En metode for å definere effekten av miljømessig berikelse på kolon Microbiome biologisk mangfold i en mus kolon svulst modell

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Miljømessig berikelse (EE) er et dyr bolig miljø som brukes til å avsløre mekanismer underlie forbindelsene mellom livsstil, stress og sykdom. Denne protokollen beskriver en fremgangsmåte som bruker en musemodell av kolon tumorigenesis og EE spesielt definere endringer i bakterieflora biologisk mangfold som kan påvirke dyr dødelighet.

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Flere studier har vist de gunstige effektene av å bo i en berike omgivelsene på å forbedre menneskelig sykdom. I mus, miljømessig berikelse (EE) reduserer tumorigenesis av immunsystemet musen eller påvirker svulst bærende dyr overlevelse ved å stimulere såret reparasjon svaret, inkludert forbedret microbiome mangfold i svulst microenvironment. Gis her en detaljert prosedyre for å vurdere effekten av miljømessig berikelse på biologisk mangfold av microbiome i en mus kolon svulst modell. Forholdsregler angående avl og hensyn for dyr genotype og mus kolonien integrering er beskrevet, som til slutt påvirke mikrobiell biologisk mangfold. Akte disse forholdsregler kan gi en mer ensartet microbiome overføring, og derfor vil lindre behandling avhengige effekter som kan forvirre studere resultatene. Videre i denne prosedyren er bakterieflora endringer preget med 16S rDNA sekvenser av DNA isolert fra avføring fra distale kolonet langsiktige miljømessig berikelse. Gut microbiota ubalanse er forbundet med patogenesen av inflammatorisk tarm sykdom og tykktarm kreft, men også av fedme og diabetes blant andre. Viktigere, kan denne protokollen for EE og microbiome analyse benyttes for å studere rollen til microbiome patogenesen på tvers av en rekke sykdommer der robust musen modeller finnes som kan recapitulate menneskelig sykdom.

Introduction

Miljømessig berikelse (EE) studier utnytte komplekse bolig parametere for å påvirke sosiale stimulering (store bolig bur, større grupper av dyr), kognitiv stimulering (hytter, tunneler, hekkende materialer, plattformer) og fysisk aktivitet (kjører hjul). EE blitt benyttet av mange laboratorier å forstå effekten av økt aktivitet og forbedret sosiale og kognitive interaksjoner på sykdom initiering og progresjon med et bredt utvalg av musen modeller, inkludert barbering indusert alopesi, Alzheimers sykdom, Retts syndrom og flere svulst og fordøyelsesenzymer sykdom modeller1,,2,,3,,4,,5,,6.

Flere musen modeller er utviklet for å studere kolon tumorigenesis i mus. Kanskje er den mest veldefinerte modellen ApcMin musen. ApcMin musen ble utviklet i laboratoriet av William Dove i 19907, og har blitt brukt som en musemodell av mutasjoner i genet APC forbindes med menneskelige tykktarmskreft. I motsetning til Human skjuler APC mutasjoner, utvikle ApcMin mus primært små intestinal svulster, med svært sjelden forekomst av kolon svulster. En Tcf4Het allelet med en enkelt knockin knockout heterozygote mutasjon i Tcf4, øker imidlertid langt kolon tumorigenesis kombinert med ApcMin allelet8. Nylig har denne musemodell kolon tumorigenesis blitt brukt til å bestemme effekten av EE på kolon tumorigenesis6. I Bice et al. studere, fysiologiske og fenotypiske effekten av EE på menn og kvinner av fire forskjellige mus linjene (vill-type (WT), Tcf4Het / + Apc+/ +, Tcf4+/ + ApcMin / +, og Tcf4 Het / + APCMin / +)) ble definert. Kanskje var mest interessante funn at EE øker levetiden til både mannlige og kvinnelige kolon svulst-bærende dyr. Dette viste at EE kan redusere minst noen av symptomene forbundet med kolon tumorigenesis og forbedre dyrehelse. Bemerkelsesverdig, denne forbedret levetid i menn er ikke et direkte resultat av redusert tumorigenesis, og stedet var knyttet til oppstart av en svulst sårheling svaret, inkludert forbedret microbiome biodiversitet6.

Flere EE spesifikke studier blitt publisert med interessante resultater. Men fra et teknisk synspunkt er viktige resultater ofte ikke oversettbare til andre laboratorier. Opprettholde samme EE metoder mellom forskjellige laboratorier er en utrolig komplekse problemet, skyldes berikelse enheter og bolig brukes, men også sengetøy, mat, ventilasjon, avl, genetikk, aktivitet i rommet og animalsk-protokollen krav, blant annet9,10,11. Et eksempel er dyr integrasjon, hvor dyr må stabilt integreres i musen kolonien, derfor normalisere genetisk bakgrunn og kosthold komposisjon, for å unngå behandling relaterte effekter. Videre, mange EE studier er fullført før realisering av betydningen av microbiome i sykdom, og måten at felles musen dyrehold praksis kan påvirke sammensetningen av tarmen microbiome10,12.

Avl strategi og dyr plassering i EE kan øke stress hvis ikke utføres riktig. Siden EE studier bruker store mengder både mannlige og kvinnelige dyr og flere genotyper, kan eksperimentelle oppsett være vanskelig gitt behovet for dyr fra flere søppel kan kombineres. Derfor utviklet en avl og avvenning strategi for å tillate kombinere Avvent dyr av riktig genotype fra ulike søppel. Primære begrunnelsen for dette var å normalisere bakterieflora blant søppel og redusere stress når dyr ble flyttet til eksperimentelle miljøet. Microbiome ble overført fra demningen10. For å gi mikrobiell mangfold å kolonien, ble kvinner kjøpt fra Jackson Labs og integrert i kolonien i en måned før forsøket begynte9,10,12. Å fremme normalisere microbiome biologisk mangfold mellom dyr, var kvinner co ligger tidligere å formering. Etter avl, felles bolig i oppdrett og muligheten til å unnslippe forbedret sykepleie pups stress nivåer av mors omsorg13,14, muligens fremme microbiome normalisering. For å hindre ikke-EE relaterte effekter på microbiome, denne felles bolig av alle forsøksdyr forhindret kampene og ekstra stress som oppstod ved kombinere flere menn fra forskjellige kull i en eksperimentell bur. Til slutt, lik antall dyr av alle genotyper ble inkludert i merdene. Dette gitt muligheten for forbedret bakterieflora biodiversitet over genotyper og fjernet bidrag av coprophagia (dyrets tendens til å konsumere avføring) eller mulig genotype-spesifikke atferdsdata forskjeller til generelle studiet.

Denne protokollen gir en strategi som utvider tidligere EE studier med kjente sider ved microbiome forskning, inkludert bakterieflora overføring og dyr kolonien integrasjon for bakterieflora normalisering, aktivere mer ensartet microbiome bestander mellom forsøksdyr. Akte disse forholdsreglene er viktig på grunn av muligheten for behandling relaterte bakterieflora forskjeller å forvirre studere resultatene. Fjerne ikke-EE relatert bakterieflora endringer vil aktivere forskere spesielt definere rollen EE på bakterieflora komposisjon under sykdom utvikling og progresjon.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle metodene som er beskrevet her ble utført i henhold til protokoller godkjent av institusjonelle Animal Care og bruk Committee (IACUC) ved University of Utah.

1. eksperimentell Design og EE og bur oppsett

Merk: For referanse, en disposisjon av eksperimentell design er illustrert (figur 1).

  1. Definerer kontroll (NE) og EE bur (figur 2).
    1. Sette opp NE bur, kan du bruke autoklaveres konvensjonelle kontroll bur (tabell 1) som mangler berikelse enheter.
    2. For store merder, bore et hull per bur som er stor nok til en grommet og tunnel (Tabell for materiale).
    3. Sette opp pup oppdrett og EE bur, koble to store autoklaveres bur med en sterilisert grommet sikret tunnel og 2 sterilisert plattformer å øke gulvplass (tabell 1). For EE eksperimenter, gi sterilisert kjøre hjul, tunneler, igloene, hytter, gjennomgå baller og hekke materiale i EE merdene.
    4. Sett både EE og NE bur i ventilert stativet for å gi lik ventilasjon.
      Merk: To store merder med 2 plattformer (tabell 1) tillater maksimalt 12 gravide kvinner per pup oppdrett installasjonsprogrammet15 (se Tabell av materialer, trinn 3.2 i dokumentet, og tabell 2).
    5. Mate mus annonse libitum bestrålt standard chow og autoklaveres omvendt osmose vann.
    6. Gi mus sterilt sengetøy materialer.
      Merk: Alle manipulasjoner av Tom burene og bur med dyr må gjøres i panseret for å hindre forurensning. Buret manipulering av store merder, dekke hullet i buret med en selvklebende folien.
  2. Forberede dyr oppdrett. Gruppe huset 15 2 - måned gamle kvinner i en enkelt stor bur (tabell 1) for 2 uker før parring. Separat huset 2 - måned gamle littermate menn for 2 uker før parring.
    Merk: Antallet hunner for formering er avhengig av eksperimentet og antall dyr kreves. I denne studien 15 kvinner ble benyttet for å få 12 plugget kvinner, som er maksimalt antall tillatte i det pups bakside installasjonsprogrammet beskrevet i 1.1.2 (tabell 2).
  3. Formering, kombinere opphav og dam dyr, 1 hann per 2 tisper. Den første sjekken i morgen skal være for vaginal plugger, som kan være et synlig tegn på at dyrene har paret i løpet av natten.
    Merk: Huset hanndyr og kvinner sammen til hver kvinne har plugget. En vaginal plugg kan identifiseres visuelt, hvis det er eksternt.
    1. For å oppdage internalisert plugger, settes en sonde inn i skjedeåpningen og hvis vaginal pluggen, sonden lett settes ikke (16, se delen 4.3.6).
      Merk: Registrere om morgenen en plugg registreres som ½ dag, siden mating i natt.
    2. Når kvinner har vaginal plugger, overføre dem til en stor pup oppdrett bur for gruppen boliger med andre parret kvinner (oppsett i trinn 1.1.2 uten berikelse enheter).
    3. Erstatt parret kvinner med nye unmated gruppe huset kvinner for parring og fortsette parring for å få maksimalt antall kull i en 7-dagers periode.
      Merk: Alle dyr må ha en leveringsdato innen 7 dager etter hverandre.
  4. At gravide kvinner å føde i gruppen boliger slik at alle søppel er oppvokst i en stor pup oppdrett bur (oppsett i trinn 1.1.2 uten berikelse enheter).
    1. Holde orden på pup tall og fødselsdager, og begynne genotyperingteknologi pups på 7 dager gammel.
      1. Tatovering pups på sine tær på 7 dager gammel nummerkoden identifisere dem13,17.
      2. Rengjør tå med 70% etanol og forsiktig setter inn en mikro-tatovering enhet som inneholder blekk i hudoverflaten parallell til tå17 (se Tabell for materiale).
      3. Samle vev med saks for genotyperingteknologi fra hale tips av incising en liten del av 7 - dagers gammel nyfødte.
    2. Isolere genomisk DNA fra vev og utføre PCR med en konvensjonell HotSHOT metode som beskrevet i 18.
    3. Separat dyr av sex i 14-21 dager store bur med mødre.
      Merk: Kontroller at eldre valpene skal kunne feed på sine egne, og at yngre pups fortsette å sykepleier til gamle nok til å fø sine egne.
    4. På 21 til 28 dager, distribuere mannlige og kvinnelige dyr separat av genotype i NE eller EE miljøer, og pass på å holde like andeler av hver genotype per bur (figur 2A).
      Merk: Kontroller at antall dyr tillatt i hver NE eller EE bur er basert på maksimalt antall tillatte av IACUC (tabell 2). NE merdene har minst 5 dyr (tabell 2). I EE bur, for sosiale stimulering, ikke mindre enn 20, og med plass restriksjoner, skal mer enn 41 dyr tillates i EE buret (tabell 2).

2. krakk samling for 16 ukens av alderen

  1. Begynn krakk samling 1 til 2 dager før ofre, og separat samle krakk ved offer i disseksjon bruke sterilt verktøy.
    Merk: Samle krakk samtidig 1-2 dager før samlingen kan bidra til å unngå tap av et eksempel på grunn av muligheten for at det finnes ingen krakk ved samling.
    1. Å samle krakk fra levende dyr, nøye scruff dyret over en ren bur. Samle krakk ved hjelp av sterile pinsett i et sterilt microfuge rør.
      Merk: Dyr vil vanligvis eliminere krakk når immobilisert, som gir mulighet for rask krakk samling direkte inn i et sterilt microfuge rør. Hvis et dyr ikke defekt umiddelbart når immobilisert, Legg den i en ren bur og vente på dyret å defekt (vanligvis opptil 1 time).
    2. Samle krakk ved offer.
      1. For euthanizing dyrene, plassere dyret i en bjelle krukke med en liten beholder med en bomull ball fuktet i isoflurane. Når opphør av puste er observert (vanligvis etter 2 min), lå dyret på ryggen å tillate kolon disseksjon.
      2. 70% etanol gjelde mus magen.
      3. Løft huden anterior urethral åpningen med tang, og bruker saks til å kutte langs ventrale midtlinjen fram brystkasse, og kuttet fra bunnen av den første snittet mot hver etappe. Brett tilbake huden og bruk saks til å klippe gjennom peritoneal veggen i samme mønster.
      4. Bruk tang til å forstå det distale kolonet på anus å dissekere og koble distale kolontegnet fra endetarmen. Mens du trekker kolon loddrett med tang, bruk saks for å skjære gjennom mesentery å løslate kolon.
      5. Skjær kolon rett under cecum og legge den på filter papir. Bruk tang til å løfte toppen av kolon røret, åpne lumen for å tillate en side åpen saks settes. Skjær langs, distale proksimale og splay åpne kolon på langs.
      6. Samle avføring fra det distale kolonet i et sterilt microfuge rør ved hjelp av sterile pinsett.
  2. Lagre avføring i et microfuge rør på-80 grader til bakteriell DNA isolert.
    Merk: På dagen for offer, i tillegg til krakken, samle andre eksempler som fullblod, serum, plasma, normal og tumor vev fra fettvev kolon og tynntarm, microsomes, osv. å ta definerte spørsmål i undersøkelsen.

3. genomisk DNA isolasjon fra avføring

Merk: Benytte en kommersiell kit å isolere mikrobiell DNA fra avføring etter en krakk patogen oppdagelsen protokoll. Fjerne prøver for-80 grader fryseren og store på tørris mens veier.

  1. Overføre opptil 220 mg krakk til en ren microfuge rør som inneholder 1,4 mL romtemperatur (RT) krakk lyseringsbuffer (se Tabell for materiale).
  2. Vortex utvalg for 1 min til grundig homogenize faste stoffer (figur 2B). Varme suspensjon til 95 grader for 5 min til lyse alle bakterier (inkludert Gram-positive bakteriene).
  3. Vortex prøver for 15 s og deretter sentrifuge 20.000 x g for 1 min til pellets krakk faste stoffer. Overføre nedbryting til en 2-mL microfuge tube. Legge til en tablett i hver prøve å absorbere PCR hemmere, vortex til tabletten er oppløst, og ruge utvalget på RT for 1 min.
  4. Sentrifuge prøven på 20.000 x g for 3 min og overføre nedbryting slik ny microfuge. Sentrifuge 20.000 x g for 3 min. Aliquot 15 μL proteinasen K (20 mg/mL stock) til en ny 1,5 mL microfuge tube. Pipetter 200 μL av prøven inn i røret som inneholder proteinasen K.
  5. Tilsett 200 μL av guanidinium chloride lyseringsbuffer til røret, vortex grundig i 15 s (se Tabell for materiale) og ruge prøven på 70 grader for 10 min. legge 200 μL av etanol (96-100%) til rør og bland godt vortexing.
  6. Sted en silica basert spin-kolonnen i en 2-mL samling rør og gjelder prøvene for kolonnen. Lukk lokket og sentrifuge for 1 min 20.000 x g.
  7. Overføre kolonnen til en ny 2 mL samling rør og legge 500 μL vaskebuffer 1 til kolonnen cap den kolonnen og sentrifuge for 1 min på 20.000 x g. overføring kolonnen til en ny 2 mL samling rør og legge til 500 μL vaskebuffer 2 kolonnen , Lukk dekselet og sentrifuge 20.000 x g for 3 min.
  8. Lokket stengt, overføre kolonnen til en ny 2 mL samling rør og sentrifuge for en ekstra 1 min 20.000 x g fjerne gjenværende vaskebuffer. Overføre kolonnen til en 1,5 mL merket microfuge rør og elute prøven ved å legge til 200 μL av elueringsbufferen inneholder EDTA til membranen (se Tabell for materiale).
  9. Lukk lokket og ruge på RT i 1 sentrifuge prøven for 1 min på 20.000 x g. Forkast kolonnen.

4. DNA konsentrasjon besluttsomhet og prøve forberedelser for PCR

Merk: Bruke en fluorometer og en kommersielt tilgjengelig dsDNA fluorescerende analysen å bestemme genomisk DNA konsentrasjon i hvert utvalg (se Tabell for materiale). Fluorescerende fargestoff må binde double-strandet DNA spesielt.

  1. Forberede en 1:200 fortynning av hvert utvalg (1 µL av hvert utvalg i 199 µL dsDNA master mix) og en 1:50 fortynning av standarder. Analysere på et fluorometer ved hjelp av innstillingen dsDNA.
    Merk: En stor mengde DNA i PCR kan være hemmende, volumet av DNA brukes må derfor ikke mer enn 10% av det siste bindet i PCR. En fluorometer kan nøyaktig måling av DNA i utvalget, som bare DNA bundet til fluorescerende farge vil fluoresce, eliminere mulige bidrag av miljøgifter til siste beregnede DNA konsentrasjonen. Dette nivået av nøyaktig kvantifisering er viktig for nedstrøms sekvensering programmet.
  2. Forberede PCR maler utvannet til 5 ng/μL med riktige volumet av 10 mM Tris, pH 8.5 å arbeide mal bestander av hvert utvalg.
  3. Lagre prøver på 20 ° C.

5. design primere for 16S ønsket V regioner

  1. Design primere å selektivt forsterke ønsket V 16S rRNA regionene.
  2. Analysere primere med sonde Match, Ribosomal databaseprosjektet19, for å bestemme omtrentlig treffrekvensen for ulike rekker.
    Merk: For V1-V3 regioner publisert denne studien brukte primere Bosshard frem20, som binder i posisjon 8 i regionen V1 og 533 omvendt21, som binder i posisjon 533 i V3-regionen. Primere må inkludere overheng kortet sekvenser for indeksering.
  3. Når du utformer primere, inkludere kortet sekvenser i 5' endene av hver primer, som anbefalt for 16S metagenomics sekvensering biblioteket forberedelse22 (tabell 3).
  4. Syntetisere disse store primere med kassetten rensing. Rekonstituer desiccated primere og fortynne en PCR arbeider lager til 1 μM i 10 mM Tris, pH 8.5.

6. Amplicon PCR å forsterke V områdene med overheng Adapter sekvenser knyttet 22

  1. Angi amplicon PCR reaksjonen blanding som beskrevet i Tabell 4.
  2. Plasser en selvklebende klart PCR plate segl på tallerkenen og kjøre amplicon PCR bruker parameterne i tabell 5.
  3. (Valgfritt) Kjøre amplicon PCR produkter på en agarose gel eller en høy følsomhet DNA analysen som muliggjør kvantitativ måling av amplicon størrelse (se Tabell for materiale).
    Merk: Amplicon fra denne studien er 550 bp (Figur 3A).

7. PCR rengjøring ved hjelp av magnetiske perler 22

  1. Sentrifuge amplicon PCR platen raskt på 1000 x g for 1 min samle kondens.
    Merk: PCR tube strimler kan brukes i stedet for PCR plater for å redusere forurensning. Forkast tube lokk og aldri gjenbruke.
  2. Vortex magnetiske perler jevnt spre dem, og legge til 20 μL magnetiske perler til hver amplicon PCR Vel, deretter Pipetter hele volumet opp og ned sakte 10 ganger.
  3. Ruge på RT for 5 min. sted PCR plate på en magnetisk stå i 2 minutter før magnetiske perler er samlet og nedbryting er klart. Fjerne og slette nedbryting.
  4. Vask perler med 200 μL frisk 80% etanol mens PCR platen er på de stå og ruge for 30 s på RT på magnetiske stand. Fjern forsiktig nedbryting.
  5. Gjenta vask for andre gang. Nå bruke en fin pipette tips å fjerne eventuelle gjenværende etanol fra brønnene og tillate luft tørke i 10 min.
  6. Fjern PCR platen fra magnetiske stativet og legge 52.5 μL 10 mM Tris pH 8.5 i hver brønn. Pipetter opp og ned 10 ganger å suspendere perler og ruge ved romtemperatur i 2 minutter.
  7. Overføre PCR platen til magnetisk stå å samle magnetiske perler og overføre 50 μL nedbryting av til en ren PCR-plate. Plasser en selvklebende klart PCR plate segl på plate og lagre på-20 grader i opptil en uke.

8. forberedelse av en Plate for indeksen PCR

Merk: Vil generere et V1-V3 bibliotek, en andre PCR ble utført med en indeks kit (se Tabell for materiale). En standard indekserer ordningen ble brukt til å kartlegge unik dobbel indeks kombinasjoner for hvert utvalg (Figur 3B og 23).

  1. Kontroller at hvert utvalg har en unik kombinasjon av 2 indeks primere (dvs.dobbel indeksering).

9. Utfør indeks PCR knytte strekkoder til adapter sekvensene som beskrevet 22 .

  1. Overføre 2,5 μL PCR amplicons (rene amplicons) til en ny 96 godt plate og sted i en indeks plate innslag til hjelp i indeksering.
  2. Ordne indeksen 1 og indeksere 2 primere eksemplet av forberedt plate grafikken (Figur 3B).
    Merk: Visuelle stikkord er forutsatt for å unngå primer mix-ups: indeks 2 primer rør skal ha hvit caps og klar løsning, mens indeksen 1 primer rør må oransje caps og gule løsning.
  3. Samle indeksen PCR blanding reaksjon som beskrevet i tabell 6. Bland ved pipettering opp og ned 10 ganger. Dekk med en selvklebende klart PCR plate segl og virvel for å samle på 1000 x g ved romtemperatur for 1 min.
  4. Kjør indeksen PCR bruker parameterne i tabellen 7.

10. rense siste PCR bibliotek

Merk: Denne PCR rydde opp er identisk med trinn 7 ovenfor og bruker magnetiske perler for å utføre PCR opprydding av indeksen PCR22.

  1. Sentrifuge PCR platen fra trinn 10 raskt på 1000 x g for 1 min samle kondens.
  2. Vortex magnetiske perler jevnt spre dem, og deretter legge til 20 μL magnetiske perler til hver amplicon PCR Vel, deretter Pipetter hele volumet opp og ned sakte 10 ganger å blande.
  3. Ruge på RT i 5 min.
  4. Sted PCR plate på en magnetisk stå i 2 minutter til magnetiske perler er samlet og supernatant er klart. Fjerne og slette nedbryting.
  5. Vask perler med 200 μL frisk 80% etanol mens PCR platen er på de stå og ruge for 30 s ved romtemperatur på magnetiske stand. Fjern forsiktig nedbryting.
  6. Gjenta vask for andre gang.
  7. Etter den andre vasken, bruk en fin pipette tips å fjerne eventuelle gjenværende etanol fra brønnene og tillate luft tørke i 10 min.
  8. Fjern PCR platen fra magnetiske stativet og legge 52.5 μL 10 mM Tris pH 8.5 i hver brønn. Pipetter opp og ned 10 ganger å suspendere perler og ruge ved romtemperatur i 2 minutter.
  9. Overføre PCR platen til magnetisk stå å samle magnetiske perler og overføre 50 μL nedbryting av til en ren PCR-plate. Plasser en selvklebende klart PCR plate segl på plate og lagre på-20 grader i opptil en uke.
  10. (Valgfritt) Kjøre indeks PCR produkter på en agarose gel eller en høy følsomhet DNA analysen som muliggjør kvantitativ måling av amplicon størrelse (se Tabell for materiale).
    Merk: Den endelige indekserte bibliotek størrelsen fra denne studien var 668 bp (Figur 3C-D).

11. kvantifisere normalisere og bassenget indekserte bibliotekene for sekvensering

  1. Bestemme DNA konsentrasjonen av hvert utvalg med en fluorometer og en dsDNA fluorescerende analysen kit (se tabell for materiale).
    1. Klargjør en 1:200 fortynning av prøven (1 µL av hvert utvalg i 199 µL dsDNA master blanding, som inkluderer buffer og reagens) for hver av indekserte prøver og standarder (190 µL dsDNA master mix og 10 µL av standard). Analysere på et fluorometer ved hjelp av innstillingen dsDNA.
  2. Etter DNA konsentrasjon beregningen, normalisere bibliotekene ved å beregne gjennomsnittlig biblioteket størrelse. Gjør dette ved å summere kortet lengder, indeks lengder og V amplicon størrelse primere, og vise produkter av agarose gel å være sikker på at den faktiske størrelsen er lik den beregnede størrelsen (Figur 3C, se 22).
    1. Du kan også bruke en høy følsomhet DNA analysen som muliggjør kvantitativ måling av DNA integritet, amplicon størrelse og konsentrasjon (tabell av materialer, Figur 3D).
      Merk: I denne studien var gjennomsnittlig biblioteket størrelse beregnet basert på summere kortet lengder, indeks lengder og V1-V3 amplicon størrelse primere. Gjennomsnittlig størrelse var 668 bp.
    2. Konsentrasjoner av prøvene er normalisert ved hjelp av formelen i tabell 8.
  3. Fortynne prøver å 4 nM og basseng 5 μL fra hver 4-nM prøve i et enkelt rør for sekvenser.

12. sekvens biblioteket bruker en neste generasjons sekvensering System og analysere Data

  1. Sekvens biblioteket.
    Merk: For denne studien utført University of Utah høy gjennomstrømming Genomics kjernen biblioteket rødsprit og prøve sekvensering (som beskrevet i 6,22).
  2. Analysere data.
    Merk: For å skille data fra gruppert prøver, ble indeks leser identifisert og atskilt (som beskrevet i 22).
  3. Generere FASTQ filer og benytte dette for senere analyse.

13. analysere sekvensert Data fra 16S Amplicon biblioteket

Merk: Dette trinnet utføres som beskrevet i Bice et al., 20176.

  1. Installere fritt tilgjengelig dataanalyseverktøyene (se Tabell for materiale; 24).
  2. Montere demultiplexed fastq filer fra sekvensert data (som beskrevet i25,26). Forkaste alle umontert sekvenser.
  3. Utføre analyser etter en de novo åpne taksonomisk enhet (OTU) plukke protokollen (som beskrevet i 27).
    1. Bin sekvenser i en enkelt fastq arkiv av sampleID og gruppe sekvenser med 97% eller større likhet i OTUs, som beskrevet i 28. Juster representant sekvenser av kjerne med minimum sekvens lengde på 150 og 75% identitet29,30. Tilordne taksonomien som beskrevet28.
      Merk: Eksempler kan være binned og analysert31, etterfulgt av taksonomisk tildelings- og OTU tabell bygging32.
    2. Opprett en tilordningsfil som identifiserer beskrivende navn og egenskaper av prøver å koble til prøven identifikasjon og validere kartlegging filen33,34.
    3. Lage et OTU nettverk som kobler OTUs til eksempel beskrivelser med kartlegging filen35.
    4. Beregne taksonomi Sammendrag i relative overflod består taxa gjennom tomter36.
    5. Utforsk alpha mangfold av prøver i uniform sekvensering dybde riktig smakebiter. Definer passende dybden for alfa mangfold ved oppsummere totalt teller observert i hvert utvalg ved hjelp av kommandoen biome oppsummere tabell som beskrevet i 37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Flere studier har vist at praktiseringen av sinn-kropp medisin bedre helseutfall. Tilsvarende i mus forbedrer miljømessig berikelse resultater inkludert forbedret levetid og svulst sår reparasjon6. Derfor utviklet en EE fremgangsmåte for definering av rollen for bakterieflora i denne fenotypen mens første normalisere microbiome før oppstart av eksperimentet (figur 1). Viktigere, alle avlsdyr er integrert i musen kolonien i minst en måned før avl, og newborn pups er co huset med mødre i en stor bur normalisere bakterieflora overføring før eksperimentet. Når dyrene er mellom 21 til 28 dager gamle, er lik antall hver genotype Avvent i deres respektive bolig, EE eller NE miljøer (figur 2A). Ved 16 uker, avføring fra alle dyr samles og homogenisert (figur 2B), etterfulgt av bakteriell DNA isolasjon. Til slutt, 16S amplicons er forsterket fra krakk microbiome DNA og strekkode indeksert for å tillate sekvensering av alle microbiome bibliotekene samtidig (Figur 3). De unike sekvensene identifisert i WT og svulst med dyr på både NE og EE er vist i Figur 4. Interessant, EE forbedrer ikke biologisk mangfold WT dyr, men øker enormt biomangfold i svulst bærende dyr (Figur 4), viser at denne metoden tillater biodiversitet forbedringer. Denne økningen i biologisk kan tilskrives økt tilstedeværelsen av rekken Proteobacteria, med betydelig økning i klassene Alphaproteobacteria og Betaproteobacteria, og nedgang i sykdomsfremkallende Gammaproteobacteria (figur 5 ; Supplerende tabell 1). Den største økningen er Betaproteobacteria klasse er slekten Sutterella, en sannsynlig commensal involvert i utskilles IgA nedbrytning (figur 6, også se38).

Figure 1
Figur 1 : En representasjon av eksperimentelle tidslinjen. Kort bandene representerer 7-dagers windows, som de fleste av protokollen oppnås i 7-dagers intervaller. Dette også hjelpemidler i visualisering av pup aldre over eksperimentet. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : EE og NE bolig vilkår og avføring homogenates (som beskrevet i protokollen). Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : 16S Microbiome biblioteket forberedelse. (A) urenset PCR amplicon produkter avledet fra avføring genomisk DNA. (B) indeksering plate grafikken utformet som programvaren som brukes (Tabell av materialer, 23). Dobbel indeks kombinasjonene, I7 (indeks 1; Rad) og I5 (indeks 2; Kolonne), vises for hvert utvalg. Hver indeks er 8 bp i lengden. Eksempel tallene viser til respektive mus tallene fra EE studier. (C) urenset indeks PCR produkter. (D) kvalitet analyse av finalen renset og samlet 16S biblioteker. (A, C, D) Svarte piler betegne 550 bp amplicon og 668 bp indekserte bibliotek. Røde piler betegne uspesifisert produkter som er eliminert etter rensing som vist i D. Øvre og nedre markører er størrelse markører lagt til utvalget for referanse. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 : Endringer i alpha mangfold etter EE av Tcf4Het / + ApcMin / + dyr. Alpha mangfoldet av WT og Tcf4Het / + ApcMin / + svulst bærende dyr. På 20.000 leser, NE og EE av WT, p= 0.64 og NE og EE av Tcf4Het / + ApcMin / +, p= 0,03 t-test for to utvalg med Welch korreksjon. Tilpasset fra Bice et al., 20176. Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5 : EE-mediert endringer etter EE av Tcf4Het / + ApcMin / + dyr. R-ggplot2 generert box-whisker plott viser endringer i overflod av rekke Proteobacteria og klasser Alphaproteobacteria, Betaproteobacteria og Gammaproteobacteria. Outliers er kjent som sirkler. p= 0.005 bruker to utvalg t-tester med Welch korreksjon. Feilfelt beregnet ved hjelp av standard feil av gjsnitt (SEM). Tilpasset fra Bice et al., 20176. Klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6 : Endringer i den relative overfloden av Sutterella etter EE av Tcf4Het / + ApcMin / + dyr. Outliers er kjent som sirkler. p= 0.005 t-test for to utvalg med Welch korreksjon. Feilfelt beregnet ved hjelp av SEM. tilpasset fra Bice et al., 20176. Klikk her for å se en større versjon av dette tallet.

Supplemental Table 1
Ekstra tabell 1: klassifisering av bakterier isolert fra avføring samles inn fra NE og EE mus. Klassifisering over genotyper på (A) rekke, (B) klasse, (C) ordren, (D) familie og (E) slekt nivå. Sammenligninger av NE og EE av samme genotype eller WT å Tcf4Het / + ApcMin / +. P-verdiene beregnes en t-test for to utvalg med Welch korreksjon. Tilpasset fra Bice et al., 20176. Klikk her for å laste ned denne filen.

Element Areal (tommers2) Areal (cm2) Bur størrelse (tommer) L x b x H Bur størrelse (cm) L x b x H
Én kontroll bur (NE) 68.25 440.32 10.5 x 6,5 x 5,5 26,67 x 16.51 x 13.97
En stor bur (EE) 264.36 1706.32 13.87 x 19.06 x 7,75 35.24 x 48.42 x 19.69
To store merder (EE) 528.72 3412.64 2 @ 13.87 x 19.06 x 7,75 2 @ 35.24 x 48.42 x 19.69
To plattformer (EE) 93 600 2 @ 11,8 x 3.94 x 2.95 2 @ 30 x 10 x 7.5
To store merder med to plattformer (EE) 621.72 4013 2 @ 13.87 x 19.06 x 7,75 + 2 @ 11,8 x 3.94 x 2.95 2 @ 35.24 x 48.42 x 19.69 + 2 @ 30 x 10 x 7.5

Tabell 1: EE og NE bur størrelser og gulvplass.

Dyr tillatt i buret Nødvendig Inches kvadrat Per dyr EE bur området (Inches2) Totalt dyr tillatt
Opptil 25 12 622 i2 (4013 cm2) opptil 25
25 + 15 622 i2 (4013 cm2) opptil 41
Kvinne med søppel 51 622 i2 (4013 cm2) opptil 12

Tabell 2: tillatt antall dyr i bur basert på gulvplass 15 .

Amplicon PCR primere
Fremover 5-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3 "
Omvendt 5-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 "
Locus bestemt sekvenser vises i fet skrift og den ikke-fet er overheng kortet sekvensen.

Tabell 3: Amplicon PCR primere.

Amplicon PCR reaksjon satt opp
Volum
Mikrobiell DNA (5ng/μl) 2,5 μl
Videresende Primer (1 μM, fra trinn 5.1.2) 5.0 μl
Omvendt Primer (1 μM, fra trinn 5.1.2) 5.0 μl
2 x HotStart klar Mix 12.5 μl
Totalt 25.0 μl

Tabell 4: Amplicon PCR Mix.

Amplicon PCR satt opp
95 ° C i 3 minutter
25 sykluser av:
95 ° C i 30 sekunder
55 ° C i 30 sekunder
72 ° C i 60 sekunder
72 ° C i 3 minutter
Hold på 4 ° C

Tabell 5: Amplicon PCR programmet definert.

Indeks PCR strekkode montering
DNA 2,5 μl
Indeks Primer 1 (N7XX) 2,5 μl
Indeks Primer 2 (S5XX) 2,5 μl
2 x HotStart klar Mix 12.5 μl
PCR klasse vann 5 μl
Totalt 25 μl

Tabell 6: indeks PCR Mix.

Indeks PCR oppsett
95 ° C i 3 minutter
8 sykluser av:
95 ° C i 30 sekunder
55 ° C i 30 sekunder
72 ° C i 30 sekunder
72 ° C i 5 minutter
Hold på 4 ° C
Butikken på 20 ° C

Tabell 7: indeks PCR programmet satt opp.

Konsentrasjon eksempelformel for samkjøring
(DNA konsentrasjon i ng/μl) x 106 = konsentrasjon i nM
(660 g/mol x gjennomsnittlig biblioteket størrelse)
Et eksempel fra denne studien er:
(85.2 ng/μl) x 10 ^ 6 = 193.3 nM
(660 g / mol x 668 bp)

Tabell 8: formel for Normalizing før Pooling prøver

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Denne prosedyren kan for analyse av bakterieflora isolert fra avføring etter miljømessig berikelse av normal eller svulst bærende dyr. Fordi disse er store eksperimenter som involverer avl for å få mange dyr av ulike kjønn og genotyper, normalisere microbiome mellom dyr før begynnelsen av eksperimentet er viktig å unngå ikke-EE relaterte effekter på microbiome biologisk mangfold.

For konsistens mellom NE og EE, er oppdrett prosessen gjennomført for å sikre at alle mus først har eksponering for samme mikrober og derfor forventes å ha lignende microbiome innholdet. Det er mulig, og sannsynlig at musen genotype påvirker microbiome komposisjon. Derfor opprettholdes musen tall per genotype mellom NE og EE betingelsene for å være sikker på at alle dyr det forbruker krakk støter på et tilsvarende mangfold av microbiome.

Flere problemer er tydelig når utforme EE eksperimenter. Først antall dyr nødvendig for forsøkene er avhengig av eksperimentelle detaljene, men det totale antallet er også begrenset av antall dyr tillatt i buret. For eksempel historiske data rundt musen overlevelse i et foreløpig EE eksperiment ble brukt til å beregne antall dyr å definere mekanisme underliggende økt overlevelse i forrige eksperimenter. Fra disse dataene, totalt 17 dyr i sammenligning gruppen var nødvendige for en 80% strøm til å oppdage en forskjell i overlevelse i en tosidig t-test hvor alfa = 0,05. Så, 4-5 dyr i kontrollgruppen vs 20-24 (eller til 41) dyr per bur i forsøksgruppen må ta en strøm beregning. Derfor kreves flere kontroll gruppe bur med eksperimentelle buret. Videre med komplekse genotyper er det vanskelig å få tilstrekkelig dyr antall hver genotype, som nødvendiggjør det store antallet avl kvinner kreves. Men andre modeller der færre transgene forskjeller finnes flere dyr av samme genotype kan analyseres på dette systemet og færre oppdretter er nødvendig. I USA, kan 12 gravide kvinner bli plassert i 633 i2 plass (tabell 2). Problemet med dette er at når pups blir eldre, de tar opp mer plass. Gitt at mannlige pups skilles fra kvinnelige valpene 14-21 dager, kan det hende at et godkjent unntak plass regelen i visse land mulig. Ellers, mannlige og kvinnelige pups kan være genotyped og merket, og deretter skilles i yngre alder med mødre å bo under maksimal mus tallene. Det er viktig å få godkjenning for disse studiene og overholde lokale regler på plass restriksjoner. Endelig med bakterieflora er antall dyr for å oppdage selv små forskjeller i bakterieflora sammensetning vanskelig å beregne en priori. I denne studien fant betydelige forskjeller i bakterieflora med 4 dyr per gruppe, er det mulig at økende at antall dyr vil avsløre microbiota som er mer variable mellom EE mus eller er bare litt endret av EE.

Denne metoden artikkelen bestemt utstyr og sengetøy som blir brukt, som på overflaten ikke vises viktig. Imidlertid flere ikke-åpenbare problemer som påvirker konsistens kan oppstå og må tas opp før embarking på disse svært store, dyre og tidkrevende studier. En viktig sak er buret ventilasjon. Med stort antall dyr i et bur, ventilasjon blir et problem, og er et problem som de fleste forskere ikke ta hensyn til når du prøver å gi konsekvent miljøer mellom kontrollen og eksperimentelle burene. Alle bur i beskrives oppsettet plasseres i ventilert regjering å utjevne ventilasjon over den eksperimentelle og kontroll burene. Dette kan ikke gjøres når bruker bur det gjøre ikke passer i en ventilert skap. Andre betyr å normalisere ventilasjon mellom eksperimentelle og kontroll dyr kan testes og konsekvent anvendt, men disse metodene er ikke utforsket i denne studien. Lignende konsistens problemer oppstår med sengetøy. I kolon kreft modell systemet brukes i denne studien, dyr som har fordøyelsessystemet sykdom vil ingest visse typer sengetøy, spesielt korn cob sengetøy, som fører til fordøyelseskanal blokkeringer og sykdom. Det er viktig å holde dette i tankene hvis dyrene er kjent for å innta sengetøy når ikke annet er okkupert, som i kontroll-miljøet. Dette fenomenet og påfølgende inkonsekvent helseeffekter, dypt påvirker alle data.

Ribosomal 16S genet har blitt brukt som et middel til å studere bakteriell populasjoner. Den inneholder ni regioner som uttrykker genetisk variasjon og V1-V9 utblandet konserverte områder som forblir relativt uendret mellom bakterie-art39. V1-V3 regionen, spesielt gir den høyeste sannsynligheten av arter nivå identifikasjon39. Lignende V1-V3 studier på kolorektal kreft (CRC) og avansert Colorectal adenom fant endringer i tre rekker av interesse: Bacteroidetes, Firmicutes og Proteobacteria21,40,41. Det er også rapportert at trening kan skifte mikrobiell befolkningen og føre til en økning i Firmicutes42. Derfor denne studien kjennemerke microbiome befolkninger av benytter V1-V3 primere etter en 16S metagenomic biblioteket prep protokollen22 potensielt definere effekten av miljømessig berikelse på disse stamtreet kjent endres i adenom og CRC. Denne fremgangsmåten kan endres for å forsterke og sekvens andre variable regioner av 16S rRNA gener. En måte er å bruke sonde kamp for å forstå inndeling av bakterieflora i prøven som blir identifisert av sonden. På denne måten kan sonder mål å spesielt definere og klassifisere phylogenetically mikrober rundt. Dette gjør forskjellige karakteristikk av bakterieflora i avføringsprøver, og kan avsløre flere EE-avhengige endringer i microbiome svulst bærer mus som kan påvirke sykdomsprogresjon.

Bruke denne fremgangsmåten, slekten Sutterella ble identifisert som mest endret slekten etter EE svulst bærende dyr. Denne fremgangsmåten kan tilpasses til studier som utnytter noen metode ment å analysere virkningene av en forstyrrelsene på microbiome komposisjon i genmodifiserte modeller for menneskelig sykdom. For eksempel i stedet for EE kan mus være inokulert med Sutterella til å definere om Sutterella vaksinasjon er tilstrekkelig for å øke mikrobiell biologisk mangfold og sår reparasjon i 16-uke-gamle mannlige svulst bærende dyr.

Utvilsomt er den mest unike aspekten av denne protokollen bekymring over normalisere bakterieflora før EE og vedlikeholde microbiome mangfold gjennom EE studiene. Siden microbiome studier er stadig bedre, er det sannsynlig at mer robust metoder for å karakterisere microbiome vil oppstå, og microbiome karakterisering i denne protokollen vil bli foreldet. Med denne studien har for eksempel sonder brukes til å forsterke 16S rRNA bias, avhengig av sonder som er valgt, og ikke karakteriserer alle bakterier i microbiome. Metoder brukt for å kartlegge og karakterisere microbiome vil utvilsomt forbedre, eksperimenter grunnleggende grunnlaget utformer og kjører EE mens holde normalisering av microbiome i tankene vil være en viktig fasett av EE eksperimenter.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer de har ingen konflikter av interesse.

Acknowledgements

Vi takker B. Dalley i University of Utah Genomics kjernen for biblioteket sekvensering og K. Boucher i University of Utah biostatistikk kjernen for statistiske råd og tilgang til disse tekniske kjerner støttet av National Cancer Institute prisen P30 CA042014. Prosjektet beskrevet ble støttet av National Cancer Institute tilskudd P01 CA073992 og K01 CA128891 og Huntsman Cancer Foundation.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics