Um método para definir os efeitos do enriquecimento ambiental sobre a biodiversidade de Microbiome cólon em um modelo de Tumor de cólon de Mouse

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Enriquecimento ambiental (EE) é um ambiente de alojamento dos animais que é usado para revelar os mecanismos que fundamentam as conexões entre o estilo de vida, estresse e doença. Este protocolo descreve um procedimento que utiliza um modelo do rato da tumorigênese cólon e EE para definir especificamente alterações na microbiota biodiversidade que pode afetar a mortalidade de animais.

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vários estudos recentes ilustraram os efeitos benéficos de viver em um ambiente enriquecido em melhorar a doença humana. Em camundongos, enriquecimento ambiental (EE) reduz a tumorigênese ativando o sistema imunológico do mouse, ou afeta a sobrevivência animal do tumor rolamento, estimulando a resposta de reparação de ferida, incluindo diversidade microbiome melhorada, no microambiente do tumor. Desde que aqui é um procedimento detalhado para avaliar os efeitos do enriquecimento ambiental sobre a biodiversidade da microbiome em um modelo de tumor de cólon do rato. Precauções em matéria de criação de animais e considerações para integração de colônia de genótipo e mouse animal são descritas, que acabará por afectar a biodiversidade microbiana. Atendendo a estas precauções pode permitir a transmissão de microbiome uniforme mais e consequentemente irá aliviar efeitos dependentes do não-tratamento que podem confundir as conclusões do estudo. Além disso, neste procedimento, as alterações da microbiota são caracterizadas usando 16S rDNA de sequenciamento de DNA isolado de fezes coletadas de cólon distal após enriquecimento ambiental a longo prazo. Desequilíbrio de microbiota do intestino está associado com a patogênese da doença e cólon câncer de inflamação intestinal, mas também de obesidade e diabetes entre outros. Importante, este protocolo para análise EE e microbiome pode ser utilizado para estudar o papel da patogênese microbiome através de uma variedade de doenças onde existem modelos de rato robusto que pode recapitular a doença humana.

Introduction

Estudos de enriquecimento ambiental (EE) utilizam parâmetros de complexo habitacional para afetar a estimulação social (habitação grandes gaiolas, grandes grupos de animais), estimulação cognitiva (cabanas, túneis, materiais de nidificação, plataformas) e atividade física (correr rodas). EE tem sido utilizada por muitos laboratórios para compreender os efeitos da atividade aumentada e melhorada de interações sociais e cognitivas na doença início e progressão usando uma ampla gama de modelos do rato, incluindo a alopécia induzida barbeiro, a doença de Alzheimer, Síndrome de Rett e doença tumoral e digestivo vários modelos1,2,3,4,5,6.

Vários modelos de mouse foram desenvolvidos para estudar a tumorigênese de cólon em ratos. Talvez o modelo mais bem definido é o mouse ApcMin . O mouse ApcMin foi desenvolvido no laboratório de William pomba em 19907e tem sido usado como um modelo do rato de mutações no gene APC que são comumente associados com câncer colorretal humano. Em contraste com os humanos abrigando mutações do APC , ApcMin ratos principalmente desenvolvem pequenos tumores intestinais, com ocorrência muito rara de tumores de cólon. No entanto, um alelo Tcf4Het com uma única mutação heterozigoto knockin-nocaute em Tcf4, aumenta vastamente tumorigênese cólon quando combinado com o alelo de ApcMin 8. Recentemente, este modelo de rato da tumorigênese cólon serviu para determinar os efeitos de EE no cólon tumorigênese6. No Bice et al. estudar, os efeitos fisiológicos e fenotípicos de EE nos machos e nas fêmeas de quatro linhas de mouse diferente (tipo selvagem (WT), Tcf4Het / + Apc+ +, Tcf4+ + ApcMin / +, e Tcf4 Het / + APCMin / +)) foram definidos. Talvez a descoberta mais interessante foi que EE aumenta significativamente a vida útil dos animais de rolamento de tumor de cólon tanto masculinos como femininos. Isto demonstrou que EE pode reduzir pelo menos alguns dos sintomas associados a tumorigênese do cólon e melhorar a saúde animal. Notavelmente, este prazo de vida melhorado nos machos não é um resultado direto da tumorigênese reduzido e em vez disso, estava relacionado com o início de uma resposta, incluindo melhoria microbiome biodiversidade6de cicatrização de feridas de tumor.

Vários estudos específicos de EE têm sido publicados com resultados interessantes. No entanto, do ponto de vista técnica, importantes resultados muitas vezes não são traduzíveis para outros laboratórios. Manutenção de metodologias EE idênticas entre diferentes laboratórios é um incrivelmente complexa, não só devido a dispositivos de enriquecimento e habitação usada, mas também roupa de cama, comida, ventilação, reprodução, genética, atividade em sala e do protocolo de animais requisitos, entre outros9,10,11. Um exemplo é a integração de animais, onde os animais devem ser estàvel integrados a colônia de rato, portanto normalizando a composição genética da dieta e plano de fundo, para evitar efeitos relacionados não-tratamento. Além disso, muitos estudos EE foram concluídos antes da realização da importância da microbiome na doença e a maneira que práticas de maneio comuns do mouse podem afetar a composição do intestino microbiome10,12.

Colocação de estratégia e animal de criação em EE pode aumentar o estresse se não for executado corretamente. Desde que estudos EE utilizam grandes números de animais machos e fêmeas e vários genótipos, instalação experimental pode ser difícil dada a exigência de animais de várias ninhadas para ser combinado. Portanto, uma criação e estratégia de desmame foi desenvolvido para permitir a combinação de animais desmamados com o genótipo de correto de ninhadas diferentes. A principal justificativa para isso foi para normalizar a microbiota entre ninhadas e reduzir o estresse, quando os animais foram transferidos para o ambiente experimental. A microbiome foi transmitido do dam10. Para fornecer diversidade microbiana para a colônia, fêmeas foram adquiridas de laboratórios de Jackson e integradas a colônia por um mês antes do início do experimento de10,9,12. Para normalizar mais microbiome biodiversidade entre os animais, as fêmeas foram co alojadas antes da reprodução. Após a criação, habitação comunal durante a criação e a capacidade de escape enfermagem filhotes melhoraram os níveis de estresse de cuidados maternos13,14, possivelmente promover microbiome normalização. Para evitar a não-EE relacionados com efeitos sobre a microbiome, esta habitação comunal de todos os animais experimentais impediu estresse adicional e luta que ocorreu quando combinando vários machos de ninhadas diferentes em uma gaiola experimental. Finalmente, um número igual de animais de todos os genótipos foram incluído nas gaiolas. Isto forneceu a oportunidade para a biodiversidade da microbiota melhorada através de genótipos e removido a contribuição de coprofagia (tendência do animal para consumir fezes) ou possíveis diferenças comportamentais de genótipo específico para o estudo global.

Este protocolo fornece uma estratégia que expande os estudos anteriores EE para incluir aspectos conhecidos de microbiome pesquisa, incluindo integração de colônia transmissão e animal microbiota para normalização da microbiota, para permitir mais uniforme microbiome populações entre animais experimentais. Atendendo a estas precauções é essencial devido à capacidade de não-tratamento relacionados microbiota diferenças para confundir as conclusões do estudo. Eliminação não-EE relacionadas com alterações da microbiota permitirá aos pesquisadores definir especificamente o papel do EE na composição da microbiota durante o desenvolvimento da doença e a progressão.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos os métodos aqui descritos foram realizados em conformidade com os protocolos aprovados pelo cuidado institucional do Animal e Comissão de utilização (IACUC) da Universidade de Utah.

1. delineamento e EE e configuração do controle gaiola

Nota: Para referência, um esboço do projeto experimental é ilustrado (Figura 1).

  1. Configurar controle (NE) e gaiolas EE (Figura 2).
    1. Para configurar NE gaiolas, use gaiolas autoclavado controle convencional (tabela 1) que não possuem dispositivos de enriquecimento.
    2. Para gaiolas grandes, faça um furo por gaiola que é grande o suficiente para acomodar um túnel (Tabela de materiais) e anilha.
    3. Para configurar o filhote criação e gaiolas EE, conectar-se dois grandes gaiolas autoclavadas com um túnel seguro ilhó esterilizado e 2 plataformas esterilizadas para aumentar o espaço de chão (tabela 1). Para experiências EE, fornece esterilizado executando rodas, túneis, iglus, cabanas, bolas de rastreamento e ninhos de material dentro de jaulas dos EE.
    4. Coloque ambos os EE e NE gaiolas em um rack ventilado para fornecer a ventilação igual.
      Nota: Duas gaiolas grandes com 2 plataformas (tabela 1) permitem um máximo de 12 fêmeas grávidas por filhote criação instalação15 (ver Tabela de materiais, passo 3.2 em documento e tabela 2).
    5. Ratos de alimentação ad libitum irradiados chow padrão e água de osmose reversa autoclavados.
    6. Fornece os ratos com materiais de cama estéril.
      Nota: Todas as manipulações de vazias jaulas e gaiolas com animais devem ser feitas no bairro para evitar a contaminação. Para manipulação de gaiola gaiolas grandes, cobrir o buraco na gaiola com uma película adesiva.
  2. Prepare os animais para reprodução. Grupo casa 15 2 - meses de idade fêmeas em uma única gaiola grande (tabela 1) por 2 semanas antes do acasalamento. 2 - meses de idade machos littermate separadamente de casa 2 semanas antes do acasalamento.
    Nota: O número de fêmeas para reprodução é dependente da experiência e o número de animais necessários. Neste estudo, 15 mulheres foram utilizadas para obter 12 fêmeas conectadas, que é o máximo número permitido no filhote criação instalação descrita em 1.1.2 (tabela 2).
  3. Para reprodução, combine animais senhor e represa, 1 macho por 2 fêmeas. O primeiro cheque da manhã deve ser para tampões vaginais, que podem ser um sinal visual que os animais tem acasalado durante a noite.
    Nota: Casa de machos e fêmeas juntas, até que cada fêmea tem ligado. Um plugue vaginal pode ser identificado visualmente, se for externo.
    1. Para detectar os plugues interiorizadas, uma sonda é inserida na abertura vaginal e se o plug vaginal está presente, a sonda não é facilmente inserida (16; Veja a seção 4.3.6).
      Nota: Grave pela manhã que um plug é detectado como ½ dia, desde o acasalamento ocorreu no meio da noite.
    2. Uma vez que as fêmeas têm plugues vaginais, transferi-los para um grande filhote criação gaiola para Alojamento em grupo com outras fêmeas acasaladas (instalação na etapa 1.1.2 sem dispositivos de enriquecimento).
    3. Substitua Unidos fêmeas com novas fêmeas do grupo unmated alojado para acasalamento e continuar acasalamento para obter um número máximo de ninhadas em um período de 7 dias.
      Nota: Todos os animais devem ter uma data de entrega no prazo de 7 dias do outro.
  4. Permitir que as fêmeas grávidas dar à luz no grupo habitação para que todas as ninhadas são geradas dentro de um cachorro grande criação gaiola (instalação na etapa 1.1.2 sem dispositivos de enriquecimento).
    1. Manter o controle de datas de nascimento e números de filhote e começar os filhotes de genotipagem com 7 dias de idade.
      1. Tatuagem filhotes em seus dedos com 7 dias de idade com um código numérico para identificar os13,17.
      2. Limpe o dedo do pé com 70% de etanol e suavemente, inserir um dispositivo microtatuagem que contém tinta na superfície da pele paralela para o dedo do pé17 (ver Tabela de materiais).
      3. Recolha o tecido com tesoura para genotipagem das pontas da cauda de incisão um pequeno pedaço de tecido de 7 - dias velhos neonatos.
    2. Isolar o DNA genômico de tecidos e realizar PCR usando um método convencional de HotSHOT, conforme descrito em 18.
    3. Animais separados por sexo às 14-21 dias em gaiolas grandes com as mães.
      Nota: Certifique-se que os filhotes mais velhos são capazes de se alimentar de suas próprias, e que mais jovens filhotes continuam a enfermeira até a idade suficiente para se alimentar de suas próprias.
    4. De 21 a 28 dias, distribua animais machos e fêmeas separadamente pelo genótipo em ambientes NE ou EE, certificando-se de manter proporções iguais de cada genótipo por gaiola(Figura 2).
      Nota: Certifique-se de que o número total de animais permitidos em cada gaiola NE ou EE baseia-se o número máximo permitido pelo IACUC (tabela 2). As gaiolas NE tem no máximo 5 animais (tabela 2). Em gaiolas EE, a estimulação social, nada menos que 20 e com restrições de espaço, não mais de 41 animais devem ser permitidos na gaiola do EE (tabela 2).

2. fezes coleção com 16 semanas de idade

  1. Iniciar a coleta de fezes 1 a 2 dias antes do sacrifício e separadamente, recolher fezes no dia do sacrifício durante a dissecção usando ferramentas estéril.
    Nota: Coleta de fezes ao mesmo tempo 1-2 dias antes da coleta podem ajudar a evitar a perda de uma amostra devido à possibilidade de que não há fezes está presente no momento da coleta.
    1. Para recolher fezes de animais vivos, cuidadosamente a nuca do animal sobre uma gaiola limpa. Colete fezes usando pinça estéril em um tubo de microcentrífuga estéril.
      Nota: Animais tipicamente vão eliminar fezes quando imobilizados, que permite a coleta de fezes rápida directamente para um tubo de microcentrífuga estéril. Se um animal não defecam imediatamente quando imobilizados, coloque-o em uma gaiola limpa e esperar que o animal defecar (tipicamente até 1 h).
    2. Colete as fezes no dia do sacrifício.
      1. Para a eutanásia do animal, coloca o animal em uma redoma de vidro contendo um pequeno recipiente com uma bola de algodão embebida em isoflurano. Uma vez que a cessação da respiração é observada (geralmente depois de 2 min), colocar o animal em sua parte traseira para permitir a dissecação do cólon.
      2. Aplica o etanol a 70% no abdômen de rato.
      3. Levantar a pele anterior a abertura uretral com fórceps e use uma tesoura para cortar ao longo da linha mediana ventral até atingir a caixa torácica e corte da base da primeira incisão para cada perna. Dobre a pele e use uma tesoura para cortar a parede peritoneal no mesmo padrão.
      4. Use fórceps para apreender o cólon distal no ânus para dissecar e desanexar o cólon distal do reto. Enquanto puxa os dois pontos verticalmente com fórceps, use uma tesoura para cortar o mesentério para liberar o cólon.
      5. Corte logo abaixo do ceco cólon e colocá-lo no papel de filtro. Use a pinça para levantar a parte superior do tubo do cólon, abrindo o lúmen para permitir que um lado da tesoura aberta a ser inserido. Corte longitudinal, aberto de distal para proximal e angulações do cólon longitudinalmente.
      6. Colete fezes do cólon distal em um tubo de microcentrífuga estéril utilizando Pinças esterilizadas.
  2. Armazenar fezes em um tubo de microcentrífuga no-80 ˚ c até o tempo de isolamento de DNA bacteriano.
    Nota: No dia do sacrifício, além de fezes, colete outras amostras como sangue total, soro, plasma, normal e o tecido do tumor de cólon e intestino delgado, microssomas, tecido adiposo, etc. para abordar questões definidas no estudo.

3. genômica DNA isolado do tamborete

Nota: Utilize um kit comercial para isolar o DNA microbiano de fezes seguindo um protocolo de deteção do patógeno de fezes. Remova as amostras diretamente para o congelador ˚ c-80 e loja em gelo seco durante a pesagem.

  1. Até 220 mg de fezes de transferir para um tubo de microcentrífuga limpos contendo 1,4 mL de tampão de lise de fezes de temperatura (RT) (ver Tabela de materiais).
  2. Amostra de vórtice para 1 min homogeneizar completamente sólidos (Figura 2B). Aqueça a suspensão para 95 ˚ c por 5 min lisar todas as bactérias (incluindo bactérias gram-positivas).
  3. Amostras de vórtice durante 15 s e então centrifugar a 20.000 x g por 1 min para os sólidos de fezes de Pelotas. Transferi o sobrenadante para um tubo de microcentrífuga de 2 mL. Adicionar um comprimido para cada amostra a absorver inibidores do PCR, vórtice até que o comprimido é dissolvido e incubar a amostra a RT por 1 min.
  4. Centrifugar a amostra a 20.000 x g por 3 min e transferir o sobrenadante para um novo tubo de microcentrífuga. Centrifugar a 20.000 x g durante 3 min. 15 alíquota μL de proteinase K (20 mg/mL de caldo) em um novo tubo de microcentrífuga de 1,5 mL. Pipetar 200 µ l da amostra para o tubo contendo proteinase K.
  5. Adicionar 200 μL de tampão de lise de cloreto de guanidínio ao tubo, vórtice abundantemente durante 15 s (consulte a Tabela de materiais) e incubar a amostra em 70 ˚ c por 10 min. Adicionar 200 μL de etanol (96-100%) para os tubos e misture bem por num Vortex.
  6. Lugar de sílica com base em coluna de rotação em um tubo de coleta de 2 mL e aplicar as amostras para a coluna. Feche a tampa e centrifugar por 1 min a 20.000 x g.
  7. Transferir a coluna para um novo tubo de coleta de 2 mL e adicionar 500 μL de tampão de lavagem 1 para a coluna, a coluna e centrifugar por 1 min em 20.000 x g. transferência da coluna para um novo tubo de coleta de 2 mL do tampão e adicionar 500 μL de tampão de lavagem 2 à coluna , feche a tampa e centrifugar 20.000 x g por 3 min.
  8. Com a tampa fechada, transferir a coluna para um novo tubo de coleta de 2 mL e centrifugar para um adicional 1 min a 20.000 g x para remover o tampão de lavagem residual. Transferir a coluna para um 1,5 mL rotulado tubo de microcentrífuga e eluir amostra adicionando 200 μL de tampão de eluição contendo EDTA para a membrana (ver Tabela de materiais).
  9. Feche a tampa e incubar a RT por 1 min. centrifugar a amostra por 1 min em 20.000 x g. descartar a coluna.

4. determinação da concentração DNA e preparação da amostra para o PCR

Nota: Utilizar um dados e um ensaio fluorescente dsDNA comercialmente disponíveis para determinar a concentração de DNA genômica em cada amostra (ver Tabela de materiais). O corante fluorescente deve ligar o ADN encalhado dobro especificamente.

  1. Preparar uma diluição de 1: 200 de cada amostra (1 µ l de cada amostra em 199 mistura de mestre dsDNA µ l) e um 01:50 diluição das normas. Analise em um dados usando a configuração de dsDNA.
    Nota: Um alto volume de DNA na PCR pode ser inibitório, portanto, o volume de DNA utilizado não deve ser mais do que 10% do volume final do PCR. Um dados permite uma medição precisa de DNA na amostra, como só DNA ligado para o corante fluorescente será fluorescem, eliminando a possível contribuição de contaminantes para a concentração final de DNA calculado. Este nível de quantificação exata é essencial para a aplicação de sequenciamento a jusante.
  2. Prepare modelos PCR diluídos a 5 ng / µ l com o volume apropriado de 10mm Tris, pH 8,5 existências de modelo de trabalho de cada amostra.
  3. Armazenar as amostras a-20 ° C.

5. projeto Primers para as 16 desejado regiões V

  1. Desenho de primers para amplificar seletivamente regiões desejadas V 16S rRNA.
  2. Analise as primeiras demão com sonda Match, desde o projeto de banco de dados Ribosomal19, para determinar a taxa de acertos aproximada para diversos filos.
    Nota: Para as regiões V1-V3, o estudo atual usado publicou cartilhas Bosshard frente20, que se ligam na posição 8 dentro da região V1 e 533 reversa,21, que vincula-se em posição 533 dentro da região V3. As primeiras demão devem incluir sequências de adaptador saliência para indexação.
  3. Ao projetar primers, inclua sequências de adaptador nas extremidades 5' de cada primer, como recomendado por 16S metagenomics sequenciamento biblioteca preparação22 (tabela 3).
  4. Sintetiza estas primeiras demão grande com purificação de cartucho. Reconstituir as primeiras demão dessecadas e diluir um PCR estoque de 1 μM a trabalhar em 10 mM Tris, pH 8,5.

6. Amplicon PCR para amplificar a região (ões) V com saliência adaptador sequências anexado 22

  1. Configure o amplicon mistura de reação de PCR conforme descrito na tabela 4.
  2. Coloque um adesivo selo de placa PCR claro sobre a chapa e executar o amplicon PCR usando os parâmetros na tabela 5.
  3. (Opcional) Executar o amplicon produtos do PCR em um gel de agarose ou um ensaio de DNA de alta sensibilidade que permite uma medição quantitativa do amplicon tamanho (ver Tabela de materiais).
    Nota: O amplicon tamanho deste estudo é 550 bp(Figura 3).

7. PCR limpeza usando magnético contas 22

  1. Centrifugue a placa do PCR amplicons rapidamente a 1.000 x g, durante 1 min coletar condensação.
    Nota: Tiras de tubo PCR podem ser usadas em vez de placas PCR para minimizar a contaminação. Descartar as tampas de tubo e nunca reutilizar.
  2. Vórtice os grânulos magnéticos uniformemente dispersá-los e adicionar 20 μL de magnético contas para cada amplicon PCR, depois Pipetar todo o volume acima e para baixo lentamente 10 vezes.
  3. Incube a RT por 5 min. lugar a placa do PCR em um carrinho magnético por 2 min até esferas magnéticas são recolhidas e o sobrenadante é claro. Remover e descartar o sobrenadante.
  4. Grânulos de lavagem com 200 μL fresco 80% etanol enquanto a placa do PCR é na magnético ficar e incube por 30 s em RT sobre o suporte magnético. Remova cuidadosamente o sobrenadante.
  5. Repeti a lavagem pela segunda vez. Agora, use uma ponta de pipeta fina para remover qualquer etanol residual dos poços e permitir que o ar de secagem por 10 min.
  6. Retire a placa do PCR do suporte magnético e adicionar 52,5 μL de pH de 10 mM Tris 8.5 a cada poço. Pipetar acima e para baixo 10 vezes para suspender contas e incubar a temperatura ambiente por 2 min.
  7. Transferi a placa do PCR para o suporte magnético para coletar esferas magnéticas e transferir 50 µ l do sobrenadante para um prato limpo de PCR. Coloque um adesivo selo de placa PCR claro sobre a chapa e armazenar a-20 ˚ c por até uma semana.

8. elaboração de um esquema de placa para índice do PCR

Nota: Para gerar uma biblioteca de V1-V3, um segundo PCR foi executada com um índice kit (veja a Tabela de materiais). Um esquema de indexação padrão foi usado para mapear as combinações de índice exclusivo duplo para cada amostra (Figura 3B e 23).

  1. Certifique-se de que cada amostra tem uma combinação única das 2 primeiras demão de índice (ou seja, dupla indexação).

9. Execute índice PCR para anexar os códigos de barras para as sequências de adaptador como descrito 22 .

  1. Transfira 2,5 μL de amplicons PCR (amplicons limpo) para um novo 96 placa bem e coloque em um dispositivo elétrico placa de índice para ajudar na indexação.
  2. Organizar o índice 1 e índice 2 primeiras demão, como no exemplo do gráfico prato preparado (Figura 3B).
    Nota: Pistas visuais são fornecidas para evitar confusões primeira demão: tubos de índice 2 da primeira demão devem ter capuzes brancos e uma solução clara, enquanto tubos de índice 1 da primeira demão devem ter solução amarela e laranja tampões.
  3. Monte o índice de reação de PCR Mix conforme descrito na tabela 6. Misture pipetando acima e para baixo 10 vezes. Cubra com um adesivo selo de placa PCR claro e centrifugar para coletar a x 1.000 g à temperatura ambiente durante 1 min.
  4. Execute o índice do PCR usando os parâmetros na tabela 7.

10. purificar biblioteca Final do PCR

Nota: Este PCR limpar é idêntico ao passo 7 acima e usa grânulos magnéticos para realizar PCR Clean-Up do índice PCR22.

  1. Centrifugue a placa do PCR da etapa 10 rapidamente a 1.000 x g, durante 1 min coletar condensação.
  2. Vórtice os grânulos magnéticos uniformemente dispersá-los, em seguida, adicionar 20 μL de magnético contas para cada amplicon PCR, pipetar então todo o volume subindo e descendo lentamente 10 vezes para misturar.
  3. Incube a RT por 5 min.
  4. Placa de PCR lugar num suporte magnético por 2 min até esferas magnéticas são coletados e sobrenadante é clara. Remover e descartar o sobrenadante.
  5. Grânulos de lavagem com 200 μL fresco 80% etanol enquanto a placa do PCR é na magnético ficar e incube por 30 s na temperatura de quarto no stand magnético. Remova cuidadosamente o sobrenadante.
  6. Repeti a lavagem pela segunda vez.
  7. Após a segunda lavagem, use uma ponta de pipeta fina para remover qualquer etanol residual dos poços e permitir que o ar de secagem por 10 min.
  8. Retire a placa do PCR do suporte magnético e adicionar 52,5 μL de pH de 10 mM Tris 8.5 a cada poço. Pipetar acima e para baixo 10 vezes para suspender contas e incubar a temperatura ambiente por 2 min.
  9. Transferi a placa do PCR para o suporte magnético para coletar esferas magnéticas e transferir 50 µ l do sobrenadante para um prato limpo de PCR. Coloque um adesivo selo de placa PCR claro sobre a chapa e armazenar a-20 ˚ c por até uma semana.
  10. (Opcional) Executar os produtos de PCR de índice em um gel de agarose ou um ensaio de DNA de alta sensibilidade que permite uma medição quantitativa do amplicon tamanho (ver Tabela de materiais).
    Nota: O tamanho da biblioteca indexado final deste estudo foi 668 bp (Figura 3C-D).

11. quantificar, normalizar e piscina as bibliotecas indexadas para sequenciamento

  1. Determinar a concentração de DNA de cada amostra com um dados e um kit de ensaio fluorescente dsDNA (ver tabela de materiais).
    1. Prepare uma diluição de 1: 200 da amostra (1 µ l de cada amostra em 199 µ l dsDNA mestre mix, que inclui o buffer e reagente) para cada uma das amostras indexadas e padrões (190 mistura de mestre dsDNA µ l e 10 µ l do padrão). Analise em um dados usando a configuração de dsDNA.
  2. Após o cálculo da concentração de DNA, normalize as bibliotecas calculando o tamanho médio da biblioteca. Fazer isto somando V amplicon tamanho de primers, comprimentos de índice e comprimentos de adaptador e ver os produtos de gel de agarose para ter a certeza de que o tamanho real é semelhante para o tamanho calculado (consulte aFigura 3C, 22).
    1. Como alternativa, utilize um ensaio de DNA de alta sensibilidade que permite uma medição quantitativa de DNA integridade amplicon tamanho e concentração (tabela de materiais, Figura 3D).
      Nota: Neste estudo, o tamanho médio da biblioteca foi calculado com base na soma de comprimentos de adaptador, comprimentos de índice e tamanho de V1-V3 amplicons de cartilhas. O tamanho médio foi 668 bp.
    2. As concentrações das amostras são normalizadas usando a fórmula no quadro 8.
  3. Diluir as amostras 4 nM e piscina 5 μL de cada amostra 4-nM em um único tubo para sequenciamento.

12. a biblioteca usando um sistema de sequenciamento de próxima geração de sequenciar e analisar os dados

  1. Sequência da biblioteca.
    Nota: Para este estudo, o núcleo de genômica Universidade de Utah, alta taxa de transferência realizada biblioteca desnaturação e sequenciamento de amostra (conforme descrito em 6,,22).
  2. Analisa os dados.
    Nota: Para separar dados de amostras em pool, índice leituras foram identificadas e separadas (conforme descrito em 22).
  3. Gerar arquivos de FASTQ e utilizar isto para análise de dados subsequentes.

13. analisar dados sequenciados da biblioteca de amplicons 16S

Nota: Esta etapa é executada conforme descrito no Bice et al., 20176.

  1. Instalar as ferramentas de análise de dados livremente disponíveis (ver Tabela de materiais; 24).
  2. Junte demultiplexed fastq arquivos de dados sequenciais (conforme descrito em25,,26). Descarte todas as sequências de montagem.
  3. Realize análises seguindo uma de novo aberto taxonômica unidade (OTU) escolher o protocolo (como descrito em 27).
    1. Bin sequências em um arquivo único fastq por sampleID e sequências de grupo com 97% ou maior similaridade em OTUs, conforme descrito em 28. Alinhe sequências representativas do núcleo definido com comprimento de sequência mínima de 150 e 75% por cento identidade29,30. Atribua a taxonomia como descrito28.
      Nota: Amostras podem ser guardadas e analisaram31, seguido por atribuição taxonômica e OTU tabela construção32.
    2. Crie um arquivo de mapeamento que identifica nomes descritivos e características de amostras para vincular a identificação da amostra e validar o arquivo de mapeamento33,34.
    3. Fazer uma rede OTU links OTUs para descrições de amostra usando um arquivo de mapeamento35.
    4. Calcule resumos de taxonomia em termos de abundância relativa por Resumindo táxons através de parcelas de36.
    5. Explore a diversidade alfa de amostras na profundidade de sequenciamento de uniforme adequada para amostras. Para definir a profundidade apropriada para diversidade alfa, resuma contagens totais observadas em cada amostra, usando o comando de resumir-tabela de bioma, conforme descrito em 37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Vários estudos têm demonstrado que a prática da medicina mente-corpo melhora os resultados de saúde. Da mesma forma, em ratos, enriquecimento ambiental melhora os resultados, incluindo a melhoria de vida útil e tumor ferida reparo6. Portanto, um procedimento EE foi desenvolvido com o objectivo de definir o papel da microbiota este fenótipo enquanto primeiro normalizando o microbiome antes do início do experimento (Figura 1). Importante, todos os animais reprodutores são integrados a colônia de rato pelo menos um mês antes do início da reprodução, e os filhotes recém-nascidos são co alojados com as mães em uma gaiola grande para normalizar a microbiota transmissão antes do experimento. Quando os animais são entre 21 e 28 dias de idade, um número igual de cada genótipo é desmamado em sua respectiva habitação, EE ou ambientes NE(Figura 2). Às 16 semanas, fezes de todos os animais são recolhidos e homogeneizado (Figura 2B), seguido pelo isolamento de DNA bacteriano. Finalmente, 16S amplicons são amplificados de fezes microbiome DNA e código de barras indexados para permitir para sequenciamento de todas as bibliotecas microbiome simultaneamente (Figura 3). As sequências únicas identificadas no WT e tumor rolamento animais em condições NE e EE são mostradas na Figura 4. Curiosamente, EE não melhora a biodiversidade em animais WT, mas vastamente aumenta a biodiversidade em animais de rolamento do tumor (Figura 4), demonstrando que este método permite melhorias de biodiversidade. Este aumento da biodiversidade pode ser atribuído para o aumento da presença do filo Proteobacteria, com significativa aumenta nas classes Alphaproteobacteria e proteobactérias beta e diminui em patogenicidade Gammaproteobacteria (Figura 5 ; Suplementar, tabela 1). O maior aumento é na Betaproteobacteria classe é o género de Sutterella, um de seus comensais provavelmente envolvidos na degradação de IgA secretada (Figura 6, também de ver38).

Figure 1
Figura 1 : Uma representação da linha da tempo experimental. As bandas curtas representam janelas de 7 dias, como a maioria do protocolo é realizado em incrementos de 7 dias. Isto também auxilia na visualização da faixa de idade do filhote de cachorro em todo o experimento. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : EE e NE habitação condições e fezes homogenates (conforme descrito no protocolo). Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Preparação de biblioteca Microbiome 16S. (A) impuro PCR amplicons produtos derivados de DNA genômico de fezes. (B) indexação gráfico placa projetado conforme o software utilizado (Tabela de materiais, 23). As combinações do índice dual, I7 (índice 1; Linha) e I5 (índice 2; Coluna), são mostrados para cada amostra. Cada índice é 8 bp em comprimento. A amostra referem-se os números respectivos rato de estudos EE. (C) os produtos de PCR de índice impuro. (D) análise da qualidade da final purificado e pool 16S bibliotecas. (A, C, D) Setas pretas indicam 550 bp amplicon e 668 bp indexado biblioteca. Setas vermelhas indicam produtos não específicos que são eliminados após a purificação, conforme mostrado no D. Superior e inferiores marcadores são marcadores de tamanho adicionados à amostra de referência de tamanho. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4 : Alterações na diversidade alfa seguindo EE de Tcf4Het / + ApcMin / + animais. Diversidade alfa de WT e Tcf4Het / + ApcMin / + tumor animais do rolamento. Em 20.000 leituras, NE e EE de WT, p= 0,64 e NE e EE de Tcf4Het / + ApcMin / +, p= 0,03 usando teste t de duas amostras com correção de Welch. Adaptado do Bice et al., 20176. Clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5 : EE-mediada alterações seguindo EE de Tcf4Het / + ApcMin / + animais. R-ggplot2 gerado parcelas caixa-Suiça, denotando alterações na abundância das classes Alphaproteobacteria proteobactérias beta e filo Proteobacteria e filo Proteobacteria. Outliers são notados por círculos. p= 0,005 usando testes-t de duas amostras com correção de Welch. Barras de erro calculadas usando o erro padrão da média (SEM). Adaptado do Bice et al., 20176. Clique aqui para ver uma versão maior desta figura.

Figure 6
Figura 6 : Alterações na abundância relativa de Sutterella seguindo EE de Tcf4Het / + ApcMin / + animais. Outliers são notados por círculos. p= 0,005 usando teste t de duas amostras com correção de Welch. Barras de erro calculadas usando SEM. adaptado do Bice et al., 20176. Clique aqui para ver uma versão maior desta figura.

Supplemental Table 1
Suplementar tabela 1: classificação de bactérias isoladas de fezes coletadas de ratos NE e EE. Classificação entre genótipos no nível do (A) filo, classe (B), (C) ordem, (D) família e gênero (E). Comparações de NE e EE com o mesmo genótipo ou WT para Tcf4Het / + ApcMin / +. P-valores são calculados usando um teste t de duas amostras com correção de Welch. Adaptado do Bice et al., 20176. Clique aqui para baixar este arquivo.

Item de Área total (polegada2) Área total (cm2) Tamanho da gaiola (polegadas) L x W x H Gaiola de tamanho (cm) L x W x H
Uma controle gaiola (NE) 68,25 440.32 10,5 x 6,5 x 5,5 26.67 x 16,51 x 13,97
Uma grande gaiola (EE) 264.36 1706.32 13.87 x 19.06 x 7,75 35.24 x 48.42 x 19.69
Duas gaiolas grandes (EE) 528.72 3412.64 2 @ 13.87 x 19.06 x 7,75 2 @ 35.24 x 48.42 x 19.69
Duas plataformas (EE) 93 600 2 @ 11,8 x 3.94 x 2.95 2 @ 30 x 10 x 7.5
Duas gaiolas grandes com duas plataformas (EE) 621.72 4013 2 @ 13.87 19.06 x 7,75 + X2 @ 11,8 x 3.94 x 2.95 2 @ 35.24 48.42 x 19.69 + X2 @ 30 x 10 x 7.5

Tabela 1: Tamanhos EE e NE gaiola e espaço.

Animais permitidos em gaiola Necessárias polegadas ao quadrado por Animal EE área de gaiola (polegadas2) Animais totais permitidos
Até 25 12 622 em2 (4013 cm2) até 25
25 + 15 622 em2 (4013 cm2) até 41
Fêmea com ninhada 51 622 em2 (4013 cm2) até 12

Tabela 2: permitidos números de animais em gaiolas com base no espaço 15 .

Amplicon PCR Primers
Para a frente 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3 '
Inverter 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 '
Locus específico de sequências são mostradas em negrito e os não-bold (realce) é a sequência de adaptador de saliência.

Tabela 3: Amplicon PCR Primers.

Reação de PCR Amplicon configurar
Volume de
DNA microbiano (5ng/μl) 2,5 μl
Encaminhar o Primer (1 μM; de passo 5.1.2) Μl 5.0
Reverter o Primer (1 μM; de passo 5.1.2) Μl 5.0
2 x HotStart Ready Mix 12,5 μl
Total 25,0 μl

Tabela 4: Amplicon PCR Mix.

Configurar o Amplicon PCR
95 ° C por 3 minutos
25 ciclos de:
95 ° C por 30 segundos
55 ° C por 30 segundos
72 ° C por 60 segundos
72 ° C por 3 minutos
Manter a 4 ° C

Tabela 5: Configurar o programa Amplicon PCR.

Assembly de código de barras do PCR do índice
DNA 2,5 μl
Primer de índice 1 (N7XX) 2,5 μl
Primer de índice 2 (S5XX) 2,5 μl
2 x HotStart Ready Mix 12,5 μl
Água de grau PCR 5 μl
Total 25 μl

Tabela 6: índice PCR Mix.

Índice do PCR Setup
95 ° C por 3 minutos
8 ciclos de:
95 ° C por 30 segundos
55 ° C por 30 segundos
72 ° C por 30 segundos
72 ° C por 5 minutos
Manter a 4 ° C
Loja a-20 ° C

Tabela 7: programa PCR índice definido de cima

Fórmula de concentração de amostra para o pool
(Concentração de DNA em ng/μl) x 106 = concentração em nM
(660 g/mol x tamanho da biblioteca média)
Um exemplo deste estudo é:
(85.2 ng/μl) x 10 ^ 6 = 193,3 nM
(660 g / mol x 668 bp)

Tabela 8: fórmula para normalizar antes pool de amostras

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Este procedimento permite a análise da microbiota isolado de fezes de enriquecimento ambiental de normal ou tumor rolamento animais a seguir. Porque estas são as grandes experiências que envolvem a reprodução para obter muitos animais de sexos diferentes e de genótipos, normalizar o microbiome entre animais antes do início do experimento é essencial evitar a não-EE relacionados com efeitos na microbiome biodiversidade.

Para consistência entre condições NE e EE, o processo de criação é realizado para garantir que todos os mouses inicialmente tem exposição para os mesmos micróbios e, portanto, deverão ter o conteúdo de microbiome semelhante. É possível e provável, o genótipo do rato afeta microbiome composição. Por esta razão, rato números por genótipo são mantidos entre NE e EE condições de ter a certeza de que qualquer animal que está consumindo fezes encontrará uma diversidade semelhante da microbiome.

Diversas dificuldades são aparentes quando projetar EE experimentos. Primeiro, o número total de animais necessários para as experiências depende dos detalhes experimentais, mas também, o número total é limitado pelo número de animais permitido na gaiola. Por exemplo, a sobrevivência de rato circundante dados históricos de uma experiência preliminar de EE foram usados para calcular o número de animais para definir a sobrevivência melhorada mecanismo subjacente observada em experiências anteriores. Estes dados, um total de 17 animais no grupo de comparação foram necessários para um poder de 80% para detectar uma diferença na sobrevivência em um t-teste dos dois lados, onde alfa = 0,05. Então, 4-5 animais no grupo controle, vs. 20-24 (ou até 41) animais por gaiola no grupo experimental devem acomodar um cálculo de potência. Portanto, várias gaiolas de grupo controle são necessários junto com a gaiola experimental. Além disso, com genótipos complexos, é difícil obter suficiente número de animais de cada genótipo, que necessita de um grande número de fêmeas reprodutoras exigidos. No entanto, com outros modelos onde menos diferenças transgénicas estão presentes, mais animais com o mesmo genótipo podem ser analisados neste sistema e criadores menos são necessários. Nos Estados Unidos, 12 fêmeas grávidas podem ser alojadas o 633 em2 de espaço (tabela 2). O problema com isto é que como filhotes envelhecem, elas ocupam mais espaço. Dado que os filhotes machos são separadas de filhotes fêmeas em 14 a 21 dias, uma exceção aprovada para a regra de espaço em certos países pode ser viável. Caso contrário, filhotes machos e fêmeas podem ser genótipo selecionado e então separados em uma idade mais jovem com mães de permanecer abaixo os números máximos de rato. É essencial para obter a aprovação para estes estudos e aderir aos regulamentos locais sobre as restrições de espaço. Finalmente, com a microbiota, o número de animais necessários para detectar até mesmo pequenas diferenças na composição da microbiota é difícil calcular a priori. Enquanto no presente estudo, foram encontradas diferenças significativas na microbiota com 4 animais por grupo, que se é possível que aumentar o número de animais revelaria a microbiota que são mais variável entre ratos EE ou são apenas ligeiramente alterada por EE.

Este artigo método descreve o particular equipamentos e fundamento que são utilizados, que na superfície podem não aparecer essencial. No entanto, várias questões não-óbvio que afetam a consistência podem ser encontrados e precisam ser resolvidos antes de embarcar nestes muito grandes, caros e demorados estudos. Uma questão importante é a ventilação de gaiola. Com um grande número de animais em uma gaiola, ventilação se torna um problema e é um problema que a maioria dos pesquisadores não leva em conta ao tentar fornecer ambientes consistentes entre controle e gaiolas experimentais. Todas as gaiolas na configuração do descrito são colocadas em um gabinete ventilado para equalizar a ventilação através do experimental e controlar as gaiolas. Isso não pode ser realizado quando usando gaiolas que fazem não se encaixam em um gabinete ventilado. Outros meios para normalizar a ventilação entre experimental e controlar animais poderiam ser testados e aplicados de forma consistente, mas estes métodos não são explorados neste estudo. Problemas de consistência semelhantes surgem com roupa de cama. No cólon câncer modelo sistema utilizado neste estudo, os animais que têm doença digestiva vão ingerir certos tipos de roupa de cama, especialmente espiga de milho do fundamento, levando a bloqueios digestivos e doença. É importante ter isto em mente, se os animais são conhecidos por ingerir fundamento quando não ocupado com outras coisas, como o ambiente de controle. Este fenómeno e os efeitos subsequentes saúde inconsistente afetará profundamente todos os dados.

O gene ribosomal 16S tem sido usado como um meio para estudar as populações bacterianas. Ele contém nove regiões que expressam as regiões conservadas intercaladas que permanecem relativamente inalteradas entre espécies bacterianas39, V1-V9 e variabilidade genética. A região de V1-V3, em particular, fornece a maior probabilidade de identificação de espécies-nível39. V1-V3 similar estudos sobre câncer colorretal (CRC) e Adenoma colorretal avançada encontrou alterações em três filos de interesse: Proteobacteria, Firmicutes e Bacteroidetes21,40,41. Também relatou-se que o exercício pode deslocar a população microbiana e levar a um aumento de Firmicutes42. Por este motivo, este estudo identificou microbiome populações usando primeiras demão de V1-V3 seguindo um 16S metagenomic biblioteca prep protocolo22 potencialmente definir os efeitos do enriquecimento ambiental sobre esses filos conhecidos para ser alterado em adenoma e CRC. Este procedimento pode ser modificado para amplificar e outras regiões variáveis dos genes 16S rRNA de sequências. Uma maneira é usar sonda Match para entender a classificação filogenética da microbiota presente na amostra que será identificada pela sonda. Desta forma, sondas podem ser direcionadas para definir especificamente e filogeneticamente classificar micróbios de interesse. Isto permite uma caracterização diferente da microbiota presente nas amostras de fezes e pode revelar alterações de EE-dependentes adicionais na microbiome do tumor rolamento ratos que podem afetar a progressão da doença.

Usando este procedimento, o género Sutterella foi identificado como o género mais alterado seguindo EE de tumor animais do rolamento. Este procedimento pode ser adaptado para acomodar os estudos que utilizam qualquer método destinado a analisar os efeitos de uma perturbação na composição de microbiome geneticamente modificados modelos de doenças humanas. Por exemplo, no lugar de EE, ratos poderiam ser inoculados com Sutterella para definir se a inoculação Sutterella é suficiente para aumentar a biodiversidade microbiana e ferida reparo no tumor masculino 16 semanas de idade, tendo os animais.

Sem dúvida, o aspecto mais original do presente protocolo é a preocupação sobre microbiota antes EE a normalização e manutenção microbiome diversidade ao longo dos estudos EE. Desde estudos de microbiome estão melhorando continuamente, é provável que métodos mais robustos para caracterizar a microbiome surgirá, e a caracterização de microbiome neste protocolo se tornará obsoleta. Por exemplo, com o estudo, as sondas utilizadas para amplificar o 16S rRNA tem preconceito, dependendo as sondas que são escolhidos e não todas as bactérias presentes na microbiome caracterizam. Enquanto os métodos usados para levantamento e caracterizar a microbiome irão melhorar, sem dúvida, a base da concepção e execução EE experiências enquanto mantendo a normalização da microbiome na mente permanecerá uma faceta essencial das experiências EE.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores declaram que têm não há conflitos de interesse.

Acknowledgements

Agradecemos B. Dalley no núcleo genómica da Universidade de Utah para sequenciamento de biblioteca e K. Boucher no núcleo para conselhos de estatístico e acesso a estes núcleos técnicos suportado pelo prêmio do National Cancer Institute P30 CA042014 Bioestatística da Universidade de Utah. O projeto descrito foi apoiado pelo National câncer Institute subsídios P01 CA073992 e K01 CA128891 e o Huntsman Cancer Foundation.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics