En metod för att definiera effekterna av miljömässiga berikning på kolon mikrobiomet biologisk mångfald i en musmodell kolon tumör

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Miljömässiga anrikning (EE) är en djurstallar-miljö som används för att avslöja mekanismer som ligger bakom sambanden mellan livsstil, stress och sjukdom. Det här protokollet beskriver en procedur som använder en musmodell av kolon uppkomst och EE att specifikt definiera förändringar i biologisk mångfald bakterieflora som kan påverka djurens dödlighet.

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Flera färska studier har illustrerat de positiva effekterna av att leva i en berikad miljö för att förbättra mänskliga sjukdomar. I möss, miljömässiga anrikning (EE) minskar uppkomst genom att aktivera musen immunförsvaret eller påverkar tumören uthärda djurens överlevnad genom att stimulera såret reparation svaret, inklusive förbättrad mikrobiomet mångfald, i den tumör mikromiljö. Här är ett detaljerat förfarande att bedöma effekterna av miljömässiga berikning på den biologiska mångfalden av mikrobiomet i en musmodell kolon tumör. Försiktighetsåtgärder avseende djur avel och överväganden för djurs genotyp och mus kolonin integration beskrivs, som slutligen påverkar mikrobiell biologisk mångfald. Akta dessa försiktighetsåtgärder kan tillåta mer enhetlig mikrobiomet överföring, och följaktligen kommer att lindra icke-beroende behandlingseffekter som kan förvirra studie resultaten. Vidare i den här proceduren karakteriseras bakterieflora förändringar med hjälp av 16S rDNA sekvensering av DNA isolerade från avföring samlas in från distala kolon efter långsiktiga miljömässiga anrikning. Gut bakterieflora obalans är associerade med patogenesen av upphetsande läkt sjukdom och kolon cancer, men också av fetma och diabetes bland andra. Allt kan detta protokoll för EE och mikrobiomet analys användas för att studera roll mikrobiomet patogenes över en mängd olika sjukdomar där robust musmodeller finns som kan sammanfatta mänskliga sjukdomar.

Introduction

Miljömässiga anrikning (EE) studier använda komplex bostäder parametrar för att påverka social stimulering (stora bostäder burar, större grupper av djur), kognitiv stimulering (hyddor, tunnlar, häckande material, plattformar) och fysisk aktivitet (löpande hjul). EE har utnyttjats av många labs att förstå effekterna av ökad aktivitet och förbättrade sociala och kognitiva interaktioner på sjukdom initiering och progression med en rad olika mus-modeller, inklusive barbering inducerad alopeci, Alzheimers sjukdom, Rett syndrom och flera tumör och mag sjukdom modeller1,2,3,4,5,6.

Flera musmodeller har utvecklats för att studera kolon uppkomst hos möss. Kanske är den mest väldefinierade modellen ApcMin musen. ApcMin musen utvecklades i laboratorium av William duva i 19907, och har använts som en musmodell av mutationer i APC genen som vanligen förknippas med mänskliga kolorektal cancer. I motsats till människor som härbärgerat APC mutationer, ApcMin möss primärt utveckla små intestinala tumörer, med mycket sällsynta förekomsten av kolontumörer. En Tcf4Het allel med en enda knockin-knockout heterozygot mutation i Tcf4, ökar dock kraftigt kolon tumourigenesis när den kombineras med ApcMin allel8. Nyligen, denna musmodell av kolon uppkomst har använts för att fastställa effekterna av EE på kolon tumourigenesis6. I den Bice et al. studera, fysiologiska och fenotypiska effekterna av EE på hanar och honor av fyra olika mus linjer (vildtyp (WT), Tcf4Het / + Apc+/ +, Tcf4+/ + ApcMin / +, och Tcf4 Het / + APCMin / +)) definierades. Kanske var det mest intressant fyndet att EE signifikant ökar livslängden på både manliga och kvinnliga kolon tumör-bärande djur. Detta visade att EE kan åtminstone minska några av symptomen associerade med kolon uppkomst och förbättra djurhälsan. Anmärkningsvärt, detta förbättrad livslängd hos hanar är inte ett direkt resultat av minskad uppkomst, och istället var kopplad till inledandet av en tumör sårläkning svar, inklusive förbättrad mikrobiomet biologisk mångfald6.

Flera EE särskilda studier har publicerats med intressanta resultat. Ur en teknisk synvinkel är viktiga resultat dock ofta inte översättas till andra laboratorier. Att upprätthålla identiska EE metoder mellan olika laboratorier är en otroligt komplicerad fråga, inte bara på grund av anrikning enheter och bostäder används, men också sängkläder, mat, ventilation, avel, genetik, aktivitet i rummet, och djurs protokoll krav, bland annat9,10,11. Ett exempel är animaliska integration, där djur måste vara stabilt integreras i mus kolonin, därför normalisera genetisk bakgrund och kost sammansättning, för att undvika icke-behandling relaterade effekter. Vidare, många EE studier har slutförts före förverkligandet av vikten av mikrobiomet i sjukdomen, och sättet att vanliga mus djurhållningspraxis kan påverka sammansättningen av gut mikrobiomet10,12.

Avel strategi och djur placering i EE kan öka stress om inte utförts korrekt. Eftersom EE studier utnyttja stora mängder både manliga och kvinnliga djur och flera genotyper, kan experiment vara svårt med tanke på kravet på djur från flera kullar kombineras. Därför utvecklades en avel och avvänjning strategi att för att kombinera avvanda djur av rätt genotypen från olika kullar. Den primära grunden för detta var att normalisera bakterieflora bland kullar och minska stress när djuren flyttades till experimentella miljön. Mikrobiomet överfördes från dam10. För att ge mikrobiell mångfald till kolonin, honor köptes från Jackson Labs och integrerat in i kolonin för en månad innan experimentet började9,10,12. För att ytterligare normalisera mikrobiomet biologisk mångfald mellan djur, var kvinnor samtidig inhysta före avel. Efter avel, kommunala bostäder under uppfödning och förmågan att fly förbättrad omvårdnad pups stressnivån mödravård13,14, eventuellt främja mikrobiomet normalisering. För att förhindra icke-EE relaterade effekter på microbiom, denna gemensamma bostäder av alla experimentella djur förhindras kämpar och ytterligare stress som inträffade när du kombinerar flera hanar från olika kullar i en experimentell bur. Slutligen ingick lika antal djur av alla genotyper i burarna. Detta gav möjligheten för förbättrad bakterieflora biologisk mångfald över genotyper, och bort bidrag coprophagia (djurets tendens att konsumera avföring) eller möjligt genotyp-specifik beteendemässiga skillnader till den övergripande studien.

Detta protokoll ger en strategi som expanderar tidigare EE studier att omfatta kända aspekter av mikrobiomet forskning, inklusive bakterieflora överföring och djur kolonin integration för bakterieflora normalisering, aktivera mer enhetlig mikrobiomet populationer mellan försöksdjur. Akta dessa försiktighetsåtgärder är nödvändiga på grund av icke-behandling relaterade bakterieflora skillnader förmåga att blanda ihop studie resultaten. Att eliminera icke-EE relaterade bakterieflora förändringar kommer att göra det möjligt för forskare att specifikt definiera rollen som EE på bakterieflora sammansättning under sjukdomsutvecklingen och progression.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alla metoderna som beskrivs här har utförts i enlighet med protokoll som godkänts av institutionella djur vård och användning kommittén (IACUC) vid University of Utah.

1. försöksplanering och EE och bur inställningar

Obs: För referens, en disposition av experimentell design illustreras (figur 1).

  1. Ställa in kontroll (NE) och EE burar (figur 2).
    1. Ställ in NE burar, Använd Ånghärdad konventionella kontroll burar (tabell 1) som saknar anrikning enheter.
    2. För stora burar, borra ett hål per bur som är tillräckligt stor för att rymma en skyddshylsa och tunnel (Tabell för material).
    3. Ställ in valp uppfödning och EE burar, ansluta två stora Ånghärdad burar med en steriliserad genomföringen säkrade tunnel och 2 steriliserad plattformar att öka golvyta (tabell 1). För EE experiment, tillhandahålla steriliserad kör hjul, tunnlar, igloos, hyddor, crawl bollar och häckande material inom EE burar.
    4. Placera både EE och NE burar i ett ventilerat rack att ge lika ventilation.
      Obs: Två stora burar med 2 plattformar (tabell 1) möjliggör maximalt 12 dräktiga hondjur per valp uppfödning inställning15 (se Tabell för material, steg 3,2 i dokument och tabell 2).
    5. Mata möss ad libitum bestrålade standard chow och autoklaveras omvänd osmos vatten.
    6. Ge möss med steril sängkläder material.
      Obs: Alla manipulationer av tomma burar och burar med djur måste göras i huven för att förhindra kontaminering. För bur manipulering av stora burar, täcka hålet i buren med en självhäftande film.
  2. Förbereda djur för avel. Grupp hus 15 2 - månader gamla Honor i en enda stor bur (tabell 1) för 2 veckor före parning. Separat hus 2 - månader gammal littermate hanar 2 veckor före parning.
    Obs: Antalet hondjur i avel är beroende av experimentet och antalen djur som krävs. I denna studie 15 kvinnor utnyttjades för att erhålla 12 inkopplad kvinnor, vilket är maximalt antalet tillåtna i pup uppfödning setup som beskrivs i 1.1.2 (tabell 2).
  3. För avel, kombinera sire och dam djur, 1 hane per 2 honor. Den första kontrollen på morgonen bör för vaginal pluggar, som kan vara visuella tecken som djuren har parat under natten.
    Obs: Hus hanar och honor tillsammans tills varje kvinna har ansluten. En vaginal plugg kan identifieras visuellt, om det är externa.
    1. För att upptäcka internaliserade pluggar, infogas en sond i slidöppningen och om vaginal kontakten finns sonden enkelt infogas inte (16; se avsnitt 4.3.6).
      Obs: Spela in på morgonen som en plugg identifieras som ½ dag, sedan parning inträffade i natt.
    2. När honorna har vaginal pluggar, överföra dem till en stor valp uppfödning bur för gruppboende med andra Parade honor (Setup i steg 1.1.2 utan berikning enheter).
    3. Ersätt parad honor med nya individer gruppen inrymt Honor för parning och fortsätta parning för att få ett maximalt antal kullar i en 7-dagarsperiod.
      Obs: Alla djur måste ha ett leveransdatum inom 7 dagar efter varandra.
  4. Kan gravida kvinnor att föda i gruppen bostäder så att alla kullar föds upp inom en stor valp uppfödning bur (Setup i steg 1.1.2 utan berikning enheter).
    1. Håll koll på pup siffror och födelsedatum, och börja genotypning ungar på 7 dagars ålder.
      1. Tatuering valpar på tårna på 7 dagar med en nummerkod att identifiera dem13,17.
      2. Rengör tån med 70% etanol och försiktigt in en micro-tatuering enhet som innehåller bläck till hudytan parallell till tå17 (se Tabell för material).
      3. Samla vävnad med sax för genotypning från svans tips genom öppning av en liten bit vävnad från 7 - dag-gammal nyfödda.
    2. Isolera genomiskt DNA från vävnad och utför PCR med en konventionell HotSHOT metod som beskrivs i 18.
    3. Separat djur efter kön på 14-21 dagar i stora burar med mödrar.
      Obs: Se till att äldre valparna ska kunna livnära sig på sina egna, och att yngre valpar fortsätter att sjuksköterska tills gamla nog att livnära sig på sina egna.
    4. 21-28 dagar, fördela manliga och kvinnliga djur separat av genotyp i NE eller EE miljöer, se till att hålla lika proportioner av varje genotyp per bur (figur 2A).
      Obs: Se till att det totala antalet djur som tillåts i varje NE eller EE bur baseras på det maximala antalet tillåtna av IACUC (tabell 2). NE burar har högst 5 djur (tabell 2). I EE burar, för social stimulans, inte mindre än 20, och utrymme begränsningar, bör inte mer än 41 djur tillåtas i EE buren (tabell 2).

2. pall samling vid 16 veckors ålder

  1. Påbörja pall samling 1 till 2 dagar före att offra, och separat samla avföring på dagen för offer under dissektion med sterila verktyg.
    Obs: Samlande pall på samma gång 1-2 dagar före samlingen kan bidra till att undvika förlust av ett prov på grund av möjligheten att ingen pall är närvarande vid tiden för insamling.
    1. Att samla pall från levande djur, noggrant kragen djuret över en ren bur. Samla in pall med steril pincett till ett sterilt mikrofugrör.
      Obs: Djur kommer vanligtvis eliminera avföring när orörlig, vilket möjliggör snabb pall samling direkt i en steril mikrofugrör. Om ett djur inte omedelbart bajsa när orörlig, placera det i en ren bur och vänta för djuret att uträtta sina behov (normalt upp till 1 h).
    2. Samla in pall på dagen för offer.
      1. För euthanizing djuret, placera djuret i en glaskupa som innehåller en liten behållare med en bomullstuss indränkt i isofluran. När andningsstopp observeras (vanligtvis efter 2 min), låg djuret på ryggen att tillåta kolon dissektion.
      2. Gälla mus buken 70% etanol.
      3. Lyfta huden anterior urinrörets med pincett, använd sax för att klippa längs ventrala mittlinjen tills de når bröstkorgen och skär från basen av första snittet mot varje ben. Vik tillbaka huden och använd sax för att klippa genom peritoneal väggen i samma mönster.
      4. Använd tången för att greppa distala kolon vid anus att dissekera och lossa det distala kolonet från ändtarmen. Samtidigt som du drar Använd kolon vertikalt med pincett, sax för att klippa genom tarmkäxet att släppa kolon.
      5. Skär tjocktarmen precis nedanför blindtarmen och lägga den på filterpapper. Använd tången för att lyfta toppen av kolon röret, öppna lumen för att tillåta en sida öppen sax ska infogas. Skär längdriktningen, distala och proximala, splay öppna kolon på längden.
      6. Samla in pall från distala kolon i ett sterilt mikrofugrör med steril pincett.
  2. Store pall i ett mikrofugrör vid-80 ˚C tills tid av bakteriell DNA isolering.
    Obs: På dagen för offer, förutom avföring, samla andra prover som helblod, serum, plasma, normal och tumörvävnad från tjocktarmen och tunntarmen, mikrosomer, fettvävnad, etc. att hantera definierade frågor i studien.

3. genomiskt DNA isolering från pall

Obs: Utnyttja ett kommersiella kit för att isolera mikrobiell DNA från avföring efter en pall patogen detection protocol. Ta bort prover direkt för-80 ˚C frys och store på torris samtidigt väger.

  1. Överför upp till 220 mg pall till en ren mikrofugrör med 1,4 mL lyseringsbuffert rumstemperatur (RT) pall (se Tabell för material).
  2. Vortex prov för 1 min att grundligt homogenisera fasta ämnen (figur 2B). Värm suspensionen till 95 ˚C för 5 min att lysera alla bakterier (inklusive grampositiva bakterier).
  3. Vortex prover för 15 s och sedan Centrifugera vid 20 000 x g i 1 min till pellet pall fasta ämnen. Överför supernatanten till ett 2-mL mikrofugrör. Lägga till en tablett i varje prov att absorbera PCR-hämmare, vortex tills tabletten är upplöst, och inkubera provet vid RT för 1 min.
  4. Centrifugera provet vid 20 000 x g i 3 min och överför supernatanten till ett nytt mikrofugrör. Centrifugera vid 20 000 x g i 3 min. alikvotens 15 μL av proteinas K (20 mg/mL lager) till en ny 1,5 mL mikrofugrör. Tillsätt 200 μL av provet i röret innehållande proteinas K.
  5. Tillsätt 200 μl av guanidinium klorid lyseringsbuffert till röret, vortex grundligt för 15 s (se Tabell av material) och inkubera provet vid 70 ° c för 10 min. Tillsätt 200 μl etanol (96-100%) till rören och blanda väl genom vortexa.
  6. Plats en kvarts baserat spin kolumn i en 2 mL collection tube och tillämpa proverna till kolumnen. Stäng locket och Centrifugera i 1 min vid 20 000 x g.
  7. Flytta kolumnen till en ny 2 mL samling tub och tillsätt 500 μL tvättbuffert 1 till kolumnen, cap den kolumn och Centrifugera i 1 min vid 20 000 x g. överföring kolumnen till en ny 2 mL samling tub och tillsätt 500 μL tvättbuffert 2 till kolumnen , Stäng locket och centrifugera vid 20 000 x g under 3 minuter.
  8. Med locket stängt, överföra kolumnen till ett nytt 2 mL samling rör och Centrifugera i en ytterligare 1 min vid 20 000 x g ta bort resterande tvättbuffert. Flytta kolumnen till ett 1,5 mL märkt mikrofugrör och eluera provet genom att lägga till 200 μL av eluering buffert innehållande EDTA till membranet (se Tabell för material).
  9. Stäng locket och inkubera vid RT i 1 min. Centrifugera provet i 1 min vid 20 000 x g. Kassera kolumnen.

4. DNA koncentrationen beslutsamhet och preparering av prov för PCR

Obs: Utnyttja en fluorometer och en kommersiellt tillgänglig dsDNA fluorescerande analysen att bestämma genomisk DNA-koncentration i varje prov (se Tabell för material). Den fluorescerande färgämnen måste binda dubbel stranded DNA specifikt.

  1. Förbereda en 1: 200 utspädning av varje prov (1 µL av varje prov i 199 µL dsDNA master mix) och 1:50 utspädning av standarder. Analysera på en fluorometer med inställningen dsDNA.
    Obs: En hög volym av DNA i PCR kan vara hämmande, därför volymen av DNA som används får inte mer än 10% av den slutliga volymen av PCR. En fluorometer kan exakt mätning av DNA i provet, som endast DNA bunden till den fluorescerande färgämnen kommer fluorescerar, eliminera det möjliga bidraget av föroreningar till den slutliga beräknade DNA-koncentrationen. Denna nivå av noggrann kvantitering är viktigt för efterföljande sekvensering tillämpningen.
  2. Förbered PCR mallar spädd till 5 ng/μl med lämplig volym av 10 mM Tris, pH 8,5 att göra fungerande mall lager av varje prov.
  3. Lagra prover vid-20 ° C.

5. design grundfärger till 16S önskas V regioner

  1. Design grundfärger att selektivt förstärka önskade V 16S rRNA regionerna.
  2. Analysera grundfärger med Probe Match, från Ribosomal databasprojektet19, för att bestämma den ungefärliga träffsäkerheten för olika phyla.
    Obs: För V1-V3 regioner publicerade den aktuella studien används grundfärger Bosshard framåt20, som binder på 8 plats inom regionen V1 och 533 omvänd21, som binder vid position 533 inom regionen V3. Primers innehålla överhäng adapter sekvenser för indexering.
  3. När du utformar primers, omfatta adapter sekvenser i 5' ändarna av varje primer, som rekommenderas för 16S metagenomik sekvensering bibliotek förberedelse22 (tabell 3).
  4. Syntetisera dessa stora grundfärger med patron rening. Bered desiccated primers och späd en PCR arbetar beståndet att 1 μM i 10 mM Tris, pH 8.5.

6. amplikon PCR att förstärka V regionerna med överhäng Adapter sekvenser kopplade 22

  1. Ställa in ospädd PCR-reaktionsblandning som beskrivs i tabell 4.
  2. Placera en självhäftande tydlig PCR-plattan sigill på plattan och kör ospädd PCR med parametrar i tabell 5.
  3. (Valfritt) Kör amplikon PCR-produkter på en agarosgel eller en högkänslig DNA-analysen som möjliggör kvantitativ mätning av kopiestorlek (se Tabell för material).
    Obs: Kopiestorlek från denna studie är 550 bp (figur 3A).

7. PCR Cleanup använder magnetiska pärlor 22

  1. Centrifugera amplikon PCR-plattan snabbt vid 1 000 x g för 1 min att samla kondens.
    Obs: PCR-röret remsor kan användas istället för PCR-plattor för att minimera kontaminering. Kassera tube lock och aldrig återanvända.
  2. Vortex magnetiska pärlor för att jämnt skingra dem, och tillsätt 20 μL av magnetiska pärlor till varje amplikon PCR väl, sedan Pipettera hela volymen upp och ned sakta 10 gånger.
  3. Inkubera vid RT för 5 min. plats PCR-plattan på en magnetisk stå för 2 min tills magnetiska pärlor samlas och supernatanten är tydlig. Avlägsna och Kassera supernatanten.
  4. Tvätta pärlor med 200 μL färska 80% etanol medan PCR-plattan är på den magnetiska stå och inkubera i 30 s vid RT på magnetiska stativet. Ta försiktigt bort supernatanten.
  5. Upprepa tvätten för en andra gång. Nu Använd en fin pipettspetsen ta bort eventuella kvarvarande etanol från brunnarna och tillåta lufttorkning i 10 min.
  6. Ta bort PCR-plattan från magnetiska stativet och tillsätt 52,5 μL 10 mM Tris pH 8.5 till varje brunn. Pipettera upp och ner 10 gånger att upphäva pärlor och odla i rumstemperatur i 2 min.
  7. Överföra PCR-plattan till den magnetisk stå att samla magnetiska pärlor och överföra 50 μL av supernatanten till en ren PCR-plattan. Placera en självhäftande tydlig PCR-plattan sigill på plattan och förvaras vid-20 ° c i upp till en vecka.

8. utarbetandet av ett system för plattan för Index PCR

Obs: Generera ett V1-V3-bibliotek, en andra PCR utfördes med ett index kit (se Tabell för material). Ett standard indexering system användes för att kartlägga unika dubbla index kombinationer för varje prov (figur 3B och 23).

  1. Se till att varje prov har en unik kombination av 2 index primers (dvsdubbla indexering).

9. utför Index PCR bifoga streckkoder till adapter sekvenser som beskrivs 22 .

  1. Överföra 2,5 μl av PCR-amplikoner (ren amplikoner) till en ny 96 väl platta och plats i ett index plattan fixtur till stöd i indexering.
  2. Ordna index 1 och index 2 primers som i exemplet av beredda plattan grafiken (figur 3B).
    Obs: Visuella referenser finns för att undvika primer misstag: index 2 primer rören bör har vita mössor och klar lösning, medan index 1 primer rören bör ha orange lock och gul lösning.
  3. Montera indexet PCR-Mix reaktion som beskrivs i tabell 6. Blanda genom pipettering upp och ner 10 gånger. Täck med en självhäftande tydlig PCR-plattan tätning och centrifugera för att samla in 1 000 x g i rumstemperatur i 1 min.
  4. Kör index PCR med parametrar i tabell 7.

10. rena sista PCR bibliotek

Obs: Detta PCR-sanering är identisk med steg 7 ovan, och använder magnetiska pärlor för att utföra PCR Clean-Up av indexet PCR-22.

  1. Centrifugera PCR-plattan från steg 10 snabbt vid 1 000 x g för 1 min att samla kondens.
  2. Vortex magnetiska pärlor för att sprida ut dem jämnt och tillsätt 20 μL av magnetiska sedan pärlor till varje amplikon PCR, pipett sedan hela volymen upp och ned sakta 10 gånger för att blanda.
  3. Inkubera vid RT i 5 min.
  4. Plats PCR-plattan på en magnetisk stå för 2 min tills magnetiska pärlor är insamlade och supernatanten är klart. Avlägsna och Kassera supernatanten.
  5. Tvätta pärlor med 200 μL färska 80% etanol medan PCR-plattan är på den magnetiska stå och inkubera i 30 s vid rumstemperatur på magnetiska stativet. Ta försiktigt bort supernatanten.
  6. Upprepa tvätten för en andra gång.
  7. Efter den andra tvätten, Använd en fina pipettspetsen att avlägsna eventuella kvarvarande etanol från brunnarna och låt lufttorkning för 10 min.
  8. Ta bort PCR-plattan från magnetiska stativet och tillsätt 52,5 μL 10 mM Tris pH 8.5 till varje brunn. Pipettera upp och ner 10 gånger att upphäva pärlor och odla i rumstemperatur i 2 min.
  9. Överföra PCR-plattan till den magnetisk stå att samla magnetiska pärlor och överföra 50 μL av supernatanten till en ren PCR-plattan. Placera en självhäftande tydlig PCR-plattan sigill på plattan och förvaras vid-20 ° c i upp till en vecka.
  10. (Valfritt) Kör index PCR-produkter på en agarosgel eller en högkänslig DNA-analysen som möjliggör kvantitativ mätning av kopiestorlek (se Tabell för material).
    Obs: Den slutliga indexerade bibliotek storleken från denna studie var 668 bp (figur 3C-D).

11. kvantifiera, normalisera och Pool indexerade bibliotek för sekvensering

  1. Bestämma DNA koncentrationen av varje prov med en fluorometer och en dsDNA fluorescerande assay kit (se tabell för material).
    1. Förbereda en 1: 200 utspädning av provet (1 µL av varje prov i 199 µL dsDNA master mix, som inkluderar buffert och reagens) för varje indexerade prover och standarder (190 µL dsDNA huvudmixen och 10 µL av standard). Analysera på en fluorometer med inställningen dsDNA.
  2. Efter DNA koncentrationen beräkningen, normalisera biblioteken genom att beräkna den genomsnittliga bibliotek storleken. Gör detta genom att summera adapter längder, index längder och V kopiestorlek från grundfärger, och Visa produkter av agarosgel för att vara säker på att den faktiska storleken är liknande till den beräknade storlek (figur 3C, se 22).
    1. Alternativt kan du utnyttja en högkänslig DNA-analysen som möjliggör kvantitativ mätning av DNA integritet, kopiestorlek och koncentration (tabell för material, figur 3D).
      Obs: I denna studie var den genomsnittliga bibliotek storleken beräknas baserat på summera adapter längder, index längder och V1-V3 kopiestorlek från grundfärger. Den genomsnittliga storleken var 668 bp.
    2. Koncentrationer av prover är normaliserade med hjälp av formeln i tabell 8.
  3. Späd prover till 4 nM och pool 5 μL från varje 4-nM prov till ett enda rör för sekvensering.

12. sekvens biblioteket använder en Nästa Generation Sequencing System och tolka Data

  1. Sekvens i biblioteket.
    Obs: För denna studie utförs på University of Utah hög genomströmning Genomics Core bibliotek denaturering och prov sekvensering (som beskrivs i 6,22).
  2. Tolka data.
    Obs: För att separera data från poolade prover, index läsningar identifierades och separerade (enligt beskrivningen i 22).
  3. Generera FASTQ filer och använda detta för efterföljande dataanalys.

13. analysera sekvenserade Data från 16S amplikon biblioteket

Obs: Detta steg utförs enligt beskrivningen i Bice et al., 20176.

  1. Installera fritt tillgängliga dataanalysverktyg (se Tabell för material; 24).
  2. Montera demultiplexed fastq filer från sekvenserade data (som beskrivs i25,26). Kassera alla omonterad sekvenser.
  3. Utföra analyserna efter en de novo öppen taxonomiska enheten (OTU) plocka protokoll (som beskrivs i 27).
    1. Bin sekvenser i en enda fastq fil av provgivarID och gruppen sekvenser med 97% eller större likhet i OTUs, som beskrivs i 28. Justera representativa sekvenser av core set med minsta sekvens längd 150 och 75% procent identitet29,30. Tilldela taxonomin som beskrivs28.
      Obs: Prover kan kastas och analyserat31, följt av taxonomiska tilldelning och OTU tabell konstruktion32.
    2. Skapa en avbildningsfil som identifierar beskrivande namn och egenskaper av prover att länka till exempel identifiering och validera den kartläggning fil33,34.
    3. Gör en OTU nätverk som länkar OTUs till provet beskrivningar med hjälp av en kartläggning fil35.
    4. Beräkna taxonomi sammanfattningar i form av relativa överflöd genom att summera taxa genom tomter36.
    5. Utforska alfa mångfald av prover på enhetliga sekvensering djup lämpligt att prover. För att definiera lämpliga djupet för alfa mångfald, sammanfatta totalt räknas som observerats i varje prov med kommandot biome sammanfatta-tabell, som beskrivs i 37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Flera studier har visat att öva av kropp-själ-medicin förbättrar hälsoresultat. Likaså hos möss förbättrar miljömässiga anrikning resultat bland annat förbättrad livslängd och tumör sår reparation6. Därför utvecklades ett EE förfarande med syftet att definiera rollen av bakterieflora i denna fenotyp medan första normalisera mikrobiomet före inledandet av experimentet (figur 1). Ännu viktigare, alla avelsdjur är integrerade i mus kolonin för minst en månad före inledandet av avel och nyfödda valpar är samtidig inhysta med mödrar i en stor bur att normalisera bakterieflora överföring före experimentet. När djur är mellan 21 och 28 dagar gammal, är lika många av varje genotyp avvanda in i deras respektive bostäder, antingen EE eller NE miljöer (figur 2A). På 16 veckor, pall från alla djur samlas och homogeniserad (figur 2B), följt av bakteriell DNA isolering. Slutligen, 16S amplikoner förstärks från pall mikrobiomet DNA och streckkod indexeras för att möjliggöra för sekvensering av alla mikrobiomet bibliotek samtidigt (figur 3). De unika sekvenser som identifierats i WT och tumör med djur både NE och EE villkor visas i figur 4. Intressant, EE förbättrar inte den biologiska mångfalden i WT djur, men ökar kraftigt den biologiska mångfalden i tumör-bärande djur (figur 4), visar att denna metod kan biologisk mångfald förbättringar. Denna ökning av biologisk mångfald kan hänföras till ökade närvaro Kongospråken Proteobacteria, med betydande ökningar i klasserna Alphaproteobacteria och Betaproteobacteria, och minskningar patogena Gammaproteobacteria (figur 5 ; Kompletterande tabell 1). Den största ökningen är i Betaproteobacteria klass är släktet Sutterella, en sannolikt kommensala inblandade i utsöndrade IgA nedbrytning (figur 6, också se38).

Figure 1
Figur 1 : En representation av experimentella tidslinjen. De korta banden representerar 7-dagars windows, eftersom de flesta av protokollet är fulländad i 7-dagars steg. Detta hjälpmedel också visualisering av spänna av pup åldrar över experimentet. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : EE och NE bostäder villkor och pall homogenates (som beskrivs i protokollet). Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : 16S mikrobiomet bibliotek förberedelse. (A) orenat PCR-amplikon produkter som härrör från pall genomiskt DNA. ()B) indexering plattan grafisk utformade enligt den programvara som används (Tabell för material, 23). Dubbla index kombinationer, I7 (Index 1. Rad) och I5 (Index 2. Kolumn), visas för varje prov. Varje index är 8 bp i längd. Prov siffrorna hänvisar till respektive mus siffrorna från EE studier. (C) orenat Index PCR-produkter. (D) kvalitetsanalys av slutliga renas och poolade 16S bibliotek. (A, C, D) Svarta pilar beteckna 550 bp amplikon och 668 bp indexerade bibliotek. Röda pilar beteckna icke-specifika produkter som elimineras efter rening som i D. Övre och nedre markörer är storlek markörer tillsätts provet för storleksreferens. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 : Ändringar i alfa mångfald efter EE av Tcf4Het / + ApcMin / + djur. Alpha mångfald av WT och Tcf4Het / + ApcMin / + tumör med djur. På 20 000 läsningar, NE och EE av WT, p= 0,64 och NE och EE av Tcf4Het / + ApcMin / +, p= 0,03 med två-sampel t-test med Welch korrigering. Anpassad från Bice et al., 20176. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5 : EE-medierad förändringar efter EE av Tcf4Het / + ApcMin / + djur. R-ggplot2 genereras box-whisker tomter som betecknar förändringar i överflöd av fylum Proteobacteria och klasserna Alphaproteobacteria, Betaproteobacteria och Gammaproteobacteria. Extremvärden noteras som cirklar. p= 0,005 med två-sampel t-test med Welch korrigering. Felstaplar som är beräknade med hjälp av standardavvikelsen för medelvärdet (SEM). Anpassad från Bice et al., 20176. Klicka här för att se en större version av denna siffra.

Figure 6
Figur 6 : Förändringar i det relativa överflödet av Sutterella efter EE av Tcf4Het / + ApcMin / + djur. Extremvärden noteras som cirklar. p= 0,005 med två-sampel t-test med Welch korrigering. Felstaplar som är beräknade med hjälp av SEM. anpassas från Bice et al., 20176. Klicka här för att se en större version av denna siffra.

Supplemental Table 1
Kompletterande Tabell1: klassificering av bakterier isolerade från avföring samlas in från NE och EE möss. Klassificering över genotyper på (A) stam, klass (B), (C) ordning, (D) familj och (E) släktet nivå. Jämförelser av NE och EE av samma genotyp eller WT till Tcf4Het / + ApcMin / +. P-värden är beräknade med ett två-sampel t-test med Welch korrigering. Anpassad från Bice et al., 20176. Vänligen klicka här för att hämta den här filen.

Objekt Total yta (tum2) Total yta (cm2) Cage storlek (tum) L x b x H Cage storlek (cm) L x b x H
En kontroll bur (NE) 68,25 440.32 10,5 x 6,5 x 5,5 26,67 x 16,51 x 13,97
En stor bur (EE) 264.36 1706.32 13.87 x 19.06 x 7.75 35.24 x 48.42 x 19,69
Två stora burar (EE) 528.72 3412.64 2 @ 13.87 x 19.06 x 7.75 2 @ 35.24 x 48.42 x 19,69
Två plattformar (EE) 93 600 2 @ 11,8 x 3,94 x 2,95 2 @ 30 x 10 x 7,5
Två stora burar med två plattformar (EE) 621.72 4013 2 @ 13.87 x 19.06 x 7.75 + 2 @ 11,8 x 3,94 x 2,95 2 @ 35.24 x 48.42 x 19,69 + 2 @ 30 x 10 x 7,5

Tabell 1: EE och NE Cage storlekar och golvyta.

Djur tillåtna i bur Krävs Inches kvadrat Per djur EE burarean (tum2) Totala husdjur
Upp till 25 12 622 i2 (4013 cm2) upp till 25
25 + 15 622 i2 (4013 cm2) upp till 41
Hona med kull 51 622 i2 (4013 cm2) upp till 12

Tabell 2: tillåtet antal djur i burar baserat på golvyta 15 .

Amplikon PCR Primers
Framåt 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3 '
Omvänd 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 '
Locus specifika sekvenser visas i fetstil och det icke-fet är överhäng adapter sekvensen.

Tabell 3: amplikon PCR Primers.

Amplicon PCR reaktionen ställa in
Volym
Mikrobiell DNA (5ng/μl) 2,5 µl
Vidarebefordra Primer (1 μM; från kliver 5.1.2) 5.0 μl
Reverse Primer (1 μM; från kliver 5.1.2) 5.0 μl
2 x HotStart Ready Mix 12.5 µl
Totalt 25,0 μl

Tabell 4: PCR-amplikon Mix.

Amplicon PCR ställa in
95 ° C i 3 minuter
25 cykler av:
95 ° C i 30 sekunder
55 ° C i 30 sekunder
72 ° C i 60 sekunder
72 ° C i 3 minuter
Håll vid 4 ° C

Tabell 5: PCR-amplikon programmet in.

Index PCR streckkod församling
DNA 2,5 µl
Indexera Primer 1 (N7XX) 2,5 µl
Indexera Primer 2 (S5XX) 2,5 µl
2 x HotStart Ready Mix 12.5 µl
PCR-grade vatten 5 μl
Totalt 25 μl

Tabell 6: Index PCR-Mix.

Index PCR-Setup
95 ° C i 3 minuter
8 cykler av:
95 ° C i 30 sekunder
55 ° C i 30 sekunder
72 ° C under 30 sekunder
72 ° C i 5 minuter
Håll vid 4 ° C
Förvaras vid-20 ° C

Tabell 7: Index PCR-Program ställa upp

Exempelformel koncentration för poolning
(DNA-koncentration i ng/µL) x 106 = koncentration i nM
(660 g/mol x genomsnittliga bibliotek storlek)
Ett exempel från denna studie är:
(85,2 ng/µL) x 10 ^ 6 = 193,3 nM
(660 g / mol x 668 bp)

Tabell 8: formel för att normalisera innan samla prover

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Detta förfarande möjliggör för analys av bakterieflora som isolerats från pall efter miljömässiga anrikning av normal eller tumör med djur. Eftersom dessa är stora experiment som inbegriper avel för att få många djur av olika kön och genotyper, normalisera mikrobiomet mellan djur före påbörjandet av experimentet är viktigt att undvika icke-EE relaterade effekter på mikrobiomet biologisk mångfald.

För konsekvens mellan NE och EE villkor genomförs avel processen för att säkerställa att alla möss initialt har exponering mot samma mikrober och därför förväntas ha liknande mikrobiomet innehållet. Det är möjligt och troligt, att musen genotyp påverkar mikrobiomet sammansättning. Av denna anledning bibehålls mus nummer per genotyp mellan NE och EE villkor för att vara säker på att alla djur som förbrukar pall kommer att stöta en liknande mångfald av mikrobiomet.

Flera svårigheter är uppenbara när utforma EE experiment. Först, det totala antalet djur som behövs för experiment är beroende av de experimentella detaljerna, men det totala antalet begränsas också av antalen djur som vistas i buren. Till exempel historiska data omgivande mus överlevnad i ett förberedande EE experiment användes för att beräkna antalet djur att definiera mekanism underliggande förbättrad överlevnad observerats i tidigare experiment. Från dessa data, krävdes sammanlagt 17 djur i jämförelsegruppen för en 80% makt att upptäcka en skillnad i överlevnad i en dubbelsidig t-test där alfa = 0,05. Så, 4-5 djur i kontrollgruppen vs. 20-24 (eller upp till 41) djur per bur i den experimentella gruppen måste rymma en styrkeberäkningen. Därför behövs flera kontroll burars tillsammans med experimentella buren. Vidare, med komplexa genotyper är det svårt att få tillräcklig antalet djur av varje genotyp, vilket nödvändiggör det stora antalet avelshonor krävs. Dock med andra modeller där det finns färre transgena skillnader, fler djur av samma genotyp kan analyseras i detta system och färre uppfödare är nödvändiga. I USA, kan 12 dräktiga honor inrymmas i 633 i2 utrymme (tabell 2). Problemet med detta är att när valparna blir äldre, de tar upp mer utrymme. Eftersom hanvalpar separeras från kvinnliga valpar på 14-21 dagar, ett godkänt undantag från regeln utrymme i vissa länder kan vara genomförbart. Annars, manliga och kvinnliga valpar kan vara genotypbestämts valt och sedan separeras vid en yngre ålder med mödrar att bo under maximala mus nummer. Det är viktigt att få godkännande för dessa studier och följa lokala regler om utrymme begränsningar. Slutligen med bakterieflora är antalet djur som behövs för att upptäcka även små skillnader i bakterieflora sammansättning svårt att beräkna en priori. Även i denna studie hittades signifikanta skillnader i bakterieflora med 4 djur per grupp, är det möjligt att öka det antalet djur som skulle avslöja bakterieflora som är mer variabel mellan EE möss eller bara något ändras med EE.

Metoden beskrivs särskilt utrustning och sängkläder som används, som på ytan visas kanske inte nödvändigt. Dock flera icke uppenbara problem som påverkar konsistens kan påträffas och måste åtgärdas före inleder dessa mycket stora, dyra och tidskrävande studier. En viktig fråga är buren ventilation. Med ett stort antal djur i en bur, ventilation blir ett problem, och är en fråga som de flesta forskare inte tar hänsyn till när du försöker ge konsekvent miljöer mellan kontroll och experimentella burar. Alla burar i beskrivs installationen är placerade i ett ventilerat skåp att utjämna ventilation över de experimentella och styra burar. Detta kan inte åstadkommas när använder burar att göra som inte passar i ett ventilerat skåp. Andra sätt att normalisera ventilation mellan experimentell och kontrollera djur kunde testas och konsekvent sätt, men dessa metoder utforskas inte i denna studie. Liknande konsistens problem uppstå med sängkläder. I kolon cancer modell-systemet används i denna studie kommer att djur som har mag sjukdom äter vissa typer av bedding, särskilt majskolv sängkläder, vilket leder till mag blockeringar och sjukdom. Det är viktigt att ha detta i åtanke om djuren är kända att förtära sängkläder när inte annat ockuperade, liksom i kontrollmiljön. Detta fenomen och de efterföljande inkonsekvent hälsoeffekterna påverkar djupt alla data.

Den ribosomal 16S genen har använts som ett sätt för att studera bakteriell populationer. Den innehåller nio regioner som uttrycker genetiska variation, V1-V9 och interspersed konserverade regioner som förblir relativt oförändrad mellan bakteriearter39. V1-V3 regionen, i synnerhet ger den högsta sannolikheten för artnivå identifiering39. Liknande V1-V3 studier på kolorektal Cancer (CRC) och avancerad kolorektal adenom Funna förändringar i tre phyla av intresse: Bacteroidetes, Firmicutes och Proteobacteria21,40,41. Det har också rapporterats att motion kan flytta den mikrobiella populationen och leda till en ökning av Firmicutes42. Av denna anledning, denna studie identifierat mikrobiomet populationer med V1-V3 primers efter en 16S gjorts bibliotek prep protokoll22 till potentiellt definiera effekterna av miljömässiga berikning på dessa phyla känd ändras i adenom och CRC. Detta förfarande kan ändras för att förstärka och sekvens andra variabla regioner av 16S rRNA gener. Ett sätt är att använda sond Match för att förstå den phylogenetic klassifikationen av bakterieflora i provet som identifieras av sonden. På detta sätt kan sonder riktas för att specifikt definiera och klassificera fylogenetiskt mikrober av intresse. Detta gör en olika karakterisering av bakterieflora som är närvarande i avföringsprov, och kan avslöja ytterligare EE-beroende förändringar i mikrobiomet hos tumören med möss som kan påverka sjukdomsförloppet.

Med den här proceduren, släktet Sutterella identifierades som mest förändrade släktet efter EE av tumör med djur. Detta förfarande kan anpassas att rymma studier som använder någon metod som innebar att analysera effekterna av en störning på mikrobiomet sammansättning i genetiskt modifierade modeller av mänskliga sjukdomar. I stället för EE, kunde exempelvis möss ympas med Sutterella att definiera om Sutterella inympning är tillräcklig för att öka mikrobiella mångfalden och såret reparation i 16 veckor gamla manliga tumör med djur.

Utan tvekan är den mest unika aspekten av detta protokoll oro över normalisera bakterieflora före EE och underhålla mikrobiomet mångfald i hela EE studierna. Eftersom mikrobiomet studier förbättras kontinuerligt, är det troligt att mer robusta metoder för att karakterisera mikrobiomet kommer att uppstå, och mikrobiomet karakterisering i detta protokoll kommer att bli föråldrade. Exempelvis med den aktuella studien har de sonder som används för att förstärka den 16S rRNA bias, beroende på de sonder som är valt, och inte karakterisera alla bakterierna som finns i mikrobiomet. Samtidigt kommer otvivelaktigt att förbättra metoderna för undersökning och karaktärisera microbiom, experiment grundläggande grunden designa och kör EE medan med normalisering av mikrobiomet i åtanke kommer att förbli en viktig aspekt av EE experiment.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna förklarar de har inga intressekonflikter.

Acknowledgements

Vi tackar B. Dalley i University of Utah genomik kärnan för bibliotek sekvensering och K. Boucher i University of Utah biostatistik kärna för statistisk rådgivning och tillgång till dessa tekniska kärnor stöds av National Cancer Institute award P30 CA042014. Projektet beskrivs stöddes av National Cancer Institute bidrag P01 CA073992 och K01 CA128891 och Huntsman Cancer Foundation.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics