Un método para definir los efectos del enriquecimiento ambiental sobre la biodiversidad de microbioma de Colon en un modelo de Tumor de Colon murino

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Enriquecimiento ambiental (EE) es un entorno de alojamiento de los animales que se utiliza para revelar los mecanismos que subyacen a las conexiones entre el estilo de vida, estrés y enfermedad. Este protocolo describe un procedimiento que utiliza un modelo de ratón de tumorigenesis colon y EE definir específicamente alteraciones en la biodiversidad de la microbiota que puede afectar la mortalidad de animales.

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Varios estudios recientes han demostrado los efectos beneficiosos de vivir en un ambiente enriquecido en la mejora de la enfermedad humana. En ratones, enriquecimiento ambiental (EE) reduce tumorigenesis activando el sistema inmune del ratón, o afecta a la supervivencia animal de cojinete de tumor mediante la estimulación de la respuesta de reparación de herida, incluyendo diversidad mejorada del microbioma en el microambiente del tumor. Aquí es un procedimiento detallado para evaluar los efectos del enriquecimiento ambiental sobre la biodiversidad del microbioma en un modelo de tumor de colon murino. Precauciones con respecto a la cría de animales y consideraciones para la integración de Colonia animal genotipo y ratón se describen, que en última instancia afectan biodiversidad microbiana. Teniendo en cuenta estas precauciones puede permitir la transmisión de microbioma uniforme más y por lo tanto aliviará los efectos del no tratamiento dependiente que pueden confundir los resultados del estudio. Además, en este procedimiento, cambios de la microbiota se caracterizan mediante secuenciación de ADNr 16S del ADN aislado de heces recogidas del colon distal tras enriquecimiento ambiental a largo plazo. Desequilibrio de microbiota intestinal se asocia con la patogenia de la inflamatoria intestinal enfermedad y cáncer de colon, sino también de obesidad y diabetes entre otros. Lo importante, este protocolo para el análisis de EE y microbioma puede ser utilizado para estudiar el papel de la patogenesia de microbioma a través de una variedad de enfermedades donde existen modelos de ratón robusto que puede recapitular la enfermedad humana.

Introduction

Estudios de enriquecimiento ambiental (EE) utilizan parámetros complejos de vivienda para afectar la estimulación social (viviendas grandes jaulas, grandes grupos de animales), estimulación cognitiva (chozas, túneles, materiales de anidación, plataformas) y actividad física (correr ruedas). EE se ha utilizado por muchos laboratorios para entender los efectos del aumento de la actividad y mejora las interacciones sociales y cognitivas en el inicio de la enfermedad y la progresión usando una amplia gama de modelos de ratón, incluyendo alopecia inducida por barbería, enfermedad de Alzheimer, El síndrome de Rett y enfermedad tumoral y digestivo varios modelos1,2,3,4,5,6.

Se han desarrollado varios modelos de ratón para estudiar tumorigenesis de colon en ratones. Quizás el modelo más bien definido es el ratón de ApcMin . El ratón de ApcMin fue desarrollado en el laboratorio de William Paloma en 19907y se ha utilizado como un modelo de ratón de mutaciones en el gen APC que están comúnmente asociados con cáncer colorrectal humano. A diferencia de los seres humanos que las mutaciones APC , ApcMin ratones desarrollan principalmente pequeños tumores intestinales, con muy rara ocurrencia de tumores de colon. Sin embargo, un alelo Tcf4Het con una sola mutación heterozigótica de nocaut knockin en Tcf4, enormemente aumenta tumorigenesis de colon cuando se combina con el alelo ApcMin del8. Recientemente, este modelo de ratón de tumorigenesis de colon se ha utilizado para determinar los efectos de la EA en la tumorigénesis de colon6. En el Bice et al. estudio, los efectos fisiológicos y fenotípicos de la EA en machos y hembras de cuatro líneas de ratón diferente (wild-type (WT), Tcf4Het / + Apc+ / +, Tcf4+ + ApcMin / +, y Tcf4 Het / + APCMin / +)) se definieron. Quizás el hallazgo más interesante fue que EE aumenta significativamente la vida de hombres y mujeres animales de con tumores de colon. Esto demostró que la EE puede reducir por lo menos algunos de los síntomas asociados con la tumorigénesis de colon y mejorar la salud animal. Notable, esta vida útil mejorada en varones no es consecuencia directa de la tumorigénesis reducida y en su lugar estaba ligado a la iniciación de una respuesta, incluyendo mejorado microbioma biodiversidad6de cicatrización tumor.

Se han publicado varios estudios específicos de EE con resultados interesantes. Sin embargo, desde un punto de vista técnico, resultados importantes a menudo no son traducibles a otros laboratorios. Mantener idénticas metodologías EE entre distintos laboratorios es un tema muy complejo, no sólo por dispositivos de enriquecimiento y vivienda usada, pero también ropa de cama, alimentos, ventilación, cría, genética, actividad en la sala y Protocolo de animales requisitos, entre otros9,10,11. Un ejemplo es la integración animal, donde los animales deben estar estable integrados en la colonia de ratón, por lo tanto normalizar la composición genética del fondo y la dieta, para evitar efectos relacionados no tratamiento. Además, muchos estudios EE se han completado antes de la realización de la importancia de la microbioma en enfermedad y la forma en que las prácticas de cría de ratón comunes pueden afectar la composición del microbioma intestinal10,12.

Colocación de estrategia y animales de cría en EE puede aumentar el estrés si no se realiza correctamente. Desde estudios EE utilizan gran número de animales machos y hembras y varios genotipos, montaje experimental puede ser difícil dado el requisito para los animales de varias camadas para combinarse. Por lo tanto, una cría y destete estrategia fue desarrollado para permitir la combinación de animales destetados del genotipo correcto de diferentes camadas. La razón primaria de esto era normalizar la microbiota entre camadas y a reducir el estrés cuando los animales fueron trasladados al ambiente experimental. El microbioma se transmitió desde la presa10. Diversidad microbiana a la Colonia, las hembras fueron compradas en laboratorios Jackson e integradas en la colonia durante un mes antes de que la experimento comenzó9,10,12. Normalizar más biodiversidad de microbioma entre animales, las hembras fueron alojadas conjuntamente antes de la cría. Después de cría, viviendas comunales durante la crianza y la capacidad para escapar de cachorros de enfermería mejoraron los niveles de estrés de la atención materna13,14, posiblemente favorecer la normalización del microbioma. Para evitar que EE no relacionadas con efectos sobre el microbioma, esta casa común de todos los animales experimentales prevenir estrés adicional y luchando que se produjo cuando la combinación de varios machos de diferentes camadas en una jaula experimental. Finalmente, se incluyeron números iguales de animales de todos los genotipos en las jaulas. Esto proporcionó la oportunidad para la biodiversidad de la microbiota mejorada a través de genotipos y quitado la contribución de coprofagia (tendencia del animal a consumir heces) o posibles diferencias conductuales específicas de genotipo al estudio general.

Este protocolo proporciona una estrategia que amplía estudios previos de EE para incluir aspectos conocidos de la investigación microbioma, incluyendo integración de microbiota animal y transmisión de Colonia para la normalización de la microbiota, para permitir a más poblaciones de microbioma uniforme entre los animales de experimentación. Teniendo en cuenta estas precauciones es esencial debido a la capacidad de tratamiento no relacionados con microbiota diferencias para confundir los resultados del estudio. Eliminación de EE no relacionadas con cambios microbiota permitirá a los investigadores definir específicamente el papel de la EA en la composición de la microbiota durante el desarrollo de la enfermedad y la progresión.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos los métodos aquí descritos fueron realizados según protocolos aprobados por el cuidado institucional del Animal y el Comité uso (IACUC) en la Universidad de Utah.

1. diseño y EE y Control configuración de jaula

Nota: Para referencia, se ilustra un esquema del diseño experimental (figura 1).

  1. Configurar control (NE) y jaulas EE (figura 2).
    1. Para configurar NE jaulas, use jaulas de la autoclave control convencional (tabla 1) que carecen de dispositivos de enriquecimiento.
    2. Para jaulas grandes, perfore un agujero de cada jaula lo suficientemente grande para acomodar un ojal y túnel (Tabla de materiales).
    3. Para configurar cachorro cría y jaulas EE, conectar dos jaulas grandes para autoclave con un túnel seguro ojal esterilizada y 2 plataformas esterilizadas para aumentar el espacio (tabla 1). Por experimentos EE, proporcionan funcionamiento ruedas, túneles, iglús, chozas, bolas de arrastre esterilizada y jerarquización material dentro de las jaulas EE.
    4. Colocar jaulas EE y NE en un estante ventilado para proporcionar ventilación igual.
      Nota: Dos grandes jaulas con 2 plataformas (tabla 1) permiten un máximo de 12 mujeres embarazadas por cachorro cría configuración15 (ver Tabla de materias, paso 3.2 en el documento y tabla 2).
    5. Ratones de alimentación ad libitum había irradiado chow estándar y agua de ósmosis inversa en autoclave.
    6. Proporcionar ratones con material estéril de la cama.
      Nota: Todas las manipulaciones de jaulas vacías y jaulas con animales deben realizarse en la campana para evitar la contaminación. Para la manipulación de la jaula de jaulas grandes, cubrir el agujero en la jaula con una película adhesiva.
  2. Preparar los animales para la cría. Grupo de hembras 2 meses de edad 15 de la casa en una sola jaula grande (tabla 1) durante 2 semanas antes del apareamiento. Por separado de la casa 2 meses de edad machos littermate durante 2 semanas antes del apareamiento.
    Nota: El número de hembras para la cría es dependiente en el experimento y el número de animales requerido. En este estudio, se utilizaron 15 hembras para obtener 12 hembras tapadas, que es la máxima cantidad permitida en el cachorro cría de configuración descrito en 1.1.2 (tabla 2).
  3. Para la cría, combinar animales padre y presa, 1 macho por 2 hembras. El primer cheque por la mañana debe ser tapones vaginales, que pueden ser un signo visual que los animales han acoplado durante la noche.
    Nota: Casa machos y hembras juntas hasta que cada mujer ha metido. Un tapón vaginal se puede identificar visualmente, si es externo.
    1. Para detectar tapones internalizados, se inserta una sonda en la abertura vaginal y si el enchufe vaginal está presente, la sonda no se inserta fácilmente (16; vea la sección 4.3.6).
      Nota: Grabar la mañana que un enchufe se detecta como 1/2 día, ya que el acoplamiento se produjo en la noche.
    2. Una vez que las hembras tienen tapones vaginales, transferirlos a un cachorro grande cría en jaula para alojamiento en grupo con otras hembras fecundadas (configuración en el paso 1.1.2 sin dispositivos de enriquecimiento).
    3. Reemplazar aparearon hembras con nuevo fecundada ubicado las hembras para el apareamiento y continuar apareamiento para obtener un número máximo de camadas en un período de 7 días.
      Nota: Todos los animales deben tener una fecha de entrega dentro de 7 días entre sí.
  4. Permitir que las hembras embarazadas dan a luz en grupo de viviendas que camadas todos son criados dentro de un gran cachorro cría de jaula (configuración en el paso 1.1.2 sin dispositivos de enriquecimiento).
    1. Seguimiento de fechas de nacimiento y número de crías y comenzar a cachorros de genotipado a los 7 días de edad.
      1. Tatuaje de cachorros en estado de alerta a los 7 días de edad con un número de código para identificarlas13,17.
      2. Limpiar el dedo con etanol al 70% y suavemente inserte un dispositivo de micro-tatuaje con tinta en la superficie cutánea paralela a la del dedo del pie17 (véase Tabla de materiales).
      3. Recoger tejido con tijeras para genotipificación de las puntas de la cola mediante la incisión de un pedazo pequeño de tejido de recién nacidos de 7 días - la vieja.
    2. Aislar ADN genómico de tejidos y realizar PCR utilizando un método convencional de HotSHOT como se describe en 18.
    3. Animales separados por sexo a los 14-21 días en jaulas grandes con las madres.
      Nota: Asegurar que las crías mayores son capaces de alimentarse de sus propios, y que los cachorros más jóvenes continúan enfermera hasta edad suficiente para alimentar sus propios.
    4. A los 21-28 días, distribuir animales masculinos y femeninos por separado por genotipo en entornos NE o EE, asegurándose de mantener proporciones iguales de cada genotipo por jaula (figura 2A).
      Nota: Asegúrese de que el número total de animales en cada jaula NE o EE se basa en el número máximo permitido por la IACUC (tabla 2). Las jaulas NE tienen a más de 5 animales (tabla 2). En jaulas EE, para la estimulación social, no menos de 20 y con las limitaciones de espacio, se deben permitir no más de 41 animales en la jaula EE (tabla 2).

2. la muestra colección en 16 semanas de edad

  1. Comenzar colección de heces 1 a 2 días previos al sacrificio y recoger por separado taburete en el día del sacrificio durante la disección con instrumentos estériles.
    Nota: Taburete que recoge al mismo tiempo 1-2 días antes de la recogida puede ayudar a evitar la pérdida de muestra debido a la posibilidad que ningún taburete está presente en el momento de la recogida.
    1. Para recoger heces de animales vivos, cuidadosamente scruff el animal en una jaula limpia. Recoger heces utilizando pinzas estériles en un tubo de microcentrífuga estéril.
      Nota: Los animales normalmente eliminará heces cuando inmovilizado, lo que permite el rápido taburete colección directamente en un tubo de microcentrífuga estéril. Si un animal no defecar inmediatamente cuando inmovilizado, lo coloca en una jaula limpia y espere a que el animal defeque (típicamente hasta 1 h).
    2. Recoger heces en el día del sacrificio.
      1. Para euthanizing el animal, colocar al animal en una campana de cristal que contiene un recipiente pequeño con una bola de algodón empapada en isoflurano. Una vez que cese de respiración se observa (generalmente después de 2 min), pone al animal sobre su parte posterior para permitir la disección del colon.
      2. Aplicar etanol al 70% para el abdomen de ratón.
      3. Levantar la piel anterior a la apertura uretral con pinzas, use tijeras para cortar a lo largo de la línea media ventral hasta llegar a la caja torácica y cortar desde la base de la primera incisión hacia cada pierna. Pliegue de la piel y utilice tijeras para cortar a través de la pared peritoneal en el mismo patrón.
      4. Utilice pinzas para agarrar el colon distal en el ano a disecar y separar el colon distal del recto. Mientras tira verticalmente del colon con pinzas, use tijeras para cortar a través del mesenterio para liberar el colon.
      5. Cortar el colon justo por debajo del ciego y colocar sobre papel de filtro. Utilice pinzas para levantar la tapa del tubo de colon, abriendo el lumen para permitir que un lado de tijeras abiertas para ser insertado. Cortado longitudinalmente, distal a proximal y abocinado abierto los dos puntos a lo largo.
      6. Recoger heces desde el colon distal en un tubo de microcentrífuga estéril utilizando pinzas estériles.
  2. Almacenar heces en un tubo de microcentrífuga a-80 ° c hasta el momento de aislamiento de ADN bacteriano.
    Nota: En el día del sacrificio, además de las heces, recoger otras muestras tales como sangre entera, suero, plasma, normal y el tejido del tumor de colon y el intestino, microsomas, tejido adiposo, etcetera. a preguntas de dirección definida en el estudio.

3. genómica ADN aislado de heces

Nota: Utilizar un kit comercial para aislar ADN microbiano de taburete siguiendo un protocolo de detección de patógenos de heces. Extraer muestras para el congelador de ° c-80 y tienda en hielo seco mientras se pesa.

  1. Transferencia de hasta 220 mg de materia fecal en un tubo de microcentrífuga limpio 1,4 ml de tampón de lisis de taburete de temperatura (RT) (véase Tabla de materiales).
  2. Muestra de Vortex por 1 min a homogeneizar completamente sólidos (figura 2B). Calentar la suspensión a 95 ° c por 5 min a Lisan las bacterias (incluyendo bacterias Gram-positivas).
  3. Muestras de Vortex durante 15 s y luego centrifugar a 20.000 x g durante 1 min para que sedimenten los sólidos de materia fecal. Transferir el sobrenadante a un tubo de microcentrífuga de 2 mL. Añadir una tableta a cada muestra para absorber los inhibidores de la PCR, vórtice, hasta que se disuelva la tableta e incubar la muestra a temperatura ambiente durante 1 minuto.
  4. Centrifugar la muestra a 20.000 x g durante 3 min y transferir el sobrenadante a un tubo nuevo de microcentrífuga. Centrifugue a 20.000 x g durante 3 min alícuota 15 μL de proteinasa K (stock de 20 mg/mL) en un nuevo tubo de microcentrífuga de 1,5 mL. Pipetear 200 μL de la muestra en el tubo que contiene proteinasa K.
  5. Añadir 200 μL de tampón de lisis cloruro de guanidinio al tubo, vortex durante 15 s (véase Tabla de materiales) e incubar la muestra a 70 ° c por 10 minutos añadir 200 μL de etanol (96-100%) de los tubos y mezclar bien todo con un vórtex.
  6. Una silicona base columna spin en un tubo de recogida de 2 mL y las muestras se aplican a la columna. Cierre la tapa y centrifugar durante 1 minuto a 20.000 x g.
  7. Transfiera la columna a un nuevo tubo de recogida de 2 mL y agregar 500 μL de tampón de lavado 1 a la columna, la tapa de la columna y centrifugue durante 1 min a 20.000 x g. traslado de la columna a un nuevo tubo de recogida de 2 mL y agregar 500 μL de tampón de lavado 2 a la columna , cierre la tapa y centrifugar a 20.000 x g durante 3 minutos.
  8. Con la tapa cerrada, la columna de la transferencia a un nuevo tubo de recogida de 2 mL y centrifugar durante un 1 minuto adicional a 20.000 x g para quitar el tampón de lavado residual. Transfiera la columna a un 1.5 mL etiquetado tubo de microcentrífuga y eluir la muestra mediante la adición de 200 μL de tampón de elución que contiene EDTA a la membrana (véase Tabla de materiales).
  9. Cierre la tapa e incubar a temperatura ambiente durante 1 minuto centrifugar la muestra durante 1 min a 20.000 x g. descarte la columna.

4. DNA concentración determinación y preparación de muestras para PCR

Nota: Utilizar un fluorómetro y un ensayo fluorescente dsDNA comercialmente disponibles para determinar la concentración de ADN genómica de cada muestra (véase Tabla de materiales). El tinte fluorescente específicamente debe atar la DNA trenzada doble.

  1. Preparar una dilución 1: 200 de cada muestra (1 μl de cada muestra en 199 μl dsDNA mezclar principal) y un 1:50 dilución de estándares. Analizar en un fluorómetro usando el ajuste de dsDNA.
    Nota: Un alto volumen de ADN en la polimerización en cadena puede ser inhibitorio, por lo tanto, el volumen de ADN utilizado debe no ser más del 10% del volumen final de la PCR. Un fluorómetro permite una medición precisa de la DNA en la muestra, como sólo ADN al tinte fluorescente se fluorescencia, eliminando la posible contribución de contaminantes a la concentración final de ADN calculada. Este nivel de cuantificación precisa es esencial para la aplicación de la secuencia descendente.
  2. Preparar plantillas PCR diluidas a 5 ng/μL con el volumen adecuado de 10 mM Tris, pH 8.5 para hacer acciones de plantilla de trabajo de cada muestra.
  3. Almacenar las muestras a-20 ° C.

5. diseño de cebadores para el 16S deseada V regiones

  1. Diseño de cebadores para amplificar selectivamente las regiones de ARNr de 16S V deseadas.
  2. Analizar cartillas con sonda, del proyecto de base de datos Ribosomal19, para determinar la tasa de éxitosa aproximada para varios phyla.
    Nota: Para las regiones V1-V3, el presente estudio utilizado publicado cartillas Bosshard delantero20, que se unen en la posición 8 dentro de la región V1 y 533 reversa21, que se une en posición 533 dentro de la región V3. Primers deben incluir secuencias de proyección Adaptador para la indexación.
  3. Diseño de cartillas, incluyen adaptador secuencias en los extremos 5' de cada primer, como se recomienda para 16S metagenómica secuencia biblioteca elaboración22 (cuadro 3).
  4. Sintetizar estos grandes iniciadores con purificación de cartucho. Reconstituir cartillas desecados y diluir una PCR trabajando acciones a 1 μM a 10 mM Tris, pH 8.5.

6. Amplicon de PCR para amplificar las regiones V con alero adaptador secuencias Unido 22

  1. Configurar el amplicon de mezcla de reacción de PCR como se describe en la tabla 4.
  2. Colocar un sello claro adhesivo de la placa PCR en el plato y ejecute el amplicon PCR utilizando los parámetros en la tabla 5.
  3. (Opcional) Ejecutar productos productos de la PCR en un gel de agarosa o un análisis de ADN de alta sensibilidad que permite la medición cuantitativa del tamaño de amplicón (véase Tabla de materiales).
    Nota: El tamaño del amplicón de este estudio es 550 bp (figura 3A).

7. PCR limpieza usando magnético de perlas 22

  1. Centrifugar la placa PCR amplicon rápidamente a 1.000 x g durante 1 minuto recoger la condensación.
    Nota: Tiras de tubo PCR pueden utilizarse en lugar de placas PCR para minimizar la contaminación. Deseche las tapas del tubo y nunca vuelva a usar.
  2. Vórtice de granos de los granos magnéticos uniformemente dispersarlos, y añadir 20 μL de magnético a cada amplicon PCR, luego pipetear el volumen entero hacia arriba y hacia abajo lentamente 10 veces.
  3. Incubar a RT por 5 min lugar la placa PCR en un soporte magnético por 2 min hasta que los granos magnéticos se recogen y el sobrenadante es claro. Retire y descarte el sobrenadante.
  4. Bolas de lavado con 200 μL fresca 80% etanol mientras que la placa PCR está en el magnético soporte e incube durante 30 s en RT en el soporte magnético. Retire con cuidado el sobrenadante.
  5. Repetir el lavado por segunda vez. Ahora, usar una pipeta fina para quitar cualquier etanol residual de los pocillos y permitir que el aire de secado durante 10 minutos.
  6. Retire la placa de la polimerización en cadena del soporte magnético y añadir 52.5 μL de 10 mM de Tris de pH 8.5 a cada pocillo. Pipeta para arriba y abajo 10 veces suspender cuentas e incubar a temperatura ambiente durante 2 minutos.
  7. Transferencia de la placa de la polimerización en cadena en el soporte magnético para recoger bolas magnéticas y transferir 50 μL del sobrenadante a una placa PCR limpia. Coloque un sello claro adhesivo de la placa PCR en la placa y conservarlo a-20 ° c hasta una semana.

8. elaboración de un esquema de la placa para el índice de PCR

Nota: Para generar una biblioteca de V1-V3, una segunda PCR se realizó con un índice del kit (véase Tabla de materiales). Un esquema de indexación de predeterminado se utilizó para asignar combinaciones de índice dual único para cada muestra (figura 3B y 23).

  1. Asegúrese de que cada muestra tiene una combinación única de 2 cartillas de índice (es decir, doble indexación).

9. realizar el índice de PCR para fijar códigos de barras a las secuencias de adaptador como descrito 22 .

  1. Transferir 2.5 μL de amplicones de PCR (amplicones limpio) a un lugar en un accesorio de la placa índice para ayudar en la indexación y nueva placa bien 96.
  2. Organizar el índice 1 e índice 2 cartillas como en el ejemplo del gráfico de plato preparado (figura 3B).
    Nota: Señales visuales se proporcionan para evitar confusiones de cartilla: tubos de primer índice 2 deben tener gorras blancas y clara solución, mientras que tubos de primer Índice 1 deben tener tapas de naranja y amarillo solución.
  3. Montar el índice de reacción de la mezcla de PCR como se describe en la tabla 6. Mezclar mediante pipeteo arriba y abajo 10 veces. Cubra con un sello claro adhesivo de la placa PCR y centrifugue para recoger a 1.000 x g a temperatura ambiente durante 1 minuto.
  4. Ejecute el índice de PCR utilizando los parámetros en la Tabla 7.

10. purificar PCR Final biblioteca

Nota: Esta PCR limpieza es idéntico al paso 7 arriba y usa bolas magnéticas para realizar PCR Clean-Up del índice de PCR22.

  1. Centrifugar la placa de la polimerización en cadena del paso 10 rápidamente a 1.000 x g durante 1 minuto recoger la condensación.
  2. Vórtice de granos de los granos magnéticos uniformemente dispersarlos, luego añadir 20 μL de magnético a cada amplicon PCR, luego pipetear todo el volumen arriba y abajo lentamente 10 veces para mezclar.
  3. Incubar a temperatura ambiente durante 5 minutos.
  4. Placa PCR de lugar en un soporte magnético por 2 min hasta que los granos magnéticos son recogidos y sobrenadante es claro. Retire y descarte el sobrenadante.
  5. Bolas de lavado con 200 μL fresca 80% etanol mientras que la placa PCR está en el magnético soporte e incube durante 30 s a temperatura ambiente en el soporte magnético. Retire con cuidado el sobrenadante.
  6. Repetir el lavado por segunda vez.
  7. Después del segundo lavado, utilice una pipeta fina para quitar cualquier etanol residual de los pocillos y permitir que el aire de secado durante 10 minutos.
  8. Retire la placa de la polimerización en cadena del soporte magnético y añadir 52.5 μL de 10 mM de Tris de pH 8.5 a cada pocillo. Pipeta para arriba y abajo 10 veces suspender cuentas e incubar a temperatura ambiente durante 2 minutos.
  9. Transferencia de la placa de la polimerización en cadena en el soporte magnético para recoger bolas magnéticas y transferir 50 μL del sobrenadante a una placa PCR limpia. Coloque un sello claro adhesivo de la placa PCR en la placa y conservarlo a-20 ° c hasta una semana.
  10. (Opcional) Ejecutar los productos PCR de índice en un gel de agarosa o un análisis de ADN de alta sensibilidad que permite la medición cuantitativa del tamaño de amplicón (véase Tabla de materiales).
    Nota: El tamaño de la biblioteca indexadas final de este estudio fue de 668 bp (figura 3C, D).

11. cuantificar, normalizar y piscina las librerías indexadas para secuenciación

  1. Determinar la concentración de ADN de cada muestra con un fluorómetro y un kit de ensayo fluorescente dsDNA (véase tabla de materiales).
    1. Preparar una dilución de 1: 200 de la muestra (1 μl de cada muestra en 199 μl dsDNA master mix, que incluye buffer y reactivos) para cada una de las muestras indexadas y estándares (190 μl dsDNA amo mezclar y 10 μl de estándar). Analizar en un fluorómetro usando el ajuste de dsDNA.
  2. Tras el cálculo de la concentración de ADN, normalizar las bibliotecas calculando el tamaño promedio de la biblioteca. Esto sumando longitudes de adaptador, índice longitudes y tamaño de amplicón V de cartillas y ver los productos por gel de agarosa para asegurarse de que el tamaño real es similar al tamaño calculado (vea lafigura 3C, 22).
    1. También puede utilizar un análisis de ADN de alta sensibilidad que permite la medición cuantitativa de la integridad del ADN, tamaño de amplicón y concentración (tabla de materiales,D, figura 3).
      Nota: En este estudio, el tamaño promedio de la biblioteca se calculó con base en la suma de longitudes de adaptador, índice longitudes y tamaño de amplicón de V1-V3 de cartillas. El tamaño promedio fue de 668 bp.
    2. Se normalizan las concentraciones de las muestras mediante la fórmula en el cuadro 8.
  3. Diluir las muestras a 4 nM y piscina 5 μL de cada muestra de 4 nM en un solo tubo para la secuencia.

12. la secuencia de la biblioteca mediante un sistema de secuenciación de última generación y analizar los datos

  1. Secuencia de la biblioteca.
    Nota: Para este estudio, la Universidad de Utah alto rendimiento Genomics Core realiza la desnaturalización de la biblioteca y muestra la secuencia (como se describe en 6,22).
  2. Analizar los datos.
    Nota: Para separar los datos de muestras agrupadas, índice Lee identificaron y separado (como se describe en el 22).
  3. Generar archivos FASTQ y utilizar esto para el posterior análisis.

13. analizar los datos secuenciados de la biblioteca de amplicones de 16S

Nota: Este paso se realiza como se describe en Bice et al., 20176.

  1. Instalar las herramientas de análisis de los datos libremente disponibles (véase Tabla de materiales; 24).
  2. Montar fastq demultiplexan los archivos de los datos secuenciados (como se describe en25,,26). Deseche todas las secuencias desmontadas.
  3. Realizar el análisis después de una de novo abierta unidad taxonómica (OTU) recogiendo protocolo (tal como se describe en el 27).
    1. Bin secuencias en un fichero fastq solo por sampleID y secuencias de grupo con mayor similitud a OTUs, o 97% como se describe en 28. Alinear secuencias representativas de base con la longitud de la secuencia mínima de 150 y 75% identidad29,30. Asignar taxonomía describe28.
      Nota: Muestras pueden ser desechadas y analizaron31, seguido por asignación taxonómica y OTU mesa construcción32.
    2. Crear un archivo de asignación que identifica nombres descriptivos y las características de las muestras para identificación de la muestra y validar la cartografía archivo33,34.
    3. Hacer una red OTU que OTUs se vincula a la descripción de la muestra utilizando un archivo de mapeo35.
    4. Resumiendo taxa a través de parcelas36para calcular resúmenes de taxonomía en términos de abundancia relativa.
    5. Explorar la diversidad alfa de muestras a profundidad secuencia uniforme apropiado para muestras. Para definir la profundidad adecuada para la diversidad alfa, Resumen de cuentas total observadas en cada muestra utilizando el comando de la tabla resumen de bioma, como se describe en el 37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Varios estudios han demostrado que la práctica de la medicina mente-cuerpo mejora los resultados de salud. De manera similar, en ratones, enriquecimiento ambiental mejora los resultados como mayor vida útil y reparación de tumor de la herida6. Por lo tanto, un procedimiento EE fue desarrollado con el objetivo de definir el papel de la microbiota en este fenotipo mientras que primera normalización del microbioma antes de la iniciación del experimento (figura 1). Lo importante, todos los animales de cría están integrados en la colonia de ratón para al menos un mes antes del comienzo de la cría y cachorros recién nacidos son alojados conjuntamente con las madres en una jaula grande para normalizar la microbiota transmisión antes del experimento. Cuando los animales están entre 21 y 28 días de edad, números iguales de cada genotipo se destetan en sus respectivas viviendas, EE o entornos NE (figura 2A). En 16 semanas, se recoge la materia fecal de animales y homogeneizada (figura 2B), seguido por el aislamiento de ADN bacteriano. Por último, 16S amplicones se amplifican de heces ADN microbioma y código de barras indexadas para permitir la secuencia de todas las bibliotecas de microbioma simultáneamente (figura 3). El únicas secuencias identificadas en WT y tumor teniendo animales en condiciones de NE y EE se muestran en la figura 4. Curiosamente, EE no mejora la diversidad biológica en animales de peso, pero aumenta enormemente biodiversidad en animales del cojinete de tumor (figura 4), demostrando que este método permite mejoras de la biodiversidad. Este aumento de la biodiversidad puede ser atribuido a la presencia creciente de lo phylum Proteobacteria, con importantes aumentos en la clase Alphaproteobacteria y Betaproteobacteria y disminuye en Gammaproteobacteria patógena (figura 5 ; Suplemento tabla 1). El mayor incremento es en el Betaproteobacteria clase es el género Sutterella, un comensal probablemente implicados en la degradación de IgA secretada (figura 6, también ver38).

Figure 1
Figura 1 : Una representación de la línea de tiempo experimental. Las bandas cortas representan ventanas de 7 días, como la mayor parte del Protocolo se realiza en incrementos de 7 días. Esto también ayuda en la visualización del rango de edad de cachorro en todo el experimento. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : EE y NE vivienda condiciones y homogenados de heces (como se describe en el protocolo). Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Preparación de biblioteca de microbioma 16S. (A) no PCR amplicones derivados de taburete de ADN genómico. ()B) gráfico de la placa de indexación diseñado según el software utilizado (Tabla de materiales, 23). Las combinaciones de doble índice, I7 (Índice 1; La fila) y I5 (índice 2; La columna), se muestran para cada muestra. Cada índice es 8 bp de longitud. Los números de muestra se refieren a los números respectivos de ratón de los estudios EE. (C) los productos PCR de índice no. (D) análisis de la calidad de final purificado y agruparon las bibliotecas 16S. (A, C, D) Flechas negras denotan 550 bp amplicones y 668 bp biblioteca indexadas. Flechas rojas indican los productos no específicos se eliminan después de purificación como se muestra en el D. Superior e inferiores marcadores marcadores de tamaño añadidos a la muestra de referencia. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 : Cambios en la diversidad alfa tras EE de Tcf4Het / + ApcMin / + animales. Diversidad alfa de WT y Tcf4Het / + ApcMin / + tumor teniendo animales. En 20.000 Lee, NE y EE de la WT, p= 0,64 y NE y EE de Tcf4Het / + ApcMin / +, p= 0,03 prueba de t de dos muestras con corrección de Welch. Adaptado de Bice et al., 20176. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5 : EE-mediado cambios tras EE de Tcf4Het / + ApcMin / + animales. R-ggplot2 genera diagramas box-whisker denotando cambios en abundancia de la clase Alphaproteobacteria y Betaproteobacteria Gammaproteobacteria y phylum Proteobacteria. Afloramientos se observan como círculos. p= 0,005 mediante pruebas de t de dos muestras con corrección de Welch. Barras de error calculadas usando el error estándar de la media (SEM). Adaptado de Bice et al., 20176. Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6 : Cambios en la abundancia relativa de Sutterella tras EE de Tcf4Het / + ApcMin / + animales. Afloramientos se observan como círculos. p= 0,005 utilizando la prueba t de dos muestras con corrección de Welch. Barras de error calculados usando SEM. adaptado de Bice, et al., 20176. Haga clic aquí para ver una versión más grande de esta figura.

Supplemental Table 1
Suplemento tabla 1: clasificación de las bacterias aisladas de heces recogidas de ratones NE y EE. Clasificación en genotipos a nivel de Phylum (A), clase (B), (C) orden, (D) familia y género (E). Las comparaciones de NE y EE el mismo genotipo o WT a Tcf4Het / + ApcMin / +. Los valores de P se calculan mediante una prueba t de dos muestras con corrección de Welch. Adaptado de Bice et al., 20176. Haga clic aquí para descargar este archivo.

Artículo Área total (pulgadas2) Total área (cm2) Jaula de tamaño (pulgadas) L x W x H Jaula de tamaño (cm) L x W x H
Una Control jaula (NE) 68.25 440.32 10.5 x 6.5 x 5.5 26.67 x 16.51 x 13.97
Una jaula grande (EE) 264.36 1706.32 13.87 x 19,06 x 7.75 35.24 x 48.42 x 19.69
Dos jaulas grandes (EE) 528.72 3412.64 2 @ 13.87 x 19,06 x 7.75 2 @ 35.24 x 48.42 x 19.69
Dos plataformas (EE) 93 600 2 @ 11.8 x 3,94 x 2,95 2 @ 30 x 10 x 7,5
Dos grandes jaulas con dos plataformas (EE) 621.72 4013 2 @ 13.87 x 19,06 x 7.75 + 2 @ 11.8 x 3,94 x 2,95 2 @ 35.24 x 48.42 x 19.69 + 2 @ 30 x 10 x 7,5

Tabla 1: Tamaños EE y NE la jaula y el espacio.

Animales permitidos en jaula Requiere pulgadas cuadrados por Animal Superficie de la jaula EE (pulgadas2) Total animales permitidos
Hasta 25 12 6222 (4013 cm2) hasta 25
25 + 15 6222 (4013 cm2) hasta 41
Mujer con camada 51 6222 (4013 cm2) hasta 12

Tabla 2: números de animales permitidos en jaulas basados en espacio 15 .

Cebadores de PCR amplicon
Hacia adelante 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3 '
Marcha atrás 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 '
Secuencias específicas de locus aparecen en negrita y sin negrita es el alero adaptador.

Tabla 3: Primers de PCR Amplicon.

Reacción de PCR Amplicon configurar
Volumen
DNA microbiano (5ng/μl) 2,5 μl
Adelante la cartilla (1 μM; de paso 5.1.2) 5.0 μl
Revertir la cartilla (1 μM; de paso 5.1.2) 5.0 μl
2 x HotStart Ready Mix 12.5 μl
Total 25.0 μl

Tabla 4: mezcla de PCR Amplicon.

Configurar PCR amplicon
95 ° C durante 3 minutos
25 ciclos de:
95 ° C durante 30 segundos
55 ° C durante 30 segundos
72 ° C por 60 segundos
72 ° C durante 3 minutos
Mantener a 4 ° C

Tabla 5: Programa de PCR Amplicon establecido.

Conjunto de códigos de barras índice PCR
DNA 2,5 μl
Primer Índice 1 (N7XX) 2,5 μl
Índice Primer 2 (S5XX) 2,5 μl
2 x HotStart Ready Mix 12.5 μl
Agua de grado de polimerización en cadena 5 μl
Total 25 μl

Tabla 6: Índice mezcla PCR.

Índice PCR Setup
95 ° C durante 3 minutos
8 ciclos de:
95 ° C durante 30 segundos
55 ° C durante 30 segundos
72 ° C por 30 segundos
72 ° C durante 5 minutos
Mantener a 4 ° C
Conservar a-20 ° C

Tabla 7: programa de PCR índice ajustado arriba

Fórmula de concentración de muestra para el agrupamiento
(Concentración de ADN en ng/μl) x 106 = concentración en nM
(660 g/mol x tamaño promedio de la biblioteca)
Un ejemplo de este estudio es:
(85.2 ng/μl) x 10 ^ 6 = 193.3 nM
(660 g / mol x 668 bp)

Tabla 8: fórmula para normalizar antes de agrupación de las muestras

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Este procedimiento permite el análisis de la microbiota aislada de heces tras enriquecimiento ambiental de normal o de tumor con animales. Porque estos son grandes experimentos que implican la crianza para obtener muchos animales de diversos sexos y genotipos, normalizando el microbioma entre animales antes del inicio del experimento es esencial evitar que EE no relacionadas con efectos sobre el microbioma biodiversidad.

Coherencia entre NE y EE, se lleva a cabo el proceso de cría para asegurar que todos los ratones tienen inicialmente la exposición a los mismos microbios y, por lo tanto, se espera que tengan contenido similar del microbioma. Es posible, y probablemente, ese genotipo del ratón afecta a la composición del microbioma. Por esta razón, números de ratón por genotipo se mantienen entre NE y EE condiciones para asegurarse de que cualquier animal que está consumiendo heces encontrarán una diversidad similar de la microbioma.

Varias dificultades son evidentes cuando los experimentos de diseño de EE. En primer lugar, el número total de animales necesarios para los experimentos depende de los detalles experimentales, pero el número total también está limitado por el número de animales permitidos en la jaula. Por ejemplo, datos históricos circundantes ratón supervivencia en un experimento preliminar de EE se utilizaron para calcular el número de animales para definir el mecanismo subyacente mejoró la supervivencia observada en experimentos anteriores. De estos datos, un total de 17 animales en el grupo de comparación fueron requeridos para una potencia de 80% detectar una diferencia en la supervivencia en un t-test bilateral donde alfa = 0.05. Así, animales de 4-5 en el grupo control vs. 20-24 (o hasta 41) animales por jaula en el grupo experimental deben alojar un cálculo de la energía. Por lo tanto, se necesitan varias jaulas de grupo de control junto con la jaula experimental. Además, con genotipos de complejo, es difícil obtener suficiente número de animales de cada genotipo, que exige un gran número de hembras de cría necesarios. Sin embargo, con otros modelos donde existen menos diferencias transgénicas, más animales del mismo genotipo pueden ser analizados en este sistema y menos criadores son necesarios. En los Estados Unidos, 12 hembras preñadas pueden ser ubicadas en 6332 del espacio (tabla 2). El problema con esto es que conforme van creciendo los cachorros, ocupan más espacio. Dado que los cachorros machos están separados de cachorros hembra en 14-21 días, una aprobado excepción a la regla de espacio en ciertos países puede ser factible. De lo contrario, cachorros machos y hembras pueden ser genotipados seleccionado y entonces separado a una edad más temprana con madres permanecer debajo de los números del ratón máximo. Es esencial para ganar la aprobación para estos estudios y a adherirse a las reglas locales sobre las restricciones de espacio. Finalmente, con la microbiota, el número de animales necesarios para detectar incluso pequeñas diferencias en la composición de la microbiota es difícil de calcular a priori. Mientras que en este estudio, se encontraron diferencias significativas en la microbiota con 4 animales por grupo, es posible que ese incremento de animales revelaría microbiota que son más variables entre ratones EE o son sólo ligeramente alterada por EE.

Este artículo método describe el particular equipo y ropa de cama que se utilizan, que en la superficie no parezca esencial. Sin embargo, varios problemas no evidentes que afectan la consistencia se encuentran y deben abordarse antes de embarcarse en estos muy grande, costoso y desperdiciador de tiempo estudios. Una cuestión importante es la ventilación de la jaula. Con un gran número de animales en una jaula, ventilación se convierte en un problema y es un tema que la mayoría de los investigadores no toman en cuenta cuando se intenta proporcionar entornos coherentes entre jaulas experimentales y control. Todas las jaulas en la configuración descrita se colocan en un gabinete ventilado para igualar la ventilación a través de lo experimental y control de jaulas. Esto no puede lograrse cuando usar jaulas que hacen que no caben en un armario ventilado. Otros medios para normalizar la ventilación entre experimentales y control de animales podrían ser probados y aplicados en forma consistente, pero estos métodos no son explorados en este estudio. Temas similares de consistencia se presentan con ropa de cama. En el sistema de modelo de cáncer colon utilizado en este estudio, los animales que tienen enfermedades digestivas ingieren ciertos tipos de ropa de cama, mazorca de maíz sobre todo ropa de cama, conduce a bloqueos digestivos y enfermedad. Es importante tener esto en cuenta si se conocen los animales a ingerir las camas cuando no ocupado, como en el ambiente de control. Este fenómeno y los efectos posteriores incompatibles afectará profundamente todos los datos.

El gen ribosomal 16S se ha utilizado como un medio para el estudio de las poblaciones bacterianas. Contiene nueve regiones que expresan la variabilidad genética, V1-V9 y entremezcladas regiones conservadas que permanecen relativamente sin cambios entre especies bacterianas39. La región de V1-V3, en particular, proporciona la más alta probabilidad de identificación de especies-nivel39. V1-V3 similar estudia en cáncer colorrectal (CCR) y Adenoma Colorectal avanzado encontró cambios en tres phyla de interés: Bacteroidetes y Firmicutes, proteobacterias21,40,41. También se ha divulgado que el ejercicio puede cambiar la población microbiana y conducen a un aumento de Firmicutes42. Por esta razón, este estudio identificó poblaciones de microbioma utilizando cartillas de V1-V3 siguiendo un 16S biblioteca metagenómica preparación protocolo22 para definir potencialmente los efectos del enriquecimiento ambiental en estos phyla conocido modificarse en adenoma y CRC. Este procedimiento puede modificarse para amplificar y otras regiones variables de los genes del rRNA 16S de la secuencia. Una forma es utilizar sonda partido para comprender la clasificación filogenética de la microbiota presente en la muestra que se identificará por la sonda. De esta manera, las puntas de prueba pueden ser objeto para definir específicamente y para clasificar filogenéticamente microbios de interés. Esto permite una diferente caracterización de la microbiota presente en las muestras de heces y puede revelar alteraciones de EE-dependiente adicionales en el microbioma del tumor teniendo ratones que pueden afectar la progresión de la enfermedad.

Mediante este procedimiento, el género Sutterella fue identificado como el género más alterado tras EE del tumor teniendo animales. Este procedimiento puede ser adaptado para dar cabida a estudios que utilizan cualquier método para analizar los efectos de una perturbación en la composición del microbioma en modelos transgénicos de la enfermedad humana. Por ejemplo, en lugar de EE, ratones podrían ser inoculados con Sutterella definir si Sutterella inoculación es suficiente para aumentar la biodiversidad microbiana y reparación de la herida en 16 semanas de edad masculino tumor teniendo animales.

Sin duda, el aspecto más singular de este protocolo es la preocupación sobre la microbiota antes EE la normalización y mantenimiento de microbioma diversidad a lo largo de los estudios EE. Ya que continuamente están mejorando el microbioma estudios, es probable que surgirán más robustos métodos para caracterizar el microbioma, y la caracterización del microbioma en el presente Protocolo se convertirá en obsoleta. Por ejemplo, con el estudio actual, las puntas de prueba utilizados para amplificar la 16S rRNA tienen sesgo, dependiendo de las sondas que son elegidos y no caracterizan a todas las bacterias presentes en el microbioma. Mientras que, sin duda, mejorar los métodos utilizados para estudiar y caracterizar el microbioma, el fundamento básico de diseño y ejecución de EE experimenta mientras que mantener la normalización de la microbioma en mente seguirá siendo una faceta esencial de experimentos EE.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores declaran que no tienen ningún conflicto de intereses.

Acknowledgements

Agradecemos a B. Dalley en el centro de genómica de la Universidad de Utah para la secuenciación de la biblioteca y K. Boucher en el centro de Bioestadística de la Universidad de Utah para asesoramiento estadístico y el acceso a estos núcleos técnicos apoyados por el premio del Instituto Nacional del cáncer CA042014 P30. El proyecto descrito fue apoyado por el nacional cáncer Institute subvenciones P01 CA073992 y CA128891 K01 y la Fundación de cáncer Huntsman.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics