En metode til at definere virkningerne af miljøberigelse på tyktarmen Microbiome biodiversitet i en mus tyktarmen tumoren Model

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Miljømæssig berigelse (EE) er en dyr bolig-miljø, som bruges til at afsløre mekanismer, der ligger til grund for forbindelserne mellem livsstil, stress og sygdom. Denne protokol beskriver en procedure, der anvender en musemodel af kolon tumordannelse og EE specifikt angives ændringer i mikrobiota biodiversitet, der kan påvirke dyrs dødelighed.

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Flere nyere undersøgelser har illustreret de gavnlige virkninger af at leve i en berige omgivelser på at forbedre sygdom hos mennesker. I mus, miljøberigelse (EE) reducerer tumordannelse ved at aktivere mus immunsystemet, eller påvirker tumor forsynet med dyrenes overlevelse ved at stimulere sår reparation svar, herunder forbedret microbiome mangfoldighed, i tumor mikromiljø. Her er en detaljeret procedure for vurdering af virkningerne af miljøberigelse på biodiversiteten af microbiome i en mus tyktarmen tumoren model. Forholdsregler vedrørende husdyravl og overvejelser i forbindelse med dyrs genotype og mus koloni integration er beskrevet, som i sidste ende påvirke mikrobielle biodiversitet. Give agt på disse forholdsregler kan give mere ensartede microbiome transmission, og derfor vil afbøde ikke-behandling afhængige effekter, der kan forvirre undersøgelsesresultater. Yderligere, i denne procedure, mikrobiota ændringer er karakteriseret ved hjælp af 16S rDNA-sekventering af DNA isoleret fra afføring indsamlet fra den distale colon efter langsigtede miljøberigelse. Gut mikrobiota ubalance er knyttet til patogenesen af inflammatoriske tarm sygdom og kolon kræft, men også af fedme og diabetes blandt andre. Vigtigst, kan denne protokol for EE og microbiome analyse udnyttes til at studere rollen microbiome patogenese på tværs af en lang række sygdomme hvor robust musemodeller findes der kan sammenfatte sygdom hos mennesker.

Introduction

Miljømæssig berigelse (EE) undersøgelser udnytte komplekse boliger parametre, der påvirker sociale stimulation (store boliger bure, større grupper af dyr), kognitiv stimulation (hytter, tunneler, redebygning materialer, platforme) og fysisk aktivitet (running hjul). EE er blevet udnyttet af mange laboratorier til at forstå virkningerne af øget aktivitet og bedre sociale og kognitive interaktioner på sygdom indledningen og progression ved hjælp af en bred vifte af musemodeller, herunder barbering induceret alopeci, Alzheimers sygdom, RETT syndrom, og flere tumor og mave sygdom modeller1,2,3,4,5,6.

Flere musemodeller er blevet udviklet for at studere kolon tumordannelse hos mus. Måske er den mest veldefinerede model ApcMin mus. ApcMin mus blev udviklet i laboratoriet af William Due i 19907, og har været brugt som en musemodel af mutationer i APC -genet, der er almindeligt i forbindelse med menneskelige kolorektal cancer. I modsætning til mennesker husly APC mutationer, udvikle ApcMin mus primært små intestinale svulster, med meget sjældne forekomst af colon tumorer. Men en Tcf4Het allel med en enkelt knockin knockout heterozygous mutation i Tcf4, langt øger kolon tumordannelse når kombineret med ApcMin allel8. For nylig, denne musemodel af kolon tumordannelse er blevet brugt til at bestemme EE indvirkning på tyktarmen tumordannelse6. I Bice mfl. studere, EE fysiologiske og fænotypisk virkninger på hanner og hunner af fire forskellige mus linjer (wild-type (WT), Tcf4Het / + Apc+/ +, Tcf4+/ + ApcMin / +, og Tcf4 Het / + APCMin / +)) blev defineret. Måske var den mest interessante finde at EE øger levetiden for både mandlige og kvindelige kolon tumor-bærende dyr. Dette viste, at EE kan reducere i det mindste nogle af symptomerne forbundet med kolon tumordannelse, og forbedre dyrs sundhed. Bemærkelsesværdigt, denne forbedrede levetid hos mænd er ikke et direkte resultat af lavere tumordannelse, og i stedet var knyttet til indledningen af en tumor sårheling svar, herunder forbedret microbiome biodiversitet6.

Flere EE specifikke undersøgelser er blevet offentliggjort med interessante resultater. Fra et teknisk synspunkt er vigtige resultater ofte ikke kan oversættes til andre laboratorier. Opretholde identiske EE metoder mellem forskellige laboratorier er en utrolig komplekse spørgsmål, ikke kun på grund af berigelse enheder og boliger bruges, men også sengetøj, mad, ventilation, avl, genetik, aktivitet i stuen, og animalske protokol krav, blandt andre9,10,11. Et eksempel er animalske integration, hvor dyr skal stabilt integreres i mus koloni, derfor normalisere genetiske baggrund og kost sammensætning, for at undgå ikke-behandling relaterede effekter. Yderligere, mange EE undersøgelser er blevet gennemført før erkendelsen af betydningen af microbiome i sygdommen, og den måde, at fælles mus opdrætsmetoderne kan påvirke sammensætningen af gut microbiome10,12.

Avl strategi og dyr placering i EE kan øge stress, hvis ikke udføres korrekt. Da EE undersøgelser udnytte store mængder af både mandlige og kvindelige dyr og flere genotyper, kan eksperimentel opsætning være svært givet kravet om dyr fra flere kuld skal kombineres. Derfor, en avl og fravænning strategi blev udviklet for at give mulighed for kombinering af fravænnede dyr af den korrekte genotype fra forskellige kuld. Den primære begrundelse for dette var at normalisere mikrobiota blandt kuld og reducere stress, når dyrene blev flyttet til den eksperimenterende miljø. Microbiome blev overført fra dam10. Mikrobiel diversitet til kolonien blev, hunner købt fra Jackson Labs og integreret i kolonien til en måned før eksperimentet startede9,10,12. At yderligere normalisere microbiome biodiversitet mellem dyr, var kvinder Co opstaldet tidligere hen til opdragelse. Efter avl, kommunale boliger under opdræt og evnen til at undslippe forbedret sygepleje pups stressniveau maternel pleje13,14, eventuelt fremme microbiome normalisering. For at forhindre ikke-EE relaterede effekter på microbiome, dette kommunale boliger af alle forsøgsdyr forhindret kampene og yderligere stress, der opstod, da kombinere flere mænd fra forskellige kuld i en eksperimentel bur. Endelig indgik lig antallet af dyr af alle genotyper i bure. Dette gav mulighed for forbedrede mikrobiota biodiversitet på tværs af genotyper, og fjernet bidrag af men (dyrets tendens til at forbruge afføring) eller muligt genotype-specifikke adfærdsmæssige forskelle til den samlede undersøgelse.

Denne protokol giver en strategi, der udvider tidligere EE undersøgelser til at omfatte kendte aspekter af microbiome forskning, herunder mikrobiota transmission og dyr koloni integration for mikrobiota normalisering, aktivere mere ensartet microbiome populationer mellem forsøgsdyr. Give agt på disse forholdsregler er afgørende på grund af ikke-behandling relaterede mikrobiota forskelle evne til at forvirre undersøgelsesresultater. At fjerne ikke-EE-relaterede mikrobiota ændringer vil sætte forskerne specifikt definere EE rolle på mikrobiota sammensætning under sygdomsudvikling og progression.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle metoder, der beskrives her blev udført i overensstemmelse med protokoller godkendt af institutionelle Animal Care og brug udvalg (IACUC) på University of Utah.

1. eksperimentel Design og EE og kontrol bur Setup

Bemærk: For reference, en skitse af den eksperimentelle design er illustreret (figur 1).

  1. Nedsat kontrol (NE) og EE bure (figur 2).
    1. Konfigurer NE bure, anvende autoklaveres konventionelle kontrol bure (tabel 1), mangler berigelse enheder.
    2. Store bure, bore et hul pr. bur, der er stor nok til at rumme en grommet og tunnel (Tabel af materialer).
    3. Hvis du vil konfigurere pup opdræt og EE bure, forbinde to store autoklaveres bure med en steriliseret grommet sikrede tunnel og 2 steriliseret platforme at øge gulvplads (tabel 1). EE eksperimenter, give steriliseret kører hjul, tunneler, igloer, hytter, crawl bolde, og nesting materiale inden for EE bure.
    4. Placere både EE og NE bure i en ventileret rack til at give lige ventilation.
      Bemærk: To store bure med 2 platforme (tabel 1) giver mulighed for maksimalt 12 drægtige hundyr pr. hvalp opdræt setup15 (Se Tabel af materialer, trin 3.2 i dokumentet, og tabel 2).
    5. Feed mus ad libitum bestrålet standard chow og autoklaveres omvendt osmosevand.
    6. Give mus med steril sengetøj materialer.
      Bemærk: Alle manipulationer af Tom bure og bure med dyr skal ske i hood at forhindre forurening. Bur manipulation af store bure, dække hullet i bur med en selvklæbende film.
  2. Forberede dyr til avl. Gruppere hus 15 2 - måneder gamle hunner i et enkelt stort bur (tabel 1) for 2 uger inden parringen. Separat hus 2 - måneder gamle littermate mænd i 2 uger inden parringen.
    Bemærk: Antallet af hunner til formering er afhængig af forsøget, og antallet af dyr kræves. I denne undersøgelse, 15 hunner blev udnyttet for at få 12 sat hunner, som er maksimalt antal tilladte i den pup opdræt konfigurationen som beskrevet i punkt 1.1.2 (tabel 2).
  3. Til avl, kombinere far og dæmningen dyr, 1 mand pr. 2 hunner. Den første check i morgen bør være for vaginal stik, som kan være en visuelle tegn på, at dyrene har parret i løbet af natten.
    Bemærk: House hanner og hunner sammen, indtil hver kvinde har sat. En vaginal plug kan blive identificeret visuelt, hvis det er ekstern.
    1. For at påvise en internaliseret stik, en sonde indsættes i skedeåbningen og hvis vaginal stikket er til stede, sonden er ikke nemt (16; Se afsnit 4.3.6).
      Bemærk: Registrere en plug er opdaget som ½ dag, da den parring opstod i nat om morgenen.
    2. Når hunnen har vaginal stik, overføre dem til en stor hvalp opdræt bur til opstaldning i grupper med andre skytterne hunner (Setup i trin 1.1.2 uden berigelse enheder).
    3. Erstat parret hunner med nye unmated gruppe opstaldet hunner til parring og fortsætte parring for at opnå et maksimalt antal kuld i en 7-dages periode.
      Bemærk: Alle dyr skal have en leveringsdato senest 7 dage efter hinanden.
  4. Tillad gravide kvinder til at føde i gruppe boliger således at alle kuld er rejst i en stor hvalp opdræt bur (Setup i trin 1.1.2 uden berigelse enheder).
    1. Holde styr på pup numre og fødselsdage, og begynde genotypebestemmelse hvalpe 7 dage gammel.
      1. Tatovering unger på deres tæer på 7 dage i alder med en talkode til at identificere dem13,17.
      2. Ren tå med 70% ethanol og forsigtigt indsætte et micro-tatovering enhed indeholdende trykfarver i hudens overflade parallelt med toe17 (Se Tabel af materialer).
      3. Indsamle væv med saks til genotypebestemmelse fra hale tips ved incising et lille stykke væv fra 7 - døgn gammel nyfødte.
    2. Isolere genomisk DNA fra væv og udføre PCR ved hjælp af en konventionel HotSHOT metode, som beskrevet i 18.
    3. Separat dyr af sex på 14-21 dage i store bure med mødre.
      Bemærk: Sikre, at de ældre unger er i stand til foder på deres egen, og at yngre pups fortsat sygeplejerske indtil gamle nok til at brødføde deres egne.
    4. På 21-28 dage, distribuere mandlige og kvindelige dyr særskilt af genotype i NE eller EE miljøer, og sørg for at holde lige andele af hver genotype pr. bur (fig. 2A).
      Bemærk: Sikre, at det samlede antal dyr er tilladt i hver NE eller EE bur er baseret på det maksimale antal tilladte af IACUC (tabel 2). NE bure har højst 5 dyr (tabel 2). I EE bure, for social stimulering, ikke færre end 20, og med plads begrænsninger, må højst 41 dyr i EE bur (tabel 2).

2. fæces samling henne ved 16 ugens i alder

  1. Begynde taburet samling 1 til 2 dage før at ofre, og særskilt indsamling taburet på dagen for offer under dissektion ved hjælp af steril værktøjer.
    Bemærk: Indsamling taburet på samme tid 1-2 dage inden indsamlingen kan bidrage til at undgå tab af en stikprøve på grund af muligheden for at ingen afføring er til stede på tidspunktet for indsamlingen.
    1. At indsamle afføring fra levende dyr, omhyggeligt harmoniske dyret over et rent bur. Indsamling taburet ved hjælp af steril pincet i en steril mikrofuge rør.
      Bemærk: Dyrene vil typisk fjerne afføringen når immobiliseret, som giver mulighed for hurtig taburet samling direkte ind i en steril mikrofuge rør. Hvis et dyr ikke afføring straks når immobiliseret, læg det i et rent bur og vente for dyret at defecate (typisk op til 1 time).
    2. Indsamling taburet på dagen for offer.
      1. For euthanizing dyret, skal du placere dyret i en glasklokke, som indeholder en lille beholder med et stykke vat dyppet i isofluran. Når ophør af vejrtrækning er observeret (normalt efter 2 min), lå dyret på ryggen til at tillade kolon dissektion.
      2. Gælde mus maven 70% ethanol.
      3. Løft huden foran urinrørets åbning med pincet, og bruge saks til at klippe langs den ventrale midterlinjen indtil nå brystkassen, og skæres fra bunden af den første indsnit til hvert ben. Fold tilbage huden og bruge saks til at skære igennem den peritoneale væg i det samme mønster.
      4. Bruge pincet til at forstå den distale colon på anus til at dissekere og løsrive den distale colon fra endetarmen. Mens du trækker bruge kolon lodret med pincet, saks til at skære igennem mesenterium at frigive kolonet.
      5. Skære kolon lige under coecum og lægge den på filtrerpapir. Brug pincet til at løfte toppen af kolon tube, åbne lumen for at tillade en side åben saks skal indsættes. Skæres på langs, distalt for proksimale og erst open tyktarmen.
      6. Indsamling taburet fra den distale colon ind i en steril mikrofuge rør ved hjælp af steril pincet.
  2. Butik taburet i et mikrofuge rør på-80 ˚C indtil tidspunktet for bakteriel DNA isolation.
    Bemærk: På dagen for offer, ud over afføringen, indsamle andre prøver som fuldblod, serum, plasma, normal og tumor væv fra kolon og tyndtarmen, microsomes, fedtvæv, osv. adresse defineret spørgsmålene i undersøgelsen.

3. genomisk DNA isoleret fra skammel

Bemærk: Udnytte en kommerciel kit for at isolere mikrobielle DNA fra afføring efter en afføring patogen detektion protokol. Fjerne prøver direkte til-80 ˚C fryseren og butik på tøris under vejningen.

  1. Overføre op til 220 mg af afføring til en ren mikrofuge tube indeholder 1,4 mL af stuetemperatur (RT) afføringen lysisbuffer (Se Tabel af materialer).
  2. Vortex prøve for 1 min til grundigt homogeniseres tørstof (figur 2B). Varme suspension til 95 ˚C for 5 min til lyse alle bakterier (herunder Gram-positive bakterier).
  3. Vortex prøver for 15 s og derefter centrifugeres ved 20.000 x g i 1 min til pellet fæces tørstof. Overføre supernatanten til et 2-mL mikrofuge rør. Tilføje en tablet til hver prøve at absorbere PCR hæmmere, vortex indtil tabletten opløses, og der inkuberes prøve på RT for 1 min.
  4. Centrifugeres prøve ved 20.000 x g i 3 min og overføre supernatanten til et nyt mikrofuge-rør. Der centrifugeres ved 20.000 x g i 3 min. alikvot 15 μl af proteinase K (20 mg/mL lager) ind i en ny 1,5 mL mikrofuge rør. Tilsæt 200 μl af prøven ind i røret, der indeholder proteinase K.
  5. Tilføje 200 μl af guanidinium chlorid lysisbuffer til røret, vortex grundigt i 15 s (Se Tabel af materialer) og inkuberes prøve på 70 ˚C til 10 min. tilføje 200 μl af ethanol (96-100%) til rør og bland godt ved vortexing.
  6. Sted en silica baseret spin kolonne i et 2 mL indsamling rør og anvende prøverne til kolonnen. Luk låget og centrifugeres i 1 min på 20.000 x g.
  7. Overfør kolonnen til et nyt 2 mL indsamling rør og tilsæt 500 μL af wash buffer 1 til kolonnen, cap kolonnen og centrifugeres i 1 min på 20.000 x g. overførsel kolonnen til et nyt 2 mL indsamling rør og tilsæt 500 μL af vaskebuffer 2 til kolonnen , lukke den fælles landbrugspolitik og centrifugeres ved 20.000 x g i 3 min.
  8. Med fælles landbrugspolitik lukket, Overfør kolonnen til et nyt 2 mL indsamling rør og centrifugeres i en yderligere 1 min på 20.000 x g at fjerne resterende wash buffer. Overfør kolonnen til en 1,5 mL mærket mikrofuge tube og elueres prøven ved at tilføje 200 μl af eluering buffer der indeholder EDTA til membranen (Se Tabel af materialer).
  9. Luk hætten og inkuberes ved RT i 1 min. Centrifuge prøven for 1 min på 20.000 x g. udsmid kolonnen.

4. DNA koncentration beslutsomhed og prøveforberedelse til PCR

Bemærk: Udnytte en fluorometer og en kommercielt tilgængelig dsDNA fluorescenstest at bestemme genomisk DNA koncentrationen i hver prøve (Se Tabel af materialer). Den fluorescerende farvestof skal binde dobbelt strandede DNA specifikt.

  1. Forberede en 1:200 fortynding af hver prøve (1 µL af hver prøve i 199 µL dsDNA master mix) og en 1:50 udvanding af standarder. Analysere på en fluorometer ved hjælp af indstillingen dsDNA.
    Bemærk: En stor mængde af DNA i PCR kan være hæmmende, derfor, mængden af DNA anvendes må ikke være mere end 10% af den endelige mængden af PCR. En fluorometer giver mulighed for nøjagtig måling af DNA i stikprøven, som kun DNA bundet til den fluorescerende farvestof vil fluorescerer, eliminerer den mulige bidrag af forurenende stoffer til den endelige beregnede DNA koncentration. Denne præcise kvantitering er afgørende for programmet downstream sekvensering.
  2. Forberede PCR skabeloner fortyndes til 5 ng/μl med den passende mængde i 10 mM Tris, pH 8,5 til gøre skabelon der arbejder bestande af hver prøve.
  3. Gemme prøver på-20 ° C.

5. design primere til 16S ønskede V regioner

  1. Design primere til selektivt forstærke de ønskede V 16S rRNA regioner.
  2. Analysere primere med sonde Match, fra ribosomale databaseprojekt19, for at bestemme den omtrentlige hit-rate for forskellige phyla.
    Bemærk: V1-V3 regioner offentliggjort den nuværende undersøgelse bruges primere samt fremad20, som binder på position 8 inden for regionen V1 og 533 omvendt21, som binder på holdning 533 i regionen V3. Primere skal omfatte overhæng adapter sekvenser til indeksering.
  3. Når du udformer primere, omfatte adapter sekvenser i 5' enderne af hver primer, som anbefales til 16S metagenomics sekventering bibliotek forberedelse22 (tabel 3).
  4. Syntetisere disse store primere med patron rensning. Rekonstruere udtørret primere og fortynde en PCR arbejder materiel til 1 μM i 10 mM Tris, pH 8,5.

6. amplikon PCR til at forstærke V region(er) med udhæng Adapter sekvenser knyttet 22

  1. Oprette amplikonen PCR-mastermix, som beskrevet i tabel 4.
  2. Placer en selvklæbende klart PCR plade segl på pladen og køre amplikon PCR ved hjælp af parametrene i tabel 5.
  3. (Valgfrit) Køre amplikon PCR produkter på en agarosegel eller en høj følsomhed DNA analyse, der giver mulighed for kvantitativ måling af amplikon størrelse (Se Tabel af materialer).
    Bemærk: Amplikon størrelse fra denne undersøgelse er 550 bp (fig. 3A).

7. PCR oprydning ved hjælp af magnetiske perler 22

  1. Der centrifugeres amplikon PCR plade hurtigt ved 1.000 x g i 1 min til at indsamle kondens.
    Bemærk: PCR rør strimler kan bruges i stedet for PCR plader til at minimere forurening. Kassér tube låg og aldrig genbruge.
  2. Vortex de magnetiske perler til jævnt sprede dem, og tilsættes 20 μL af magnetiske perler til hver amplikon PCR godt, derefter afpipetteres hele diskenheden op og ned langsomt 10 gange.
  3. Der inkuberes ved RT i 5 min. sted PCR-plade på en magnetisk står for 2 min indtil magnetiske perler er indsamlet og supernatanten er klart. Fjern og kassér supernatanten.
  4. Vask perler med 200 μl friske 80% ethanol mens PCR-plade er på den magnetiske stå og Inkuber i 30 s på RT på den magnetiske stand. Fjern forsigtigt supernatanten.
  5. Gentag vask for en anden gang. Nu bruge et fint pipette tip til at fjerne enhver resterende ethanol fra brøndene og lade lufttørring i 10 min.
  6. Fjern PCR-plade fra den magnetiske stå og tilføje 52,5 μl af 10 mM Tris pH 8,5 til hver brønd. Pipetteres op og ned 10 gange at suspendere perler og inkuberes ved stuetemperatur i 2 min.
  7. Overføre PCR-plade til den magnetiske stand til indsamle magnetiske perler og 50 μL af supernatanten overføres til en ren PCR-plade. Placer en selvklæbende klart PCR plade segl på pladen og opbevares ved-20 ˚C i op til en uge.

8. forberedelse af en plade ordning for indekset PCR

Bemærk: For at generere en V1-V3 bibliotek, en anden PCR blev udført med et indeks kit (Se Tabel af materialer). En standard indekserer ordningen blev brugt til at kortlægge unikke dual indeks kombinationer for hver prøve (fig. 3B og 23).

  1. Sikre, at hver prøve har en unik kombination af 2 indeks primere (dvs.dobbelt indeksering).

9. udføre indeks PCR vedhæfte stregkoder til adapter-sekvenser som beskrevet 22 .

  1. 2,5 μL af PCR-amplikoner (ren amplikoner) overføres til en ny 96 godt plade og sted i en indeks plade armatur til støtte i indeksering.
  2. Arrangere indeks 1 og indeksere 2 primere som i eksemplet med rede plade grafik (fig. 3B).
    Bemærk: Visuelle stikord er forudsat for at undgå primer forvekslinger: indeks 2 primer rør bør have hvid caps og klar løsning, mens indekset 1 primer rør bør have orange caps og gule løsning.
  3. Saml indeks PCR Mix reaktion som beskrevet i tabel 6. Mix af pipettering op og ned 10 gange. Dække med en klæbende klart PCR plade segl og centrifugeres for at indsamle på 1.000 x g ved stuetemperatur i 1 minut.
  4. Køre indeks PCR ved hjælp af parametrene i tabel 7.

10. rense endelige PCR bibliotek

Bemærk: Denne PCR clean-up er identisk med trin 7 ovenfor, og bruger magnetiske perler til at udføre PCR Clean-Up af indeks PCR22.

  1. Der centrifugeres PCR-plade fra trin 10 hurtigt ved 1.000 x g i 1 min til at indsamle kondens.
  2. Vortex de magnetiske perler til jævnt og sprede dem, derefter tilsættes 20 μL af magnetiske perler til hver amplikon PCR godt, derefter afpipetteres i hele volumen op og ned langsomt 10 gange for at blande.
  3. Der inkuberes ved RT i 5 min.
  4. Sted PCR plade på en magnetisk stå i 2 min. indtil magnetiske perler er indsamlet og supernatanten er klart. Fjern og kassér supernatanten.
  5. Vask perler med 200 μl friske 80% ethanol mens PCR-plade er på den magnetiske stå og Inkuber i 30 s ved stuetemperatur på de magnetiske stand. Fjern forsigtigt supernatanten.
  6. Gentag vask for en anden gang.
  7. Efter den anden vask, skal du bruge et fint pipette tip til at fjerne enhver resterende ethanol fra brøndene og lade lufttørring i 10 min.
  8. Fjern PCR-plade fra den magnetiske stå og tilføje 52,5 μl af 10 mM Tris pH 8,5 til hver brønd. Pipetteres op og ned 10 gange at suspendere perler og inkuberes ved stuetemperatur i 2 min.
  9. Overføre PCR-plade til den magnetiske stand til indsamle magnetiske perler og 50 μL af supernatanten overføres til en ren PCR-plade. Placer en selvklæbende klart PCR plade segl på pladen og opbevares ved-20 ˚C i op til en uge.
  10. (Valgfrit) Køre indeks PCR produkter på en agarosegel eller en høj følsomhed DNA analyse, der giver mulighed for kvantitativ måling af amplikon størrelse (Se Tabel af materialer).
    Bemærk: Den endelige indekserede bibliotek størrelse fra denne undersøgelse var 668 bp (figur 3C-D).

11. kvantificere, normalisere, og samle de indekserede biblioteker til sekvensering

  1. Bestemme DNA koncentrationen af hver prøve med en fluorometer og en dsDNA fluorescenstest kit (se tabel af materialer).
    1. Forberede en 1:200 fortynding af prøven (1 µL af hver prøve i 199 µL dsDNA master mix, som omfatter buffer og reagens) for hver af de indekserede prøver og standarder (190 µL dsDNA master mix og 10 µL af standard). Analysere på en fluorometer ved hjælp af indstillingen dsDNA.
  2. Efter beregningen DNA koncentration normalisere bibliotekerne ved at beregne den gennemsnitlige bibliotek størrelse. Gøre dette ved at addere adapter længder, indeks længder og V-amplikon størrelse fra primere, og se produkter af agarosegel at være sikker på den faktiske størrelse er svarer til den beregnede størrelse (figur 3C, se 22).
    1. Alternativt kan du bruge en høj følsomhed DNA analyse, der giver mulighed for kvantitativ måling af DNA integritet, amplikon størrelse og koncentration (tabel af materialer, figur 3D).
      Bemærk: I denne undersøgelse, var den gennemsnitlige bibliotek størrelse beregnes baseret på addere adapter længder, indeks længder og V1-V3 amplikon størrelse fra primere. Gennemsnitsstørrelsen var 668 bp.
    2. Koncentrationer af prøver er normaliseret, ved hjælp af formlen i tabel 8.
  3. Fortynd prøver til 4 nM og pool 5 μL fra hver 4-nM prøve ind i et enkelt rør til sekvensering.

12. sekvens biblioteket ved hjælp af en næste Generation Sequencing System og analysere Data

  1. Sekvens biblioteket.
    Bemærk: For denne undersøgelse udført University of Utah høj overførselshastighed genomforskning Core bibliotek denaturering og prøve sekventering (som beskrevet i 6,22).
  2. Analysere dataene.
    Bemærk: For at adskille data fra poolede prøver, blev indeks læser identificeret og adskilt (som beskrevet i 22).
  3. Generere FASTQ filer og udnytte dette til efterfølgende dataanalyser.

13. analysere sekventeret Data fra 16S amplikon bibliotek

Bemærk: Dette trin udføres som beskrevet i Bice mfl., 20176.

  1. Installere frit tilgængelige data analyseværktøjer (Se Tabel af materialer 24).
  2. Samle demultiplexed fastq filer fra sekventeret data (som beskrevet i25,26). Kassér alle usamlet sekvenser.
  3. Udføre analyser efter en de novo åben taksonomisk enhed (OTU) picking protokol (som beskrevet i 27).
    1. Bin sekvenser i en enkelt fastq fil af sampleID og gruppen sekvenser med 97% eller større lighed i OTUs, som beskrevet i 28. Juster repræsentative sekvenser af core med minimal sekvens længde 150 og 75% procent identitet29,30. Tildele taksonomi som beskrevet28.
      Bemærk: Prøver kan blive arkiveret lodret og analyseret31, efterfulgt af taksonomiske tildeling og OTU tabel konstruktion32.
    2. Oprette en tilknytningsfil, der identificerer beskrivende navne og karakteristika af prøver at linke til prøven identifikation og validere kortlægning fil33,34.
    3. Gøre en OTU netværk, der forbinder OTUs at prøve beskrivelser ved hjælp af en kortlægning fil35.
    4. Beregne taksonomi resuméer i relativ overflod af sammenfatter taxa gennem parceller36.
    5. Udforske alpha mangfoldighed af prøver på ensartet sekventering dybde passende til prøver. For at definere de passende dybde for alpha mangfoldighed, opsummere samlede tæller observeret i hver prøve ved hjælp af kommandoen biom opsummere-tabel som beskrevet i 37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Flere undersøgelser har vist, at praksis for sind-krop medicin forbedrer sundhedsresultater. På samme måde i mus forbedrer miljøberigelse resultater herunder forbedrede levetid og tumor sår reparation6. Derfor, en EE procedure blev udviklet med formålet at definere rollen som mikrobiota i denne fænotype mens første normalisere microbiome forud for indledningen af eksperiment (figur 1). Vigtigere, alle avlsdyr er integreret i mus-koloni i mindst en måned inden påbegyndelsen af avl, og nyfødte unger er co opstaldet med mødre i et stort bur til at normalisere mikrobiota transmission inden eksperimentet. Når dyr er mellem 21 og 28 dage gammel, er lige mange af hver genotype vænnet til deres respektive bolig, enten EE eller NE miljøer (fig. 2A). På 16 uger, taburet fra alle dyr er indsamlet og homogeniseret (figur 2B), efterfulgt af bakteriel DNA isolation. Endelig, 16S amplikoner forstærkes fra afføring microbiome DNA og stregkode indekseret for at muliggøre sekventering af alle microbiome biblioteker samtidigt (figur 3). De unikke sekvenser identificeret i WT og tumor forsynet med dyr i både NE og EE betingelser er vist i figur 4. Interessant, EE forbedre ikke biodiversiteten i WT dyr, men øger langt biodiversiteten i tumor forsynet med dyr (figur 4), viser, at denne metode giver mulighed for biodiversitet forbedringer. Denne forøgelse af biodiversiteten kan tilskrives øget forekomst af phylum proteobakterier, med betydelige stigninger i klasserne Alphaproteobacteria og Betaproteobacteria, og falder i patogene Gammaproteobacteria (figur 5 ; Supplerende tabel 1). Den største stigning er i Betaproteobacteria klasse er slægten Sutterella, et sandsynligt kommensale involveret i udskilles IgA nedbrydning (figur 6, også se38).

Figure 1
Figur 1 : En repræsentation af de eksperimentelle tidslinjen. De korte bands repræsenterer 7-dages windows, så de fleste af protokollen er gennemført i 7-dages intervaller. Dette også hjælpemidler i visualisering af rækken af pup aldre på tværs af eksperimentet. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : EE og NE boliger betingelser og taburet homogenater (som beskrevet i protokollen). Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : 16S Microbiome bibliotek forberedelse. (A) urenset PCR-amplikon produkter afledt af afføring genomisk DNA. ()B) indeksering plade grafisk designet som den anvendte software (Tabel af materialer, 23). Dobbelt indeks kombinationer, I7 (indeks 1; Række) og I5 (indeks 2; Kolonne), der vises for hver prøve. Hvert indeks er 8 bp i længden. Prøven numre henviser til de respektive mus numre fra EE undersøgelser. (C) urenset indeks PCR produkter. (D) kvaliteten analyse af endelige renset og samlet 16S biblioteker. (A, C, D) Sorte pile betegne 550 bp amplikon og 668 bp indekserede bibliotek. Røde pile angiver ikke-specifikke produkter, der er fjernet efter rensning, som vist i D. Øvre og nedre markører er størrelse markører tilsættes prøven for størrelse reference. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4 : Ændringer i alpha mangfoldighed efter EE af Tcf4Het / + ApcMin / + dyrene. Alpha mangfoldighed af WT og Tcf4Het / + ApcMin / + tumor forsynet med dyr. På 20.000 læser, NE og EE for WT, p= 0,64 og NE og EE af Tcf4Het / + ApcMin / +, p= 0,03 ved hjælp af t-test med dobbelt stikprøve med Welch korrektion. Tilpasset fra Bice mfl., 20176. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5 : EE-medieret ændringer efter EE af Tcf4Het / + ApcMin / + dyrene. R-ggplot2 genereret box-whisker parceller betegner ændringer i overflod af phylum proteobakterier og klasserne Alphaproteobacteria, Betaproteobacteria og Gammaproteobacteria. Outliers er noteret som cirkler. p= 0,005 ved hjælp af to stikprøver med t-test med Welch korrektion. Fejllinjer, der beregnes ved hjælp af standard fejl af middelværdien (SEM). Tilpasset fra Bice mfl., 20176. Venligst klik her for at se en større version af dette tal.

Figure 6
Figur 6 : Ændringer i de relative forekomst af Sutterella efter EE af Tcf4Het / + ApcMin / + dyrene. Outliers er noteret som cirkler. p= 0,005 ved hjælp af t-test med dobbelt stikprøve med Welch korrektion. Fejllinjer, der beregnes ved hjælp af SEM. Adapted fra Bice mfl., 20176. Venligst klik her for at se en større version af dette tal.

Supplemental Table 1
Supplerende tabel 1: klassifikation af bakterier isoleret fra afføring indsamlet fra NE og EE mus. Klassificering på tværs af genotyper på (A) Phylum, (B) klasse, (C) Order, (D) familie og (E) slægten plan. Sammenligninger af NE og EE af samme genotype eller WT til Tcf4Het / + ApcMin / +. P-værdierne beregnes ved hjælp af en t-test med dobbelt stikprøve med Welch korrektion. Tilpasset fra Bice mfl., 20176. Venligst klik her for at downloade denne fil.

Varen Samlede areal (tommer2) Samlede areal (cm2) Bur størrelse (tommer) L x W x H Bur størrelse (cm) L x W x H
Ét kontrolelement bur (NE) 68.25 440.32 10.5 x 6,5 x 5,5 26.67 x 16.51 x 13.97
Et stort bur (EE) 264.36 1706.32 13.87 x 19.06 x 7,75 35.24 x 48.42 x 19.69
To store bure (EE) 528.72 3412.64 2 @ 13.87 x 19.06 x 7,75 2 @ 35.24 x 48.42 x 19.69
To platforme (EE) 93 600 2 @ 11,8 x 3,94 x 2,95 2 @ 30 x 10 x 7,5
To store bure med to platforme (EE) 621.72 4013 2 @ 13.87 x 19.06 x 7,75 + 2 @ 11,8 x 3,94 x 2,95 2 @ 35.24 x 48.42 x 19.69 + 2 @ 30 x 10 x 7,5

Tabel 1: EE og NE bur størrelser og gulvplads.

Dyr tilladt i bur Kræves Inches Squared pr. dyr EE burarealet (Inches2) Samlede dyr tilladt
Op til 25 12 622 i2 (4013 cm2) op til 25
25 + 15 622 i2 (4013 cm2) op til 41
Kvinde med strøelse 51 622 i2 (4013 cm2) op til 12

Tabel 2: antal dyr er tilladt i bure baseret på gulvplads 15 .

Amplikon PCR primere
Fremad 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3 '
Omvendt 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 '
Locus specifikke sekvenser er vist i fed og den ikke-fed er overhæng adapter sekvensen.

Tabel 3: -amplikon PCR primere.

Amplicon PCR reaktion oprettet
Volumen
Mikrobielle DNA (5ng/μl) 2,5 μl
Videresende Primer (1 μM fra trin 5.1.2) 5.0 μl
Vende Primer (1 μM fra trin 5.1.2) 5.0 μl
2 x HotStart klar Mix 12,5 µl
I alt 25,0 μl

Tabel 4: -amplikon PCR Mix.

Amplicon PCR sat op
95 ° C i 3 minutter
25 cyklusser af:
95 ° C i 30 sekunder
55 ° C i 30 sekunder
72 ° C i 60 sekunder
72 ° C i 3 minutter
Hold ved 4 ° C

Tabel 5: Amplikon PCR programmet indstillet.

Indeks PCR stregkode forsamling
DNA 2,5 μl
Indeks Primer 1 (N7XX) 2,5 μl
Indeks Primer 2 (S5XX) 2,5 μl
2 x HotStart klar Mix 12,5 µl
PCR grade vand 5 μl
I alt 25 µl

Tabel 6: indeks PCR Mix.

Indeks PCR Setup
95 ° C i 3 minutter
8 cyklusser af:
95 ° C i 30 sekunder
55 ° C i 30 sekunder
72 ° C i 30 sekunder
72 ° C i 5 minutter
Hold ved 4 ° C
Opbevares ved-20 ° C

Tabel 7: indeks PCR Program sat op.

Prøven koncentration formlen til sammenlægning
(DNA koncentration i ng/µl) x 106 = koncentration i nM
(660 g/mol x gennemsnitlig bibliotek størrelse)
Et eksempel fra denne undersøgelse er:
(85.2 ng/µl) x 10 ^ 6 = 193.3 nM
(660 g / mol x 668 bp)

Tabel 8: formel for normaliseringen før samle prøver

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Denne procedure giver mulighed for analyse af mikrobiota isoleret fra afføring efter miljøberigelse normal eller tumor forsynet med dyr. Fordi disse er store eksperimenter, der involverer avl for at få mange dyr af forskelligt køn og genotyper, normalisere microbiome mellem dyr før påbegyndelsen af eksperimentet er vigtigt at undgå ikke-EE relaterede effekter på microbiome biodiversitet.

For sammenhængen mellem NE og EE betingelser, er avls-processen gennemført for at sikre, at alle mus i første omgang har udsat for de samme mikrober og derfor forventes at have lignende microbiome indholdet. Det er muligt, og sandsynligvis, at musen genotype påvirker microbiome sammensætning. Derfor vedligeholdes mus numre pr. genotype mellem NE og EE betingelser for at være sikker på, at alle dyr, som forbrugende afføring vil støde på en lignende mangfoldighed af microbiome.

Flere vanskeligheder er synlige, når designe EE eksperimenter. Først, det samlede antal dyr, der er nødvendige for eksperimenterne er afhængig af de eksperimentelle detaljer, men det samlede antal er også begrænset af antallet af dyr tilladt i buret. For eksempel, historiske data omkringliggende mus overlevelse i en indledende EE eksperiment blev brugt til at beregne antallet af dyr til at definere den mekanisme underliggende forbedret overlevelse observeres i tidligere forsøg. Fra disse data, ialt 17 dyr i sammenligningsgruppen var nødvendig for en 80% strøm til at påvise en forskel i overlevelse i en to-sidet t-test, hvor alpha = 0,05. Så skal 4-5 dyr i kontrolgruppen vs 20-24 (eller op til 41) dyr pr. bur i den eksperimentelle gruppe rumme en magt beregning. Derfor er flere kontrol gruppe bure nødvendigt sammen med den eksperimentelle bur. Yderligere, med komplekse genotyper, det er vanskeligt at opnå tilstrækkelig animalsk antal hver genotype, hvilket nødvendiggør det store antal avl hunner kræves. Dog med andre modeller, hvor færre transgene forskelle er til stede, flere dyr af den samme genotype kan analyseres i dette system og færre opdrættere er nødvendige. I USA, kan 12 gravide kvinder blive opstaldet i 633 i2 plads (tabel 2). Problemet med dette er, at som unger bliver ældre, de fylder mere. Da mandlige unger er adskilt fra kvindelige unger på 14-21 dage, en godkendt undtagelse til reglen om plads i visse lande kan være muligt. Ellers, mandlige og kvindelige unger kan være genotypebestemmes og valgt, og derefter adskilt i en yngre alder med mødre til at holde sig under de maksimale mus numre. Det er vigtigt at få godkendelse til disse undersøgelser og til at overholde lokale bestemmelser på plads begrænsninger. Endelig, med mikrobiota, antallet af dyr, der er nødvendige for at opdage selv små forskelle i mikrobiota sammensætning er vanskeligt at beregne på forhånd. I denne undersøgelse, fandtes betydelige forskelle i mikrobiota med 4 dyr pr. gruppe, det er muligt at øge antallet dyr ville afsløre mikrobiota som er mere variabel mellem EE mus eller er kun lidt ændret af EE.

Denne metode beskrives særlige udstyr og sengetøj, der bruges, som på overfladen kan være afgørende. Men flere ikke-indlysende spørgsmål, der påvirker konsekvens kan blive stødt og skal løses før man indlader sig på disse meget store, dyre og tidskrævende undersøgelser. Et stort problem er bur ventilation. Med et stort antal dyr i et bur, ventilation bliver et problem, og er et spørgsmål, som de fleste forskere ikke tager i betragtning når du forsøger at give konsekvente miljøer mellem kontrol og eksperimentelle bure. Alle bure i beskrives opsætningen er placeret i en ventileret skab til at udligne ventilation på tværs af de eksperimentelle og styre bure. Dette kan ikke ske, når du bruger bure at, der ikke passer i en ventileret skab. Andre midler til at normalisere ventilation mellem eksperimentelle og kontrollere dyr kunne være afprøvet og anvendt konsekvent, men disse metoder er ikke undersøgt i denne undersøgelse. Lignende konsistens spørgsmål opstår med sengetøj. I colon cancer modelsystem anvendes i denne undersøgelse, dyr, der har mave sygdom vil indtage visse typer af strøelse, især majs cob sengetøj, fører til fordøjelsessystemet blokeringer og sygdom. Det er vigtigt at holde dette i tankerne, hvis dyrene er kendt for at indtage sengetøj da ellers ikke besat, som i kontrolmiljøet. Dette fænomen og de efterfølgende inkonsekvent sundhedsvirkninger påvirker dybt alle data.

Ribosomale 16S genet er blevet brugt som et middel til at studere bakteriel populationer. Det indeholder ni regioner, der udtrykker genetisk variation, V1-V9 og spækket bevarede dele, der forbliver relativt uændret mellem bakteriearter39. V1-V3-regionen, navnlig giver den højeste sandsynlighed for arter-niveau identifikation39. Lignende V1-V3 undersøgelser på kolorektal Cancer (CRC) og avancerede kolorektal adenom fandt ændringer i tre phyla af interesse: Bacteroidetes, Firmicutes og proteobakterier21,40,41. Det er også blevet rapporteret, at motion kan flytte den mikrobielle population og føre til en stigning i Firmicutes42. Derfor, denne undersøgelse identificeret microbiome befolkninger ved hjælp af V1-V3 primere efter en 16S metagenomic bibliotek prep protokol22 til potentielt definere virkningerne af miljøberigelse på disse phyla kendt ændres i adenom og CRC. Denne procedure kan ændres til at forstærke og sekvens andre variable regioner af 16S rRNA gener. En måde er at bruge sonden Match til at forstå den fylogenetiske klassificering af mikrobiota til stede i prøven, der identificeres af sonden. På denne måde kan sonder målrettes specifikt definere og Fylogenetisk klassificere mikrober af interesse. Dette giver mulighed for en forskellig karakterisering af mikrobiota stede i afføringsprøver, og kan afsløre yderligere EE-afhængige, ændringer i microbiome tumor forsynet med mus, der kan påvirke sygdomsprogression.

Ved hjælp af denne procedure, slægten Sutterella blev udpeget som den mest ændrede slægten efter EE af tumor forsynet med dyr. Denne procedure kan være tilpasset til at rumme undersøgelser, der udnytter enhver metode, der er beregnet til at analysere virkningerne af en undertrykkelse af netbårne på microbiome sammensætning i genetisk modificerede modeller af sygdomme hos mennesker. For eksempel, i stedet for EE, kunne mus blive podet med Sutterella til at definere, om Sutterella podning er tilstrækkelige til at øge mikrobielle biodiversitet og sår reparation i 16 uger gamle mandlige tumor forsynet med dyr.

Uden tvivl er det mest unikke aspekt af denne protokol bekymringen over normalisere mikrobiota før EE og opretholde microbiome mangfoldighed i hele EE undersøgelser. Da microbiome undersøgelser løbende forbedring, er det sandsynligt, at mere solide metoder for kendetegner microbiome vil opstå, og microbiome karakterisering i denne protokol vil blive forældet. For eksempel, med den aktuelle undersøgelse har sonder anvendes til at forstærke 16S rRNA bias, afhængigt af de sonder, der er valgt, og ikke kendetegner alle bakterier til stede i microbiome. Mens metoderne til undersøgelse og karakterisere microbiome vil utvivlsomt forbedre, eksperimenter den grundlæggende fundament af design og kører EE mens holde normalisering af microbiome i tankerne vil forblive en vigtig facet af EE eksperimenter.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer, de har ingen interessekonflikter.

Acknowledgements

Vi takker B. Dalley i University of Utah genomforskning kerne for biblioteket sekventering, og K. Boucher i University of Utah Biostatistik kerne for statistisk råd og adgang til disse tekniske kerner støttet af National Cancer Institute tildeling P30 CA042014. Projektet beskrevet blev støttet af National Cancer Institute tilskud P01 CA073992 og K01 CA128891 og jægeren Cancer Foundation.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics