Eine Methode, um die Auswirkungen der Umweltanreicherung Doppelpunkt Microbiome Biodiversitätskonvention in einem Mausmodell Doppelpunkt Tumor definieren

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Environmental Enrichment (EE) ist eine Unterbringung von Tieren, die verwendet wird, um Mechanismen zu offenbaren, die die Zusammenhänge zwischen Lebensstil, Stress und Krankheit zugrunde liegen. Dieses Protokoll beschreibt ein Verfahren, das verwendet ein Maus-Modell der Doppelpunkt Tumorgenese und EE speziell Veränderungen in Mikrobiota Artenvielfalt definieren, die tierischen Sterblichkeit auswirken können.

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mehrere neuere Studien haben gezeigt, dass die positiven Auswirkungen des Lebens in einer angereicherten Umgebung auf die Verbesserung der menschlichen Krankheit. Bei Mäusen Umweltanreicherung (EE) reduziert Tumorgenese durch die Aktivierung des Immunsystems Maus oder Tumor tragenden Tiere überleben durch die Stimulierung der Wunde Reparatur Reaktion, einschließlich der verbesserten Microbiome Vielfalt in der Mikroumgebung Tumor betrifft. Hier liegt ein detailliertes Verfahren zur Beurteilung der Auswirkungen von Umweltanreicherung auf die Biodiversität des Mikrobiom in einem Mausmodell für Darm-Tumor. Vorsichtsmaßnahmen bezüglich Tierzucht und Überlegungen für die Tier-Genotyp und Maus-Kolonie-Integration werden beschrieben, die letztendlich auf mikrobielle Artenvielfalt auswirken. Diese Vorsichtsmaßnahmen beachtet kann mehr einheitliche Microbiome Übertragung, und folglich wird lindern Nichtbehandlung abhängige Effekte, die Studienergebnisse verwirren können. Weitere, in diesem Verfahren Mikrobiota Änderungen sind mit 16 s rDNA Sequenzierung der DNA isoliert vom Hocker, gesammelt aus dem distalen Dickdarm nach langfristigen Umweltanreicherung charakterisiert. Darm Microbiota Ungleichgewicht ist verbunden mit der Entstehung von entzündlichen Darm-Krankheit und Darmkrebs, aber auch von Fettleibigkeit und Diabetes unter anderem. Wichtig ist, kann dieses Protokoll für EE und Mikrobiom Analyse genutzt werden, um die Untersuchung der Rolle von Microbiome Pathogenese über eine Vielzahl von Krankheiten, wo robuste Mausmodelle existieren, die menschliche Krankheit rekapitulieren kann.

Introduction

Umweltanreicherung (EE) Studien nutzen komplexe Gehäuse Parameter um soziale Stimulation (großes Gehäuse Käfige, größere Gruppen von Tieren), kognitive Stimulation (Hütten, Tunnel, Verschachtelung Materialien, Plattformen) und körperliche Aktivität (laufen zu beeinflussen Räder). EE ist durch viele Labore zu verstehen, die Auswirkungen der erhöhten Aktivität und verbesserte soziale und kognitive Interaktionen auf Krankheit Initiation und Progression mit einer Vielzahl von Mausmodellen, einschließlich Barbe induzierte Alopezie, Alzheimer-Krankheit verwendet worden, Rett-Syndrom und mehrere Tumor und Magen-Darm-Krankheit-Modelle1,2,3,4,5,6.

Mehrere Maus-Modelle wurden entwickelt, um Doppelpunkt Tumorgenese bei Mäusen zu studieren. Vielleicht ist das am meisten klar definierte Modell der ApcMin -Maus. Die Apc-Min -Maus wurde im Labor von William Dove in 19907entwickelt und wird als ein Maus-Modell der Mutationen im APC -gen, die häufig im Zusammenhang mit menschlichen colorectal Krebs sind. Im Gegensatz zu Menschen beherbergen APC Mutationen entwickeln ApcMin Mäuse in erster Linie kleinen Darmtumoren mit sehr seltenen Auftreten von Dickdarm-Tumoren. Ein Tcf4Het Allel mit einer einzigen Profi-Ko heterozygote Mutation im Tcf4, erhöht jedoch erheblich Doppelpunkt Tumorgenese in Kombination mit dem ApcMin -Allel-8. Vor kurzem wurde diese Maus-Modell der Doppelpunkt Tumorgenese Ermittlung die Auswirkungen von EE auf Doppelpunkt Tumorgenese6eingesetzt. Im Bice Et Al. studieren, die physiologischen und phänotypischen Auswirkungen von EE auf Männchen und Weibchen von vier verschiedenen Mauslinien (Wildtyp (WT), Tcf4Het / + Apc+ / +, Tcf4+ / + ApcMin / +, und Tcf4 Het / + APCMin / +)) definiert wurden. Vielleicht war die interessanteste Erkenntnis, dass EE wesentlich die Lebensdauer der männlichen und weiblichen Doppelpunkt Tumor-tragenden Tieren erhöht. Dies zeigte, dass EE zumindest reduzieren kann einige der Symptome verbunden mit Doppelpunkt Tumorgenese und Verbesserung der Tiergesundheit. Bemerkenswert ist, diese verbesserte Lebensdauer bei Männern ist keine direkte Folge der reduzierten Tumorgenese und stattdessen auf die Einleitung einer Tumor-Wundheilung Reaktion, einschließlich verbesserte Microbiome Biodiversität6verknüpft war.

Mehreren EE spezifische Studien wurden mit interessanten Ergebnissen veröffentlicht. Aus technischer Sicht sind wichtige Ergebnisse oft nicht übersetzbar an andere Laboratorien. Identische EE Methoden zwischen verschiedenen Labors ist ein unglaublich komplexes Thema, nicht nur wegen Bereicherung Geräte und Gehäuse eingesetzt, aber auch Bettwäsche, Essen, Belüftung, Zucht, Genetik, Aktivität in den Raum, und Tier-Protokoll Anforderungen, unter anderem9,10,11. Ein Beispiel ist Tier Integration, wo müssen Tiere stabil in der Kolonie Maus integriert werden daher Normalisierung der genetische Hintergrund und Ernährung Zusammensetzung, um verwandte Behandlungseffekte zu vermeiden. Weitere, viele EE-Studien vor der Realisierung der Bedeutung des Mikrobiom in Krankheit und die Art und Weise, dass gemeinsame Maus Haltungspraktiken können Einfluss auf die Zusammensetzung der Darm Microbiome10,12abgeschlossen wurden.

Zucht-Strategie und Tier Platzierung in EE kann Stress erhöhen, wenn Sie nicht korrekt ausgeführt. Da EE Studien viele männliche und weibliche Tiere und mehrere Genotypen nutzen, kann Versuchsaufbau schwierig sein angesichts der Forderung für Tiere aus mehreren Würfen kombiniert werden. Daher wurde eine Zucht und Entwöhnung Strategie entwickelt, damit für die Kombination der entwöhnte Tiere von der richtigen Genotyp aus verschiedenen Würfen. Der primäre Grund dafür war die Mikrobiota unter Würfe zu normalisieren und Stress zu reduzieren, wenn Tiere in die experimentelle Umgebung verschoben wurden. Das Mikrobiom wurde aus dem Damm10übertragen. Um mikrobielle Vielfalt in die Kolonie zu bieten, wurden Weibchen von Jackson Labs gekauft und in die Kolonie für einen Monat vor Beginn des Experiments9,10,12integriert. Um weitere Microbiome Biodiversität zwischen Tieren zu normalisieren, waren Frauen vor der Zucht zusammen untergebracht. Nach Zucht, kommunale Wohnraum während der Aufzucht und die Fähigkeit, entkommen verbesserte Pflege Welpen den Stress der mütterlichen Fürsorge13,14, eventuell Förderung Microbiome Normalisierung. Um zu verhindern, dass nicht-EE im Zusammenhang mit Auswirkungen auf das Mikrobiom, dieses kommunale Gehäuse alle Versuchstiere verhindert kämpfen und zusätzliche Stress, die aufgetreten sind, wenn mehrere Männchen aus verschiedenen Würfen in einem experimentellen Käfig kombiniert. Zu guter Letzt wurden paritätisch von Tieren alle Genotypen in den Käfigen. Dies bot die Gelegenheit für verbesserte Mikrobiota Biodiversität über Genotypen und entfernt den Beitrag der Koprophagie (das Tier tendenziell Hocker verbrauchen) oder möglichen Genotyp-spezifische Verhaltensunterschiede der gesamten Studie.

Dieses Protokoll sieht eine Strategie, die EE Vorgängerstudien um unbekannte Aspekte des Mikrobiom Forschung, einschließlich Mikrobiota Übertragungs- und Tier Kolonie Integration für Mikrobiota Normalisierung ermöglichen mehr einheitliche Microbiome Populationen erweitert erweitert zwischen den Versuchstieren. Beherzigen diese Vorsichtsmaßnahmen unbedingt aufgrund der Fähigkeit von Nichtbehandlung Verwandte Mikrobiota Unterschiede um Studienergebnisse zu verwirren. Beseitigung von nicht-EE bezogene Mikrobiota Änderungen, speziell die Rolle von EE auf Mikrobiota Zusammensetzung während der Entwicklung der Krankheit und das Fortschreiten definieren erlauben werden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle hier beschriebene Methoden wurden gemäß Protokollen vom institutionellen Animal Care und Nutzung Committee (IACUC) an der University of Utah genehmigt durchgeführt.

1. Versuchsanordnung und EE und Kontrolle Käfig Setup

Hinweis: Als Referenz, wird ein Überblick über das experimentelle Design dargestellt (Abbildung 1).

  1. Steuerung (NE) und EE Käfige einrichten (Abbildung 2).
    1. Um NE Käfige einzurichten, verwenden Sie autoklaviert konventioneller Ansteuerung Käfige (Tabelle 1), die Anreicherung Geräte fehlen.
    2. Bohren Sie für große Käfige ein Loch pro Käfig, der groß genug für eine Öse und einen Tunnel (Table of Materials) ist.
    3. Zum Einrichten der Aufzucht von Welpen und EE Käfige verbinden Sie zwei große autoklaviert Käfige mit einem sterilisierten Öse gesicherten Tunnel und 2 sterilisierte Plattformen Bodenfläche (Tabelle 1) zu erhöhen. EE-Experimente vorsehen Sie, sterilisierte laufen Räder, Tunnel, Iglus, Hütten, Crawl Kugeln und Verschachtelung Material innerhalb der EE-Käfige.
    4. EE und NE Käfige in einem belüfteten Rack gleich Belüftung zu platzieren.
      Hinweis: Zwei große Käfige mit 2 Plattformen (Tabelle 1) zu ermöglichen, für maximal 12 trächtige Weibchen pro Welpe Aufzucht Setup15 (siehe Tabelle der Materialien, Schritt 3.2 im Dokument und Tabelle 2).
    5. Füttern Sie Mäuse, Ad Libitum bestrahlt standard Chow und autoklaviert Umkehr-Osmose-Wasser.
    6. Bieten Sie Mäuse mit sterilen Bettzeug-Materialien.
      Hinweis: Alle Manipulationen von leeren Käfigen und Gehegen mit Tieren erfolgt in der Haube, um Kontaminationen zu vermeiden. Decken Sie für Käfig Manipulation des großen Käfigen das Loch in den Käfig mit einer Klebefolie ab.
  2. Bereiten Sie Tiere für die Zucht. Haus 15 2 - Monate altes Weibchen in einem einzigen großen Käfig (Tabelle 1) für 2 Wochen vor der Paarung zu gruppieren. Separat Haus 2 - Monate alten stellt Männer für 2 Wochen vor der Paarung.
    Hinweis: Die Anzahl der Weibchen für die Zucht ist das Experiment und die Anzahl der Tiere abhängig. In dieser Studie 15 Weibchen wurden eingesetzt um 12 verstopften Weibchen zu erhalten ist die maximale Anzahl in den Welpen Aufzucht in 1.1.2 (Tabelle 2) beschriebene Setup erlaubt.
  3. Kombinieren Sie für die Zucht Vater und Mutter Tiere pro 2 Weibchen 1 Rüde. Die erste Check-in am Morgen sollte für vaginalen Stecker, die ein visuellen Zeichen sein kann, die die Tiere in der Nacht gepaart haben.
    Hinweis: Haus Rüden und Hündinnen zusammen, bis jedes Weibchen angeschlossen hat. Ein vaginaler Stecker kann visuell identifiziert werden, wenn es extern ist.
    1. Um internalisierte Stecker zu erkennen, wird eine Sonde in die vaginale Öffnung eingefügt und wenn der vaginal Plug vorhanden ist, ist die Sonde nicht leicht einführen (16; siehe Abschnitt 4.3.6).
      Hinweis: Notieren Sie am Morgen, die, den ein Stecker als ½ Tag erkannt wird, da die Paarung in der Nacht auftrat.
    2. Sobald Frauen vaginale Stecker haben, übertragen Sie sie auf einen großen Welpen Aufzucht Käfig für Gruppenhaltung mit anderen begatteten Weibchen (Setup im Schritt 1.1.2 ohne Anreicherung Geräte).
    3. Ersetzen verpaart Weibchen mit neuen unbegatteten Gruppe untergebracht Weibchen zur Paarung und weiter Paarung um eine maximale Anzahl von Würfen in einem Zeitraum von 7 Tagen zu erhalten.
      Hinweis: Alle Tiere müssen einen Liefertermin innerhalb von 7 Tagen von einander haben.
  4. Können Sie trächtige Weibchen gebären in Gruppenhaltung, so dass alle Würfe innerhalb eines großen Welpen Aufzucht Käfig (Setup im Schritt 1.1.2 ohne Anreicherung Geräte) ausgelöst werden.
    1. Behalten Sie den Überblick Welpen Zahlen und Geburtsdaten und Genotypisierung Welpen im Alter von 7 Tagen zu beginnen.
      1. Tattoo-Welpen auf ihren Zehen in 7 Tage alt mit einem Zahlencode, sie13,17zu identifizieren.
      2. Reinigen Sie den Zeh mit 70 % Ethanol und sanft fügen Sie ein Mikro-Tattoo-Gerät mit Tinte in der Hautoberfläche parallel zur Zehe17 (siehe Tabelle der Materialien).
      3. Sammeln Sie Gewebe mit einer Schere für die Genotypisierung von den Schweif Spitzen durch Eingrabung ein kleines Stück Gewebe aus 7 - Tage alten Neugeborenen.
    2. Isolieren von genomischer DNA aus Gewebe und führen Sie PCR unter Verwendung einer herkömmlichen HotSHOT-Methode, wie beschrieben in 18.
    3. Separate Tiere nach Geschlecht bei 14-21 Tage in großen Käfigen mit Müttern.
      Hinweis: Sicherstellen Sie, dass die älteren Welpen sind in der Lage, ihre eigenen feed auf, und jüngere Welpen weiterhin bis alt genug, um ihre eigenen ernähren sich von Krankenschwester.
    4. 21-28 Tage verteilen Sie männliche und weibliche Tiere separat vom Genotyp in NE oder EE Umgebungen, und achten Sie auf gleich große Anteile von jeder Genotyp pro Käfig (Abb. 2A) zu halten.
      Hinweis: Stellen Sie sicher, dass die Gesamtzahl der Tiere in jeder NE oder EE Käfig erlaubt auf die maximale Anzahl von IACUC (Tabelle 2) erlaubt. Die NE Käfige haben höchstens 5 Tiere (Tabelle 2). In EE Käfigen für soziale Stimulation, nicht weniger als 20 und mit Raumbeschränkungen darf nicht mehr als 41 Tiere in den EE-Käfig (Tabelle 2).

(2) Hocker Sammlung 16 Wochen alt

  1. Beginnen Sie Hocker Sammlung 1 bis 2 Tage vor dem zu opfern, und sammeln Sie Hocker auf dem Tag der Opfer während der Präparation mit sterilen Werkzeugen getrennt zu.
    Hinweis: Sammeln von Hocker zur gleichen Zeit 1-2 Tage vor der Entnahme kann helfen, um den Verlust einer Probe durch die Möglichkeit zu vermeiden, dass kein Hocker zum Zeitpunkt der Sammlung vorhanden ist.
    1. Zum Sammeln von lebenden Tieren, sorgfältig Genick des Tieres über einen sauberen Käfig Hocker. Hocker mit sterilen Pinzette in eine sterile Microfuge Rohr zu sammeln.
      Hinweis: Tiere werden in der Regel beseitigen Hocker wenn immobilisiert, ermöglicht eine schnelle Hocker Sammlung direkt in ein steriles Microfuge Rohr. Wenn ein Tier nicht sofort Stuhlgang, wenn immobilisiert, legen Sie sie in einen sauberen Käfig und warten auf das Tier zu verrichten (in der Regel bis zu 1 h).
    2. Sammeln Sie Hocker auf dem Tag der Opfer.
      1. Legen Sie für euthanizing das Tier, das Tier unter einer Glasglocke mit einem kleinen Behälter mit einem Wattebausch, getränkt in Isofluran. Nach Beendigung der Atmung (in der Regel nach 2 min) beobachtet wird, legen Sie das Tier auf den Rücken Doppelpunkt Dissektion zu ermöglichen.
      2. Die Maus-Bauch 70 % igem Ethanol zuweisen.
      3. Heben Sie die Haut vor der Harnröhrenöffnung mit Zange, und mit einer Schere schneiden Sie entlang der ventralen Mittellinie bis zum Erreichen des Brustkorbs und Schneiden von der Basis des ersten Schnittes auf jedem Bein. Klappen Sie die Haut und mit einer Schere durchschneiden der peritonealen Wand in dem gleichen Muster.
      4. Verwenden Sie Pinzetten erfassen der distalen Colon am After zu zerlegen und trennen den distalen Doppelpunkt aus dem Rektum. Beim Ziehen der Doppelpunkt vertikal mit der Pinzette, mit einer Schere durchschneiden das Mesenterium des Dickdarms zu veröffentlichen.
      5. Den Doppelpunkt direkt unterhalb der Blinddarm und legen Sie es auf Filterpapier. Verwenden Sie Zange, heben Sie die Spitze der Doppelpunkt-Röhre, öffnen das Lumen damit einseitig offenen Schere eingefügt werden kann. Geschnitten Sie längs auf, distal, proximal und Spreizfuß des Doppelpunkts in Längsrichtung.
      6. Hocker aus dem distalen Dickdarm in ein steriles Microfuge Rohr mit steriler Pinzette zu sammeln.
  2. Lagern Sie Hocker bis zur Zeit der bakteriellen DNA-Isolation in einer Microfuge Röhre bei-80 ° c.
    Hinweis: Am Tag der Opfer, neben dem Hocker sammeln Sie andere Proben wie Blut, Serum, Plasma, normal und Tumorgewebe von Dickdarm und Dünndarm, Microsomen, Fettgewebe, etc.. in der Studie definierte Fragen.

(3) genomische DNA isoliert vom Hocker

Hinweis: Nutzen Sie eine kommerzielle Kit zur mikrobiellen DNA vom Hocker nach einem Hocker Erreger Erkennung Protokoll zu isolieren. Proben für die-80 ° c Gefrierschrank und Store auf Trockeneis direkt beim Wiegen zu entfernen.

  1. Bis zu 220 mg des Hockers auf eine saubere Microfuge Röhrchen mit 1,4 mL der Raumtemperatur (RT) Hocker Lyse Puffer übertragen (siehe Tabelle der Materialien).
  2. Vortex-Probe für 1 min um Feststoffe (Abbildung 2B) gründlich zu homogenisieren. Erhitzen Sie die Aussetzung bis 95 ° c für 5 min um alle Bakterien (einschließlich grampositive Bakterien) zu lösen.
  3. Vortex-Proben für 15 s und dann Zentrifuge bei 20.000 x g für 1 min um die Hocker Feststoffe pellet. Übertragen Sie überstand auf ein 2-mL Microfuge Rohr. Jede Probe zu absorbieren PCR-Inhibitoren, Wirbel, bis sich die Tablette aufgelöst hat, eine Tablette hinzu, und inkubieren Sie die Probe bei RT für 1 min.
  4. Die Probe bei 20.000 x g für 3 min Zentrifugieren und den Überstand auf eine neue Microfuge Rohr übertragen. Zentrifugieren Sie bei 20.000 x g für 3 min. aliquoten 15 μl von Proteinase K (20 mg/mL Brühe) in ein neues 1,5 mL Microfuge Rohr. Pipette 200 μl der Probe in das Rohr mit Proteinase K.
  5. Fügen Sie 200 μL des Guanidinium Chlorid Lyse Puffer am Rohr, Vortex gründlich für 15 s (siehe Tabelle der Materialien) und inkubieren Sie Probe bei 70 ° c für 10 min. Fügen Sie 200 μl Ethanol (96-100 %) an den Rohren und mischen Sie gut durch aufschütteln.
  6. Ort eine Kieselsäure basierte Spin-Spalte in der Sammlung 2-mL-Tube und gelten die Proben für die Spalte. Schließen Sie den Deckel und Zentrifuge für 1 min bei 20.000 x g.
  7. Die Spalte an eine neue 2 mL Sammelröhrchen übertragen und 500 μl Waschpuffer 1 auf die Spalte, Kappe, die Spalte und die Zentrifuge für 1 min bei 20.000 x g. Übertragung der Spalte an eine neue 2 mL Sammelröhrchen und 500 μl Waschpuffer 2 hinzufügen der Spalte hinzufügen , schließen Sie die Kappe und Zentrifuge bei 20.000 x g 3 Minuten lang.
  8. Mit dem Deckel geschlossen die Spalte an eine neue 2 mL Sammelröhrchen übertragen, und Zentrifugieren für eine zusätzliche 1 min bei 20.000 x g, passives Waschpuffer zu entfernen. Die Spalte auf einen 1,5 mL beschriftet Microfuge Rohr übertragen und eluieren Probe durch Zugabe von 200 μl der Elution Puffer mit EDTA an die Membran (siehe Tabelle der Materialien).
  9. Schließen Sie den Deckel und 1 min. Zentrifuge der Probe für 1 min bei 20.000 x g. verwerfen die Spalte bei RT inkubieren.

4. DNA Konzentrationsbestimmung und Probenvorbereitung für PCR

Hinweis: Nutzen Sie ein Fluorometer und einem handelsüblichen DsDNA fluoreszierende Assay genomische DNA-Konzentration in jeder Probe zu bestimmen (siehe Tabelle der Materialien). Der Fluoreszenzfarbstoff muss doppelte stranded DNA spezifisch binden.

  1. Bereiten Sie eine Verdünnung von 1: 200 von jeder Probe (1 µL jeder Probe in 199 µL DsDNA-master-Mix) und eine 01:50 Verdünnung der Standards. Analysieren Sie auf einem Fluorometer mit DsDNA-Einstellung.
    Hinweis: Ein hohes Volumen an DNA in PCR kann hemmende, das Volumen der DNA verwendet, muss deshalb nicht mehr als 10 % der letzte Band der PCR. Ein Fluorometer ermöglicht genaue Messung der DNA in der Probe nur DNA gebunden, der Fluoreszenzfarbstoff fluoreszieren wird, Beseitigung des möglichen Beitrags der Verunreinigungen, die letzte berechnete DNA-Konzentration. Diese genaue Quantifizierung ist essentiell für die nachgelagerte Sequenzierung Anwendung.
  2. Bereiten Sie PCR Vorlagen verdünnt, um 5 ng/μl mit dem entsprechenden Volumen von 10 mM Tris, pH 8,5, funktionierende Vorlage Aktien jeder Probe zu machen.
  3. Shop-Proben bei-20 ° C.

5. Design Primer an die 16 s gewünscht V-Regionen

  1. Design-Primer an die gewünschten V 16 s rRNA Regionen gezielt zu verstärken.
  2. Analysieren Sie Primer mit Sonde Match aus der ribosomalen Datenbankprojekt19, um die ungefähre Trefferrate für verschiedene Stämme zu bestimmen.
    Hinweis: V1-V3 Regionen veröffentlicht die aktuelle Studie verwendet Primer Bosshard vorwärts20, die auf Position 8 in der V1-Region und 533 umgekehrte21, die an Position 533 innerhalb der V3-Region bindet binden. Grundierungen müssen Überhang Adapter Sequenzen für die Indizierung enthalten.
  3. Beim Entwerfen von Grundierungen sind Adapter-Sequenzen an den 5'-enden jeweils Fibel für 16 s Metagenomik Sequenzierung Bibliothek Vorbereitung22 (Tabelle 3) empfohlen.
  4. Diese große Primer mit Patrone Reinigung zu synthetisieren. Ausgetrocknete Primer wiederherzustellen und eine PCR arbeiten Lager 1 μM in 10 mM Tris, pH 8,5 zu verdünnen.

6. Amplikons PCR V Region(en) mit Überhang Adapter Sequenzen verstärken Anhang 22

  1. Einrichten der Amplifikate PCR Reaktion Mischung wie in Tabelle 4beschrieben.
  2. Platzieren Sie eine klare PCR Platte Klebeplombe auf dem Teller und führen Sie der Amplifikate PCR mit den Parametern in Tabelle 5.
  3. (Optional) Führen Amplikons PCR-Produkte auf einem Agarosegel oder eine hohe Empfindlichkeit DNA-Test, die quantitative Messung der Amplifikate Größe ermöglicht (siehe Tabelle der Materialien).
    Hinweis: Die Größe der Amplifikate aus dieser Studie beträgt 550 bp(Abbildung 3).

(7) PCR Bereinigung mit magnetischen Beads 22

  1. Zentrifugieren der Amplifikate PCR Platte schnell bei 1.000 x g für 1 min um Kondensation zu sammeln.
    Hinweis: PCR-Röhrchen Streifen können anstelle von PCR-Platten verwendet werden, um Kontamination zu minimieren. Verwerfen Sie Rohr Deckel und nie wieder verwenden.
  2. Wirbel der magnetischen Beads zu gleichmäßig verteilen sie, und fügen Sie 20 μL der magnetischen Perlen zu jeder PCR-Amplifikate gut, dann pipette das gesamte Volumen nach oben und unten langsam 10 Mal.
  3. Inkubieren Sie bei RT 5 min. Platz die PCR-Platte auf einem Magnetstativ für 2 min bis magnetische Beads gesammelt werden und der Überstand klar ist. Entfernen und entsorgen des Überstands.
  4. Wash-Perlen mit 200 μL frisch 80 % Ethanol während die PCR-Platte auf die magnetische stehen und inkubieren Sie für 30 s bei RT auf dem magnetischen Stand. Entfernen Sie vorsichtig den überstand.
  5. Wiederholen Sie die Wäsche ein zweites Mal. Verwenden Sie nun eine feine Pipettenspitze, entfernen alle verbleibenden Ethanol aus den Vertiefungen und Luft für 10 min trocknen lassen.
  6. Die PCR-Platte aus dem Magnetstativ entfernen und Hinzufügen von 52,5 μl 10 mM Tris pH 8,5 in jede Vertiefung. Pipette und unten 10 Mal aussetzen Perlen und in 2 min bei Raumtemperatur inkubieren.
  7. Übertragen Sie die PCR-Platte auf Magnetstativ magnetische Beads zu sammeln und 50 μl des Überstands auf eine saubere PCR-Platte übertragen. Eine klare PCR Platte Klebeplombe auf die Teller legen und bei-20 ° c bis zu einer Woche aufbewahren.

8. Vorbereitung einer Platte Regelung für PCR-Index

Hinweis: Um eine V1-V3-Bibliothek zu generieren, eine zweite PCR wurde durchgeführt mit einem Index kit (siehe Tabelle der Materialien). Eine Indizierung Standardschema wurde verwendet, um eine einzigartige dual Index Kombinationen für jede Probe (Abbildung 3B und 23).

  1. Sicherzustellen, dass jede Probe eine einzigartige Kombination aus 2 Index Primer hat (d.h., dual Indizierung).

9. führen Sie Index PCR fügen Sie Barcodes auf die Adapter-Sequenzen wie beschrieben 22 .

  1. Übertragen Sie 2,5 μl des PCR-Amplifikate (saubere Amplifikate) in eine neue 96-well-Platte und Ort in einem Index Platte Vorrichtung zur Unterstützung bei der Indizierung.
  2. Ordnen Sie den Index 1 und index 2 Primer wie im Beispiel der vorbereiteten Platte Grafik (Abbildung 3B).
    Hinweis: Visuelle Hinweise dienen der um Grundierung Verwechslungen zu vermeiden: Index 2 Grundierung Röhren sollten haben weiße Mützen und klare Lösung, während Index 1 Grundierung Röhren orange Kappen und gelbe Lösung haben sollte.
  3. Montieren Sie den Index PCR Mix Reaktion, wie in Tabelle 6beschrieben. Mischen Sie, indem Sie nach oben und unten 10 Mal pipettieren. Mit einer klaren PCR Platte Klebeplombe abdecken und sammle 1.000 x g bei Raumtemperatur für 1 min zentrifugieren.
  4. Führen Sie den Index PCR unter Verwendung der Parameter in der Tabelle 7.

10. abschließende PCR Bibliothek reinigen

Hinweis: Diese PCR-Bereinigung ist identisch mit Schritt 7 oben und nutzt magnetische Beads, PCR Clean-Up des Indexes PCR22durchzuführen.

  1. Zentrifugieren Sie die PCR-Platte aus Schritt 10 schnell bei 1.000 x g für 1 min um Kondensation zu sammeln.
  2. Wirbel der magnetischen Beads zu gleichmäßig verteilen sie, und fügen Sie dann 20 μL der magnetischen Perlen zu jeder PCR-Amplifikate gut, dann pipette das gesamte Volumen nach oben und unten langsam 10 Mal zu mischen.
  3. 5 min bei RT inkubieren.
  4. Ort PCR Platte auf einem Magnetstativ für 2 min bis magnetische Beads gesammelt und überstand sind ist klar. Entfernen und entsorgen des Überstands.
  5. Wash-Perlen mit 200 μL frisch 80 % Ethanol während die PCR-Platte auf die magnetische stehen und inkubieren Sie für 30 s bei Raumtemperatur auf dem magnetischen Stand. Entfernen Sie vorsichtig den überstand.
  6. Wiederholen Sie die Wäsche ein zweites Mal.
  7. Verwenden Sie nach der zweiten Wäsche eine feine Pipettenspitze, entfernen alle verbleibenden Ethanol aus den Vertiefungen und Luft für 10 min trocknen lassen.
  8. Die PCR-Platte aus dem Magnetstativ entfernen und Hinzufügen von 52,5 μl 10 mM Tris pH 8,5 in jede Vertiefung. Pipette und unten 10 Mal aussetzen Perlen und in 2 min bei Raumtemperatur inkubieren.
  9. Übertragen Sie die PCR-Platte auf Magnetstativ magnetische Beads zu sammeln und 50 μl des Überstands auf eine saubere PCR-Platte übertragen. Eine klare PCR Platte Klebeplombe auf die Teller legen und bei-20 ° c bis zu einer Woche aufbewahren.
  10. (Optional) Führen Sie Index-PCR-Produkte auf einem Agarosegel oder eine hohe Empfindlichkeit DNA-Test, die quantitative Messung der Amplifikate Größe ermöglicht (siehe Tabelle der Materialien).
    Hinweis: Die endgültige indizierten Bibliotheksgröße aus dieser Studie wurde 668 bp (Abbildung 3C-D).

11. zu quantifizieren Sie, normalisieren Sie und bündeln Sie die indizierten Bibliotheken für die Sequenzierung

  1. Bestimmen Sie die DNA-Konzentration von jeder Probe mit einem Fluorometer und ein DsDNA fluoreszierende Assay Kit (siehe Tabelle der Materialien).
    1. Bereiten Sie eine 1: 200-Verdünnung der Probe (1 µL jeder Probe in 199 µL DsDNA master-Mix, der Puffer und Reagenz enthält) für jede der indizierten Proben und Standards (190 µL DsDNA-master-Mix und 10 µL Standard). Analysieren Sie auf einem Fluorometer mit DsDNA-Einstellung.
  2. Im Anschluss an die DNA-Konzentration-Berechnung normalisieren Sie die Bibliotheken durch die Berechnung der durchschnittlichen Bibliotheksgröße. Dazu summieren Adapter Längen, Index Längen und V Amplikons Größe von Grundierungen und anzeigen Produkte von Agarosegel, um sicherzugehen, dass die tatsächliche Größe ist ähnlich wie die berechnete Größe (sieheAbbildung 3C, 22).
    1. Alternativ nutzen Sie eine hohe Empfindlichkeit DNA-Test, die quantitative Messung des DNA-Integrität, Amplifikate Größe und Konzentration (Table of Materials, Abbildung 3D) ermöglicht.
      Hinweis: In dieser Studie wurde die durchschnittliche Bibliotheksgröße berechnet auf Zusammenfassung Adapter Längen, Index Längen und V1-V3 Amplikons Größe von Primern. Die durchschnittliche Größe war 668 bp.
    2. Konzentrationen der Proben werden mit Hilfe der Formel in Tabelle 8normalisiert.
  3. Verdünnen Sie Proben zu 4 nM und Pool 5 μL jeder 4-nM-Probe in ein einzelnes Rohr für die Sequenzierung.

12. Sequenz der Bibliothek mit einem Next Generation Sequencing-System und die Daten analysieren

  1. Reihenfolge der Bibliothek.
    Hinweis: Für diese Studie durchgeführt der University of Utah hohen Durchsatz Genomics Core Bibliothek Denaturierung und Probe-Sequenzierung (wie beschrieben in 6,22).
  2. Die Daten zu analysieren.
    Hinweis: Um Daten von Mischproben zu trennen, wurden Index liest identifiziert und getrennt (siehe 22).
  3. Generieren Sie FASTQ Dateien zu und nutzen Sie dies für anschließende Datenanalyse.

13. sequenzierten Datenanalyse aus der 16 s Amplikons Bibliothek

Hinweis: Dieser Schritt wird ausgeführt, wie im Bice Et al.beschrieben., 20176.

  1. Installieren Sie frei verfügbare Daten-Analyse-Tools (siehe Tabelle der Materialien; 24).
  2. Montieren Sie demultiplexed Fastq Dateien aus den sequenzierten Daten (wie beschrieben in25,26). Entsorgen Sie alle unmontiert Sequenzen.
  3. Analysen Sie nach einer de Novo offenen taxonomischen Einheit (OTU) Kommissionierung Protokoll (wie beschrieben in 27).
    1. Bin Sequenzen in einer einzigen Fastq-Datei von SampleID und Gruppe-Sequenzen mit 97 % oder größere Ähnlichkeit in OTUs, wie in 28beschrieben. Richten Sie repräsentative Sequenzen von Core set mit minimalen Sequenz Länge von 150 und 75 % Prozent Identität29,30. Weisen Sie Taxonomie als beschrieben28.
      Hinweis: Proben können klassifiziert und analysiert31, gefolgt von taxonomische Zuordnung und OTU Tabelle Bau32.
    2. Erstellen Sie eine Mapping-Datei, die angibt, beschreibende Namen und Eigenschaften der Proben zu verbinden Probenidentifikation und validieren die Mapping-Datei33,34.
    3. Machen Sie eine OTU-Netzwerk, die OTUs links zu Probenbeschreibungen mit einer Mapping-Datei35.
    4. Berechnen Sie durch Zusammenfassen von Taxa durch Grundstücke36Taxonomie Zusammenfassungen in Bezug auf die relative Häufigkeit.
    5. Erkunden Sie alpha-Diversität Proben bei einheitlichen Sequenzierung Tiefe zu Proben. Definieren Sie die entsprechende Tiefe für alpha-Diversität, fassen Sie insgesamt zählt beobachtet in jeder Probe mithilfe des Biom zusammenfassen-Table-Befehls, wie in 37beschrieben.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Mehrere Studien haben gezeigt, dass die Praxis des Geist-Körper-Medizin Gesundheit verbessert. Ebenso verbessert Umweltanreicherung bei Mäusen, einschließlich verbesserte Lebensdauer und Tumor Wunde Reparatur6Ergebnisse. Daher wurde eine EE-Verfahren entwickelt, mit dem Ziel der Bestimmung der Rolle der Mikrobiota in diesem Phänotyp beim ersten Normalisierung Microbiome vor Einleitung des Experiments (Abbildung 1). Wichtig ist, alle Zuchttiere sind die Maus-Kolonie für mindestens einen Monat vor Beginn der Zucht integriert und neugeborenen Welpen sind gemeinsam untergebracht mit Müttern in einem großen Käfig, Mikrobiota Übertragung vor dem Experiment zu normalisieren. Wenn Tiere zwischen 21 und 28 Tage alt sind, werden paritätisch von jeder Genotyp abgesetzt, in ihren jeweiligen Wohnungen, EE oder NE Umgebungen (Abb. 2A). 16 Wochen Hocker von allen Tieren gesammelt und homogenisiert (Abbildung 2B), gefolgt von bakterieller DNA-Isolierung. Zu guter Letzt Hocker 16 s, die Amplifikate aus verstärkt werden Microbiome DNA und Barcode indiziert, um für die Sequenzierung aller Microbiome Bibliotheken gleichzeitig ermöglichen (Abbildung 3). Die einzigartige Sequenzen identifiziert in WT und Tumor NE und EE Bedingungen Tiere eingedenk sind in Abbildung 4dargestellt. Interessanterweise EE verbessert nicht die Artenvielfalt bei Tieren WT, aber erheblich erhöht Biodiversität bei Tumor tragenden Tieren (Abbildung 4), zeigen, dass diese Methode Biodiversität Verbesserungen ermöglicht. Diese Zunahme der Artenvielfalt kann die stärkere Präsenz der Phylum zugeschrieben werden Proteobakterien, mit erheblichen steigt in den Klassen Alphaproteobakterien und Betaproteobacteria, und sinkt in pathogenen Gammaproteobacteria (Abbildung 5 ; Zusätzliche Tabelle 1). Der größte Anstieg ist in der Betaproteobacteria Klasse ist die Gattung Sutterella, ein wahrscheinlich Kommensalen sekretierten IgA Abbau (Abbildung 6, auch s.38) beteiligt.

Figure 1
Abbildung 1 : Eine Darstellung des Schnittfensters experimentelle. Die kurzen Bänder repräsentieren 7-Tage-Fenster, wie die meisten des Protokolls ist in 7-Tage-Schritten durchgeführt. Dies hilft auch in Visualisierung des Bereichs Pup Alters über das Experiment. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 : EE und NE Wohnverhältnisse und Hocker Homogenates (wie im Protokoll beschrieben). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3 : 16 s Microbiome Bibliothek Vorbereitung. (A) ungereinigten PCR Amplifikate Produkte abgeleitet aus genomischer DNA Hocker. (B) Indizierung Platte Grafik nach der verwendeten Software entwickelt (Table of Materials, 23). Die dual-Index-Kombinationen, I7 (Index 1; Zeile) und I5 (Index 2; Spalte), sind für jede Probe gezeigt. Jeder Index beträgt 8 bp lang. Die Probe-Nummern beziehen sich auf die jeweilige Maus Zahlen aus EE-Studien. (C) ungereinigten Index PCR-Produkte. (D) Qualitätsanalyse von Finale gereinigt und 16 Bibliotheken gebündelt. (A, C, D) Schwarze Pfeile bezeichnen 550 bp Amplifikate und 668 bp indizierten Bibliothek. Rote Pfeile bezeichnen unspezifische Produkte, die eliminiert werden nach Reinigung wie in D. Oberen und unteren Marker sind Größe Marker hinzugefügt, um die Probe zu Referenzzwecken Größe. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4 : Änderungen im alpha-Diversität nach EE von Tcf4Het / + ApcMin / + Tieren. Alpha-Diversität der WT und Tcf4Het / + ApcMin / + Tumor mit Tieren. Bei 20.000 mal gelesen, NE und EE WT, p= 0,64 und NE und EE von Tcf4Het / + ApcMin / +, p= 0,03 mit zwei Stichproben t-Test mit Welch Korrektur. Adaptiert von Bice Et Al., 20176. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5 : EE-vermittelte Änderungen nach EE von Tcf4Het / + ApcMin / + Tieren. R-ggplot2 erzeugte Box-Whisker-Plots für Änderungen in Hülle und Fülle der Phylum Proteobakterien und Klassen Alphaproteobakterien, Betaproteobacteria und Gammaproteobacteria. Ausreißer sind als Kreise zur Kenntnis genommen. p= 0,005 mit zwei Stichproben t-Tests mit Welch Korrektur. Fehlerbalken mit Standardfehler des Mittelwertes (SEM) berechnet. Adaptiert von Bice Et Al., 20176. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 6
Abbildung 6 : Änderungen in der relativen Fülle von Sutterella nach EE von Tcf4Het / + ApcMin / + Tieren. Ausreißer sind als Kreise zur Kenntnis genommen. p= 0,005 mit zwei Stichproben t-Test mit Welch Korrektur. Fehlerbalken berechnet mit SEM Adapted von Bice Et Al., 20176. Bitte klicken Sie hier für eine größere Version dieser Figur.

Supplemental Table 1
Zusätzliche Tabelle1: Klassifizierung von Bakterien isoliert vom Hocker aus NE und EE Mäuse gesammelt. Klassifizierung über Genotypen Phylum (A), (B) Klasse (C) bestellen, (D) Familie und Gattung (E) Ebene. Vergleiche von NE und EE des gleichen Genotyps oder WT, Tcf4Het / + ApcMin / +. P-Werte werden mit einem zwei-Stichproben-t-Test mit Welch Korrektur berechnet. Adaptiert von Bice Et Al., 20176. Bitte klicken Sie hier, um diese Datei herunterladen.

Artikel Gesamtfläche (Zoll-2) Gesamtfläche (cm2) Käfig-Größe (Zoll) L x b x H Käfig-Größe (cm) L x b x H
Ein Steuerelement Käfig (NE) 68.25 440.32 10,5 x 6,5 x 5,5 26,67 x 16,51 x 13.97
Einen großen Käfig (EE) 264.36 1706.32 13.87 x 19,06 x 7,75 35,24 x 48.42 x 19.69
Zwei große Käfige (EE) 528.72 3412.64 2 @ 13.87 x 19,06 x 7,75 2 @ 35,24 x 48.42 x 19.69
Zwei Plattformen (EE) 93 600 2 @ 11,8 x 3.94 x 2,95 2 @ 30 x 10 x 7,5
Zwei große Käfige mit zwei Plattformen (EE) 621.72 4013 2 @ 13.87 x 19,06 x 7,75 + 2 @ 11,8 x 3.94 x 2,95 2 @ 35,24 x 48.42 x 19.69 + 2 @ 30 x 10 x 7,5

Tabelle 1: EE und NE Käfig Größen und Bodenfläche.

Tiere im Käfig erlaubt Erforderliche Zoll im Quadrat pro Tier EE-Käfig-Bereich (Zoll2) Insgesamt Tiere erlaubt
Bis zu 25 12 6222 (4013 cm2) bis zu 25
25 + 15 6222 (4013 cm2) bis zu 41
Weibchen mit Wurf 51 6222 (4013 cm2) bis zu 12

Tabelle 2: Anzahl der Tiere in Käfigen basierend auf Bodenfläche erlaubt 15 .

Amplifikate PCR Primer
Nach vorne 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAgagtttgatcMtggctcag-3 "
Rückgängig zu machen 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 "
Locus spezifische Sequenzen werden fett dargestellt und die nicht Fett ist der Überhang-Adapter-Sequenz.

Tabelle 3: Amplikons PCR Zündkapseln.

Amplicon PCR-Reaktion einrichten
Volumen
Mikrobiellen DNA (5ng/μl) 2.5 µl
Primer zu übermitteln (1 μM; ab Schritt 5.1.2) 5,0 µl
Reverse Primer (1 μM; ab Schritt 5.1.2) 5,0 µl
2 x HotStart Ready Mix 12.5 μl
Insgesamt 25.0 μl

Tabelle 4: PCR Amplifikate Mix.

Amplicon PCR einrichten
95 ° C für 3 Minuten
25 Zyklen:
95 ° C für 30 Sekunden
55 ° C für 30 Sekunden
72 ° C für 60 Sekunden
72 ° C für 3 Minuten
Bei 4 ° C zu halten

Tabelle 5: Amplikons PCR-Programm eingerichtet.

Index-PCR Barcode assembly
DNA 2.5 µl
Index-Primer 1 (N7XX) 2.5 µl
Index-Primer 2 (S5XX) 2.5 µl
2 x HotStart Ready Mix 12.5 μl
PCR-Klasse Wasser 5 μl
Insgesamt 25 μl

Tabelle 6: Index PCR Mix.

Index PCR Setup
95 ° C für 3 Minuten
8 Zyklen:
95 ° C für 30 Sekunden
55 ° C für 30 Sekunden
72 ° C für 30 Sekunden
72 ° C für 5 Minuten
Bei 4 ° C zu halten
Shop bei-20 ° C

Tabelle 7: Index-PCR-Programm einrichten

Beispielformel Konzentration zur Bündelung von
(DNA-Konzentration in ng/µl) X 106 = Konzentration in nM
(660 g/Mol x durchschnittliche Bibliotheksgröße)
Ein Beispiel aus dieser Studie lautet:
(85.2 ng/µl) X 10 ^ 6 = 193,3 nM
(660 g / Mol X 668 bp)

Tabelle 8: Formel für die Normalisierung der vor der Zusammenlegung Proben

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dieses Verfahren ermöglicht die Analyse der Mikrobiota isoliert vom Hocker nach Umweltanreicherung Normal oder Tumor mit Tieren. Da das große Experimente die Zucht sind um viele Tiere unterschiedlichen Geschlechts und Genotypen zu erhalten einbeziehen, Normalisierung der Microbiome zwischen Tieren vor Beginn des Experiments ist wichtig im Zusammenhang mit nicht-EE zu vermeiden Auswirkungen auf Microbiome biologische Vielfalt.

Aus Gründen der Kohärenz zwischen NE und EE Bedingungen wird Zuchtprozesses durchgeführt, um sicherzustellen, dass alle Mäuse zunächst Kontakt mit dem gleichen Mikroben haben und daher dürften ähnliche Microbiome Inhalte haben. Es ist möglich und wahrscheinlich, dass Maus Genotyp beeinflusst Microbiome Zusammensetzung. Aus diesem Grund sind Maus Zahlen pro Genotyp Bedingungen sicher sein, dass jedes Tier, das Hocker in Anspruch nimmt eine ähnliche Vielfalt an das Mikrobiom antreffen, zwischen NE und EE gepflegt.

Mehrere Schwierigkeiten sind offensichtlich, wenn EE entwerfen experimentiert. Erstens die Gesamtzahl der Tiere, die für die Experimente benötigt ist abhängig von den experimentellen Details, aber die Gesamtzahl ist auch begrenzt durch die Anzahl der Tiere im Käfig erlaubt. Zum Beispiel Verlaufsdaten umliegenden Maus überleben in einem Vorversuch EE wurden zur Berechnung der Anzahl der Tiere, das Mechanismus zugrunde liegenden verbesserte überleben in früheren Experimenten beobachtet zu definieren. Aus diesen Daten wurden insgesamt 17 Tiere in der Vergleichsgruppe benötigt für eine 80 % macht einen Unterschied in der Überlebensrate in ein zweiseitiger t-Test zu erkennen, wo alpha = 0,05. Also, müssen 4 bis 5 Tiere in der Kontrollgruppe vs. 20-24 (oder bis zu 41) Tiere pro Käfig in der experimentellen Gruppe eine Leistungsberechnung unterbringen. Deshalb sind mehrere Kontrolle Gruppe Käfige zusammen mit den experimentellen Käfig erforderlich. Weiter, mit komplexen Genotypen ist es schwierig, ausreichende Tierzahlen jeder Genotyp zu erhalten, die große Zahl der weiblichen Zuchttiere erforderlich erfordert. Jedoch mit anderen Modellen, wo weniger transgene Unterschiede vorhanden sind, weitere Tiere des gleichen Genotyps in diesem System analysiert werden können und weniger Züchter sind notwendig. In den Vereinigten Staaten können 12 trächtige Weibchen in die 6332 Platz (Tabelle 2) untergebracht werden. Das Problem dabei ist, dass Welpen älter, sie mehr Speicherplatz belegen. Angesichts der Tatsache, dass männliche Welpen von weiblichen Welpen bei 14-21 Tagen getrennt sind, kann eine genehmigte Ausnahme Raum in bestimmten Ländern möglich sein. Andernfalls können männliche und weibliche Welpen genotypisiert werden ausgewählt und dann in einem jüngeren Alter mit Müttern unter die maximale Maus Zahlen bleiben getrennt. Es ist notwendig, um Zustimmung für diese Studien zu gewinnen und zur Einhaltung der geltenden Bestimmungen zur räumlichen Begrenzung. Schließlich ist die Zahl der Tiere notwendig, um auch kleine Unterschiede in der Zusammensetzung der Mikrobiota erkennen mit Mikrobiota, schwierig, a-priorizu berechnen. In der vorliegenden Studie deutliche Unterschiede in der Mikrobiota fanden mit 4 Tieren pro Gruppe, es ist möglich, dass die Zahl der Tiere Mikrobiota, die variabler zwischen EE Mäusen oder sind nur geringfügig verändert durch EE offenbaren würde.

Dieser Methode-Artikel beschreibt die besondere Ausrüstung und Bettwäsche, die dienen, die auf der Oberfläche erscheint nicht notwendig. Jedoch mehrere nicht-offensichtliche Probleme, die Konsistenz beeinflussen können angetroffen werden und vor dem Einschiffen auf diese sehr große, teure und zeitraubende Studien behandelt werden müssen. Ein großes Problem ist die Käfig-Belüftung. Mit einer großen Anzahl von Tieren in einem Käfig Lüftung wird ein Problem, und ist ein Thema, das meisten Forscher nicht in Betracht ziehen, wenn Sie versuchen, konsequentere Umgebungen zwischen Steuerung und experimentellen Käfige bieten. Alle Käfige in den beschriebenen Einstellungen befinden sich in einem belüfteten Schrank Lüftung über die experimentelle auszugleichen und Steuern Käfige. Dies kann nicht erfüllt werden, wenn mit diesem passen nicht in einem belüfteten Schrank Käfige. Andere Mittel zu normalisieren Belüftung zwischen experimentellen und Steuern Tiere getestet und konsequent angewendet werden könnte, aber diese Methoden werden in dieser Studie nicht untersucht. Ähnliche Probleme Konsistenz mit Bettwäsche. Im Dickdarm Krebs Modellsystem in dieser Studie verwendet, werden Tiere, die verdauungsfördernde Krankheit haben bestimmte Arten von Einstreu, schlucken vor allem Maiskolben Bettwäsche, führt zu Verdauungsstörungen Blockaden und Krankheit. Es ist wichtig, dies im Hinterkopf behalten, wenn die Tiere bekannt sind, Bettwäsche, wenn nicht anderweitig beschäftigt, wie in das Kontrollumfeld einnehmen. Dieses Phänomen und die anschließende inkonsistente gesundheitlichen Auswirkungen werden alle Daten tiefgreifend beeinflussen.

Die ribosomale 16 s-gen wurde als ein Mittel zur Bakterienpopulationen zu studieren. Es enthält neun Regionen, die genetische Variabilität, V1-V9 und eingestreuten konservierten Regionen, die zwischen Bakterienarten39relativ unverändert zum Ausdruck bringen. Insbesondere bietet die V1-V3-Region die höchste Wahrscheinlichkeit der Spezies-Ebene Identifikation39. Ähnliche V1-V3 Studien auf Colorectal Krebs (CRC) und fortgeschrittenen kolorektalen Adenom Änderungen in drei Stämme von Interesse gefunden: Bacteroidetes und Firmicuten Proteobakterien21,40,41. Es wurde auch berichtet, dass Übung kann der mikrobiellen Population zu verlagern und zu einem Anstieg der Firmicuten42 führen. Aus diesem Grund identifiziert dieser Studie Microbiome Populationen mithilfe von V1-V3 Primer nach einem 16 s metagenomischen Bibliothek Prep Protokoll22 , um die Auswirkungen der Umweltanreicherung potenziell auf diese Stämme bekannt Adenom und CRC geändert werden zu definieren. Dieses Verfahren kann geändert werden, um zu verstärken und anderen Variablen Regionen der 16 s rRNA-Gene-Sequenz. Eine Möglichkeit ist, Sonde Match zu verwenden, um die Phylogenetische Klassifizierung der Mikrobiota in der Probe zu verstehen, die von der Sonde identifiziert werden. Auf diese Weise können die Sonden auf speziell definieren und klassifizieren phylogenetisch Mikroben von Interesse ausgerichtet werden. Dies ermöglicht eine verschiedene Charakterisierung der Mikrobiota in den Stuhlproben vorhanden und kann sich herausstellen, zusätzliche EE-abhängige Änderungen in das Mikrobiom des Tumors mit Mäusen, die Progression der Erkrankung beeinflussen können.

Mit Hilfe dieses Verfahrens, die Gattung, die Sutterella als die am meisten veränderte Gattung nach EE des Tumors mit Tieren identifiziert wurde. Dieses Verfahren kann an Studien zu beherbergen, die jede Methode sollen die Auswirkungen der Störung auf Microbiome Zusammensetzung in gentechnisch veränderten Modellen menschlicher Erkrankungen analysieren nutzen angepasst werden. Beispielsweise könnte anstelle von EE, Mäuse mit Sutterella festlegen, ob Sutterella Impfung genügt, um mikrobielle Artenvielfalt zu erhöhen und Wunde Reparatur in 16 Wochen alten männlichen Tumor mit Tiere geimpft werden.

Zweifellos ist der einzigartigste Aspekt dieses Protokolls die Sorge über Normalisierung Mikrobiota vor EE und die Erhaltung Microbiome Vielfalt in der gesamten EE-Studien. Da Microbiome Studien kontinuierlich zu verbessern sind, ist es wahrscheinlich, dass robustere Methoden zur Charakterisierung der Microbiome entstehen, und die Mikrobiom Charakterisierung in diesem Protokoll wird obsolet geworden. Zum Beispiel mit der aktuellen Studie haben die Sonden verwendet, um die 16 s rRNA verstärken Voreingenommenheit, abhängig von den Sonden, die ausgewählt sind, und nicht alle Bakterien in das Mikrobiom zu charakterisieren. Die Methoden zur Erhebung und charakterisieren das Mikrobiom zweifellos verbessern, experimentiert die wesentliche Grundlage der Gestaltung und Ausführung EE während Normalisierung der das Mikrobiom dabei eine wesentliche Facette des EE-Experimente bleibt.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, dass sie keine Interessenkonflikte haben.

Acknowledgements

Wir danken B. Dalley in der University of Utah Genomik-Kern für Bibliothek Sequenzierung und K. Boucher in der University of Utah Biostatistik-Kern für statistische Beratung und Zugang zu diesen technischen Kerne vom National Cancer Institute Award P30 CA042014 unterstützt. Das beschriebene Projekt wurde von der National Cancer Institut Zuschüsse P01 CA073992 und K01 CA128891 und Huntsman Cancer Foundation unterstützt.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics