Une méthode pour définir les effets de l’enrichissement environnemental sur la biodiversité le Microbiome du côlon dans un modèle murin de tumeur du côlon

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Enrichissement de l’environnement (ERE) est un environnement de logement des animaux qui permet de révéler les mécanismes qui sous-tendent les connexions entre le mode de vie, le stress et la maladie. Ce protocole décrit un procédé qui utilise un modèle murin de la tumorigenèse du côlon et EE pour définir précisément les altérations en biodiversité microbiote qui peut-être influer sur la mortalité animale.

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Plusieurs études récentes ont révélé les effets bénéfiques de vivre dans un environnement enrichi sur l’amélioration de la maladie humaine. Chez les souris, enrichissement environnemental (EE) réduit la tumorigenèse en activant le système immunitaire de la souris, ou affecte la survie animale de la tumeur roulement en stimulant la réponse de réparation de plaie, y compris amélioré microbiome diversité, dans le microenvironnement tumoral. Fourni ici est une procédure détaillée pour évaluer les effets de l’enrichissement environnemental sur la biodiversité de la microbiome dans un modèle murin de tumeur du côlon. Précautions concernant l’élevage d’animaux et les considérations relatives à l’intégration de colonie animale génotype et de la souris sont décrites, ce qui affecte finalement la biodiversité microbienne. Tenant compte de ces précautions peut permettre plus uniforme microbiome transmission et par conséquent permettra d’atténuer des effets reliés à pas de traitement qui peuvent confondre les résultats de l’étude. En outre, dans cette procédure, microbiote changements sont caractérisés en utilisant 16 s rDNA séquençage de l’ADN isolé dans les selles prélevés dans le côlon distal après enrichissement environnemental à long terme. Déséquilibre de flore microbienne intestinale est associé à la pathogenèse du cancer de l’intestin inflammatoire maladie et le côlon, mais aussi de l’obésité et le diabète entre autres. Ce qui est important, ce protocole pour l’analyse des EE et microbiome peut être utilisé pour étudier le rôle de la pathogénèse de microbiome à travers une variété de maladies où il existe des modèles de souris robuste qui peut récapituler les maladies humaines.

Introduction

Études d’enrichissement environnemental (EE) utilisent des paramètres complexes de logement pour influer sur la stimulation sociale (logement grandes cages, grands groupes d’animaux), stimulation cognitive (cabanes, tunnels, matériaux de nidification, plates-formes) et l’activité physique (marche roues). EE a été utilisé par nombreux laboratoires pour comprendre les effets de l’augmentation de l’activité et l’amélioration des interactions sociales et cognitives sur l’initiation de la maladie et la progression à l’aide d’un large éventail de modèles de souris, y compris de l’alopécie induite coiffeur, la maladie d’Alzheimer, Le syndrome de Rett et plusieurs maladies tumorales et digestif modèles1,2,3,4,5,6.

Plusieurs modèles de souris ont été développés pour étudier la tumorigenèse du colon chez des souris. Le modèle plus bien défini est peut-être la souris ApcMin . La souris ApcMin a été développée dans le laboratoire de William Dove en 19907et a été utilisée comme un modèle de souris de mutations dans le gène APC qui sont couramment associés à un cancer colorectal humain. Contrairement aux humains hébergeant des mutations de l’APC , ApcMin souris développent principalement petites tumeurs intestinales, événement très rare des tumeurs du côlon. Toutefois, un allèle Tcf4Het avec une mutation hétérozygote knockin-knockout en Tcf4, augmente considérablement tumorigenèse du côlon lorsqu’il est combiné avec l' allèle de ApcMin 8. Récemment, ce modèle de souris de la tumorigenèse du côlon a servi à déterminer les effets de l’ERE du côlon tumorigenèse6. Le Bice et al. étudier les effets physiologiques et phénotypiques de l’ERE sur mâles et femelles de quatre lignées de souris différentes (type sauvage (WT), Tcf4Het / + Apc+ / +, Tcf4+ / + ApcMin / +, et Tcf4 Het / + APCMin / +)) ont été définis. Peut-être les plus intéressantes conclusions était que EE augmente de manière significative la durée de vie des animaux de porteurs de tumeur du côlon mâles et femelles. Cela démontre que EE peut réduire au moins certains des symptômes associés à tumorigenèse du côlon et améliorer la santé animale. Remarquablement, cette durée de vie améliorée chez les mâles n’est pas une conséquence directe de la tumorigenèse réduite et au lieu de cela était liée à l’initiation d’une réponse, y compris le microbiome améliorer la biodiversité6tumeur de cicatrisation.

Plusieurs études spécifiques de EE ont été publiées avec des résultats intéressants. Cependant, du point de vue technique, des résultats importants ne sont souvent pas traduisibles aux autres laboratoires. Le maintien des méthodologies EE identiques entre différents laboratoires est une question incroyablement complexe, non seulement en raison des dispositifs d’enrichissement et de l’habitation utilisée, mais également literie, nourriture, ventilation, élevage, génétique, activité dans la salle et le protocole de l’animal exigences, entre autres,9,10,11. Un exemple est intégration animale, où animaux doit être solidement intégrés dans la colonie de souris, donc normaliser composition génétique de fond et le régime alimentaire, afin d’éviter des effets connexes de non-traitement. En outre, de nombreuses études EE sont achevées avant la réalisation de l’importance du microbiome dans la maladie et la façon que les pratiques d’élevage de souris commune peuvent influer sur la composition de l’intestin microbiome10,12.

Élevage animal et la stratégie de placement dans EE peut augmenter le stress si elle n’est pas effectuée correctement. Étant donné que les études EE utilisent un grand nombre de fois des animaux mâles et femelles et plusieurs génotypes, montage expérimental peut être difficile compte tenu de l’exigence pour les animaux provenant de plusieurs portées à combiner. Par conséquent, un élevage et stratégie de sevrage a été développé pour permettre une combinaison des animaux sevrés du génotype correct des portées différentes. La principale raison d’être pour cela est de normaliser la microflore des portées et à réduire le stress lorsque les animaux ont été déplacés vers l’environnement expérimental. Le microbiome a été diffusée par le barrage de10. Afin d’offrir la diversité microbienne dans la colonie, les femelles ont été achetées de Jackson Labs et intégrées dans la colonie pendant un mois avant le début de l’expérience9,10,12. Pour davantage normaliser la biodiversité microbiome entre animaux, les femelles sont conjointement logées avant la reproduction. Après la reproduction, logement communal au cours de l’élevage et la possibilité d’échapper à petits soins infirmiers amélioré le niveau de stress des soins maternels13,14, éventuellement favoriser microbiome normalisation. Pour éviter d’autres effets sur le microbiome liés, ce logement communal de tous les animaux de laboratoire ont empêché combat stress supplémentaire qui s’est produite lors de la combinaison de plusieurs mâles provenant de différentes portées dans une cage expérimentale. Enfin, un nombre égal d’animaux de tous les génotypes ont été inclus dans les cages. Cela a permis aux microbiote améliorer la biodiversité à travers des génotypes et supprimé la contribution de coprophagie (tendance de l’animal à consommer des selles) ou des différences de comportement possibles génotype spécifique à l’étude globale.

Ce protocole prévoit une stratégie qui développe des études antérieures d’EE afin d’inclure les aspects connus de recherche microbiome, y compris l’intégration du microbiote transmission et animal de la colonie microbiote normalisation, pour permettre à des populations plus uniforme microbiome entre les animaux de laboratoire. Tenant compte de ces précautions est essentielle en raison de la capacité des différences de non-traitement microbiote connexes pour confondre les résultats de l’étude. Éliminer les non-EE associés microbiote modifications permettra aux chercheurs de définir précisément le rôle de l’ERE sur la composition de la microflore durant le développement de la maladie et la progression.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Toutes les méthodes décrites ici ont été réalisés conformément aux protocoles approuvés par l’animalier institutionnel et utilisation Comité (IACUC) à l’Université de l’Utah.

1. protocole expérimental et EE et panneau de configuration Cage

Remarque : Pour référence, les grandes lignes du plan expérimental est illustrée (Figure 1).

  1. Mis en place le contrôle (NE) et de cages à EE (Figure 2).
    1. Pour mettre en place des cages NE, utilisez cages de contrôle conventionnel autoclavés (tableau 1) que le manque de dispositifs d’enrichissement.
    2. Pour les grandes cages, percer un trou par cage qui est assez grand pour accueillir un œillet et tunnel (Table des matières).
    3. Pour configurer d’élevage des petits et des cages EE, connectez deux grandes cages autoclavés avec un tunnel sécurisé stérilisé à œillets et 2 plates-formes stérilisés pour augmenter l’espace de plancher (tableau 1). Pour des expériences EE, contient stérilisé exécutant des roues, tunnels, igloos, cabanes, boules de rampement et matériaux dans les cages EE de nidification.
    4. Placer les cages EE et de NE dans un rack ventilé pour assurer une ventilation égale.
      Remarque : Deux grandes cages avec 2 plateformes (tableau 1) permettent un maximum de 12 femelles enceintes par chiot élevage installation15 (voir Table des matières, 3.2 dans le document et tableau 2).
    5. Se nourrit de souris ad libitum irradiés chow standard et l’eau osmosée autoclavée.
    6. Fournir des souris avec literie stérile.
      Remarque : Toutes les manipulations des cages vides et des cages avec des animaux doivent se faire dans le capot pour éviter la contamination. Pour la manipulation de la cage de grandes cages, recouvrir le trou dans la cage avec un film adhésif.
  2. Préparer les animaux d’élevage. Groupe 15 femelles 2 - mois, de maison en une seule grande cage (tableau 1) pendant 2 semaines avant l’accouplement. Maison séparément 2 - mois vieux mâles de même portée pendant 2 semaines avant l’accouplement.
    Remarque : Le nombre de femelles pour la reproduction dépend de l’expérience et le nombre d’animaux requis. Dans cette étude, 15 femmes ont été utilisées pour obtenir 12 femelles bouchées, qui est le maximum nombre autorisé dans le chiot d’élevage configuration décrite au paragraphe 1.1.2 (tableau 2).
  3. Pour la reproduction, combiner animaux sire et barrage, 1 mâle pour 2 femelles. Le premier chèque le matin devrait être prises vaginale, qui peut être un signe visuel que les animaux ont accouplé au cours de la nuit.
    Remarque : Maison mâles et femelles ensemble jusqu'à ce que chaque femelle a branché. Un plug vaginal peut être identifié visuellement, si elle est externe.
    1. Pour détecter les bouchons intériorisées, une sonde est insérée dans l’orifice vaginal et si la fiche vaginale est présente, la sonde n’est pas facilement insérée (16; Voir la section 4.3.6).
      Remarque : Enregistrer le matin qu'une fiche est détectée comme ½ journée, étant donné que l’accouplement a eu lieu dans la nuit.
    2. Une fois que les femelles ont des bouchons vaginales, transférez-les sur un chiot grand élevage cage pour logement de groupe avec d’autres femelles accouplées (programme d’installation à l’étape 1.1.2 sans matériel d’enrichissement).
    3. Remplacer accouplées femelles avec des nouvelles femelles accouplées groupe logé pour s’accoupler et continuer l’accouplement afin d’obtenir un nombre maximum de portées dans un délai de 7 jours.
      Remarque : Tous les animaux doivent avoir une date de livraison dans les 7 jours d’intervalle.
  4. Laisser les femelles gravides donner naissance au groupe logement afin que toutes les portées sont déclenchées dans un chiot grand élevage cage (programme d’installation à l’étape 1.1.2 sans matériel d’enrichissement).
    1. Garder trace des dates de naissance et numéros de chiot et commencer les chiots de génotypage 7 jours après la naissance.
      1. Tatouage chiots sur leurs orteils 7 jours après la naissance avec un numéro de code pour les identifier13,17.
      2. Nettoyer l’orteil avec l’éthanol à 70 % et insérer délicatement un dispositif micro-tatouage contenant l’encre dans la surface de la peau parallèle à l' orteil17 (voir Table des matières).
      3. Recueillir des tissus avec des ciseaux pour le génotypage depuis le bout de la queue par incision d’un petit morceau de tissu de 7 - jours vieux nouveau-nés.
    2. Isoler l’ADN génomique de tissus et d’effectuer la PCR à l’aide d’une méthode conventionnelle de HotSHOT comme décrit dans 18.
    3. Animaux séparés selon le sexe à 14 à 21 jours dans grandes cages avec les mères.
      Remarque : S’assurer que les chiots plus âgés sont capables de se nourrir de leurs propres, et que les jeunes chiots continuent d’allaiter jusqu’au vieux assez pour se nourrir de leurs propres.
    4. 21-28 jours, distribuer des animaux mâles et femelles séparément par génotype dans les milieux NE ou EE, en veillant à garder les proportions égales de chaque génotype par cage (Figure 2A).
      Remarque : Veiller à ce que le nombre total d’animaux admis dans chaque cage NE ou EE repose sur le nombre maximal autorisé par IACUC (tableau 2). Les cages NE comporter au maximum 5 animaux (tableau 2). Dans des cages EE, stimulation sociale, pas moins de 20 et aux restrictions de l’espace, pas plus de 41 animaux devrait être autorisés dans la cage EE (tableau 2).

2. tabouret Collection à 16 semaines d’âge

  1. Commencer collection de selles 1 à 2 jours avant de sacrifier et recueillir séparément les selles sur le jour du sacrifice au cours de la dissection à l’aide des outils stériles.
    Remarque : Collecte de selles en même temps 1-2 jours ayant précédé le prélèvement peut aider à éviter la perte d’un échantillon en raison de la possibilité qu’aucun tabouret n’est présent au moment de la collecte.
    1. À recueillir selles d’animaux vivants, soigneusement scruff l’animal dans une cage propre. Recueillir les selles à l’aide d’une pince stérile dans un tube à centrifuger stérile.
      Remarque : Animaux éliminera généralement selles lorsque immobilisée, qui permet pour la collection de selles rapide directement dans un tube à centrifuger stérile. Si un animal ne pas immédiatement déféquer lorsqu’immobilisé, placez-le dans une cage propre et attendez que l’animal de déféquer (généralement jusqu'à 1 h).
    2. Recueillir les selles sur le jour du sacrifice.
      1. Pour euthanasier l’animal, placer l’animal dans une cloche de verre contenant un petit récipient avec un tampon d’ouate imbibé d’isoflurane. Une fois l’arrêt de la respiration est observée (habituellement après 2 min), posez l’animal sur son dos pour permettre la dissection du côlon.
      2. S’appliquent à l’éthanol à 70 % à l’abdomen de la souris.
      3. Soulever la peau avant le méat urétral et avec une pince et utiliser des ciseaux pour couper le long de la ligne médiane ventrale jusqu'à arriver à la cage thoracique et couper de la base de la première incision vers chaque jambe. Replier la peau et utiliser des ciseaux pour couper à travers la paroi péritonéale dans le même schéma.
      4. Pince permet de saisir le côlon distal à l’anus de disséquer et détacher le côlon distal du rectum. Tout en tirant sur les deux points verticalement avec une pince, utiliser des ciseaux pour couper à travers le mésentère pour libérer le côlon.
      5. Couper les deux points juste en dessous du caecum et posez-le sur un papier filtre. Forceps permet de soulever le haut du tube du côlon, ouverture de la lumière pour permettre à un côté de ciseaux ouvert à insérer. Coupé longitudinalement, ouverte de distal à proximal et ébrasement du côlon sur la longueur.
      6. Recueillir les selles dans le côlon distal dans un tube à centrifuger stérile à l’aide d’une pince stérile.
  2. Tabouret de magasin dans un tube à centrifuger à-80 ° c jusqu’au moment de l’isolement de l’ADN bactérien.
    Remarque : Le jour du sacrifice, en plus de selles, recueillir des autres échantillons tels que le sang total, sérum, plasma, normal et le tissu tumoral du côlon et l’intestin grêle, microsomes, tissu adipeux, etc.. d’aborder des questions définies dans l’étude.

3. genomic DNA Isolation dans les selles

Remarque : Utiliser une trousse commerciale pour isoler l’ADN microbien dans les selles suite à un protocole de détection de pathogènes tabouret. Prélèvement d’échantillons directement pour le congélateur ˚C-80 et le magasin sur la glace sèche tout en pesant.

  1. Transférer jusqu'à 220 mg de selles dans un tube à centrifuger propre contenant 1,4 mL de tampon de lyse tabouret température ambiante (RT) (voir la Table des matières).
  2. Échantillon de Vortex pendant 1 min à homogénéiser soigneusement solides (Figure 2B). Faire chauffer la suspension à 95 ° c pendant 5 min à lyser toutes les bactéries (y compris les bactéries à Gram positif).
  3. Échantillons de Vortex pendant 15 s, puis centrifuger à 20 000 x g pendant 1 min granuler les solides de selles. Transférer surnageant dans un tube à centrifuger de 2 mL. Ajouter une pastille de chaque échantillon d’absorber des inhibiteurs de PCR, vortex jusqu'à ce que le comprimé se dissout et incuber l’échantillon à RT pendant 1 min.
  4. Centrifuger l’échantillon à 20 000 x g pendant 3 min et transférer le surnageant dans un nouveau tube à centrifuger. Centrifuger à 20 000 g pendant 3 min. Aliquot 15 μl de protéinase K (20 mg/mL de bouillon) dans un nouveau tube de microtubes de 1,5 mL. Pipeter 200 μl de l’échantillon dans le tube contenant la protéinase K.
  5. Ajouter 200 μl de tampon de lyse chlorure guanidinium au tube, vortex soigneusement pendant 15 s (voir Table des matières) et incuber l’échantillon à 70 ° c pour 10 min. Ajouter 200 μL d’éthanol (96-100 %) pour les tubes et mélanger bien au vortex.
  6. Place une silice base de colonne dans un tube de prélèvement de 2 mL et appliquez les échantillons à la colonne. Fermer le couvercle et centrifuger pendant 1 min à 20 000 x g.
  7. Transférer la colonne dans un nouveau tube de prélèvement de 2 mL et ajouter 500 μl de tampon de lavage 1 à la colonne, cap de la colonne et centrifuger pendant 1 min à 20 000 x g. transfert la colonne vers un nouveau tube de prélèvement de 2 mL et ajouter 500 μl de tampon de lavage 2 à la colonne , fermer le bouchon et centrifuger à 20 000 x g pendant 3 min.
  8. Avec le couvercle fermé, transférer la colonne sur un nouveau tube de prélèvement de 2 mL et centrifuger pendant une supplémentaire de 1 min à 20 000 x g pour retirer le tampon de lavage résiduelle. Transférer la colonne à un 1,5 mL étiqueté tube à centrifuger et éluer l’échantillon en ajoutant 200 μl de tampon d’élution contenant de l’EDTA à la membrane (voir Table des matières).
  9. Fermez le bouchon et laisser incuber à RT pendant 1 min. Centrifuger l’échantillon pendant 1 min à 20 000 x g. jeter la colonne.

4. ADN Concentration dosage et préparation des échantillons pour l’ACP

Remarque : Utiliser un fluorimètre et une immunofluorescence dsDNA commercialement disponible pour déterminer la concentration d’ADN génomique dans chaque échantillon (voir Table des matières). Le colorant fluorescent doit spécifiquement lié à ADN bicaténaire.

  1. Préparer une dilution au 1 : 200 de chaque échantillon (1 µL de chaque échantillon dans 199 mélange maître de µL ADNdb) et un 01:50 dilution des normes. Analyser un fluorimètre au réglage de l’ADN double brin.
    Remarque : Un volume élevé d’ADN par PCR peut être inhibitrice, donc, le volume de l’ADN utilisé ne doit pas être plus de 10 % du volume final de la PCR. Un fluorimètre permet une mesure précise de l’ADN dans l’échantillon, comme seulement les ADN lié à la teinture fluorescente seront réagissent en, éliminant la contribution possible de contaminants à la concentration finale d’ADN calculée. Ce niveau de quantification précise est essentiel pour l’application de séquençage en aval.
  2. Préparer des modèles PCR diluées à 5 ng/μL, avec le volume approprié de 10 mM Tris, pH 8,5 à faire des stocks de modèle de travail de chaque échantillon.
  3. Conserver les échantillons à-20 ° C.

5. conception des amorces pour les 16 désiré V régions

  1. Conception des amorces pour amplifier sélectivement les régions de rRNA 16 s V désirées.
  2. Analyser des amorces avec sonde Match, par le projet de base de données Ribosomal19, afin de déterminer le taux d’interception approximatif pour divers embranchements.
    Remarque : Pour les régions de V1-V3, la présente étude utilisée publié amorces Bosshard avant20, qui se lient à la position 8 dans la région de V1 et 533 inverse21, qui se lie au poste 533 au sein de la région de V3. Amorces doivent inclure des séquences Adaptateur porte-à-faux pour l’indexation.
  3. Lors de la conception des amorces, incluent des séquences d’adaptateur aux extrémités 5' de chaque amorce, tel que recommandé pour la métagénomique 16 s, séquençage bibliothèque préparation22 (tableau 3).
  4. Synthétiser ces amorces grandes purification de la cartouche. Reconstituer les amorces desséchées et diluer une PCR en stock à 1 μM 10 mM Tris, pH 8,5.

6. Amplicon PCR pour amplifier l’ou les régions avec des séquences de surplomb adaptateur V joint 22

  1. Mettre en place l’amplicon mélange de réaction PCR comme décrit dans le tableau 4.
  2. Posez un joint de la plaque PCR transparent adhésif sur la plaque et exécutez l’amplicon PCR en utilisant les paramètres dans le tableau 5.
  3. (Facultatif) Exécuter des amplicons produits PCR sur gel d’agarose ou un essai d’ADN de haute sensibilité qui permet une mesure quantitative de la taille de l’amplicon (voir Table des matières).
    Remarque : La taille de l’amplicon de cette étude est de 550 bp (Figure 3A).

7. PCR nettoyage à l’aide magnétique perles 22

  1. Centrifuger la plaque PCR amplicon rapidement à 1 000 x g pendant 1 min recueillir la condensation.
    Remarque : Bandes de tube PCR peuvent être utilisés au lieu de plaques PCR pour minimiser la contamination. Jeter le tube couvercles et ne réutilisez jamais.
  2. Vortex les billes magnétiques pour disperser uniformément et ajouter 20 μL de magnétique perles à chaque amplicon PCR bien, puis Pipetter tout le volume monte et descend lentement 10 fois.
  3. Incuber à RT pendant 5 min. Place la plaque PCR sur un support magnétique pendant 2 min jusqu'à ce que les billes magnétiques sont collectés et le surnageant est clair. Retirer et jeter le surnageant.
  4. Perles de lavage avec 200 μL frais l’éthanol 80 % tandis que la plaque PCR est sur le magnétique stand et incuber pendant 30 s à ta sur le support magnétique. Retirer délicatement le surnageant.
  5. Répéter le lavage pour une deuxième fois. Maintenant, utiliser un embout de la pipette fine pour enlever tout l’éthanol résiduel provenant des puits et de permettre à l’air de séchage pendant 10 min.
  6. Retirer la plaque PCR du support magnétique et ajouter 52,5 μL de 10 mM Tris pH 8,5 à chaque puits. Pipetter vers le haut et le bas de 10 fois de suspendre les perles et incuber à température ambiante pendant 2 min.
  7. Transférer la plaque PCR sur le support magnétique pour recueillir des billes magnétiques et transférer 50 μL de surnageant dans une assiette propre de la PCR. Posez un joint de la plaque PCR transparent adhésif sur la plaque et conserver à-20 ° c pendant une semaine.

8. élaboration d’un schéma de plaque pour Index PCR

Remarque : Pour générer une bibliothèque de V1-V3, une deuxième PCR a été réalisée avec un index nécessaire (voir la Table des matières). Un schéma d’indexation par défaut a été utilisé pour cartographier de combinaisons d’index double unique pour chaque échantillon (Figure 3B et 23).

  1. S’assurer que chaque échantillon a une combinaison unique de 2 amorces d’indice (c'est-à-diredouble indexation).

9. Effectuez Index PCR pour fixer des codes à barres pour les séquences de l’adaptateur comme décrit 22 .

  1. Transférer 2,5 μL d’amplicons PCR (amplicons propre) à une nouvelle plaque de 96 puits et les place dans un appareil plaque d’indice afin de faciliter l’indexation.
  2. Réorganiser l’index 1 et index 2 amorces comme dans l’exemple de l’image de la plaque préparée (Figure 3B).
    Remarque : Repères visuels sont fournis pour éviter les confusions d’apprêt : tubes apprêt index 2 devraient avoir capuchons blancs et une solution claire, tandis que les tubes apprêt index1 devraient avoir casquettes orange et jaune solution.
  3. Monter l’indice de réaction PCR Mix comme décrit dans le tableau 6. La composition de pipetage et descendre de 10 fois. Couvrir avec un joint de la plaque PCR transparent adhésif et centrifuger pour collecter à 1 000 x g à température ambiante pendant 1 min.
  4. Exécutez l’index PCR en utilisant les paramètres dans le tableau 7.

10. purifier PCR Final bibliothèque

Remarque : Ce nettoyage PCR est identique à l’étape 7 ci-dessus et utilise des billes magnétiques pour effectuer une PCR Clean-Up de l’indice PCR22.

  1. Centrifuger la plaque PCR de l’étape 10 rapidement à 1 000 x g pendant 1 min recueillir la condensation.
  2. Vortex les billes magnétiques pour disperser uniformément, puis ajouter 20 μL de magnétique perles à chaque amplicon PCR, pipette alors la totalité du volume et descendre lentement 10 fois pour mélanger.
  3. Incuber 5 min à RT.
  4. Plaque PCR place sur un support magnétique pendant 2 min jusqu'à ce que les billes magnétiques sont recueillis et le surnageant est clair. Retirer et jeter le surnageant.
  5. Perles de lavage avec 200 μL frais l’éthanol 80 % tandis que la plaque PCR est sur le magnétique stand et incuber pendant 30 s à température ambiante sur le support magnétique. Retirer délicatement le surnageant.
  6. Répéter le lavage pour une deuxième fois.
  7. Après le deuxième lavage, utilisez une fine de la pipette pour enlever tout l’éthanol résiduel provenant des puits et de permettre à l’air de séchage pendant 10 min.
  8. Retirer la plaque PCR du support magnétique et ajouter 52,5 μL de 10 mM Tris pH 8,5 à chaque puits. Pipetter vers le haut et le bas de 10 fois de suspendre les perles et incuber à température ambiante pendant 2 min.
  9. Transférer la plaque PCR sur le support magnétique pour recueillir des billes magnétiques et transférer 50 μL de surnageant dans une assiette propre de la PCR. Posez un joint de la plaque PCR transparent adhésif sur la plaque et conserver à-20 ° c pendant une semaine.
  10. (Facultatif) Exécuter les indexer des produits PCR sur gel d’agarose ou un essai d’ADN de haute sensibilité qui permet une mesure quantitative de la taille de l’amplicon (voir Table des matières).
    Remarque : La bibliothèque indexé final de cette étude comptait 668 bp (Figure 3-C-D).

11. quantifier, normaliser et mettre en commun les bibliothèques indexés pour le séquençage

  1. Déterminer la concentration d’ADN de chaque échantillon avec un fluorimètre et un kit d’immunofluorescence dsDNA (voir Table des matières).
    1. Préparer une dilution de 1 : 200 de l’échantillon (1 µL de chaque échantillon dans 199 µL dsDNA master mix, qui inclut la mémoire tampon et réactif) pour chacun des échantillons indexées et normes (190 µL dsDNA master mix et 10 µL de la norme). Analyser un fluorimètre au réglage de l’ADN double brin.
  2. Après le calcul de concentration de l’ADN, normaliser les bibliothèques en calculant la taille moyenne de bibliothèque. Cela en additionnant les longueurs de l’adaptateur, indice longueurs et taille amplicon V apprêts et consulter les produits en gel d’agarose pour être certain que la taille réelle est comparable à la taille calculée (voir laFigure 3C, 22).
    1. Vous pouvez également utiliser un test d’ADN de haute sensibilité qui permet une mesure quantitative de l’ADN l’intégrité, la taille de l’amplicon et concentration (Table des matières, Figure 3D).
      Remarque : Dans cette étude, la taille de la bibliothèque moyenne a été calculée en additionnant les longueurs de l’adaptateur, indice longueurs et V1-V3 amplicon taille d’amorces. La taille moyenne était 668 bp.
    2. Les concentrations d’échantillons sont normalisées à l’aide de la formule dans le tableau 8.
  3. Diluer les échantillons à 4 nM et poule 5 μL de chaque échantillon de 4 nM dans un seul tube pour l’ordonnancement.

12. la bibliothèque à l’aide d’un système de séquençage nouvelle génération de séquence et d’analyser les données

  1. Séquence de la bibliothèque.
    Remarque : Pour cette étude, l’Université de l’Utah High Throughput génomique Core effectuée dénaturation de la bibliothèque et le séquençage de l’échantillon (comme décrit dans 6,22).
  2. Analyser les données.
    Remarque : Pour séparer les données des échantillons groupés, indice lectures ont été identifiés et séparés (comme décrit dans le 22).
  3. Générer des fichiers FASTQ et utiliser cela pour une analyse ultérieure des données.

13. analyser les données en séquence de la bibliothèque d’Amplicon 16 s

Remarque : Cette étape est effectuée comme décrit dans Bice et al., 20176.

  1. Installer les outils d’analyse de données librement accessibles (voir Table des matières; 24).
  2. Assemblez des fichiers de démultiplexage fastq d’après les données séquencées (comme décrit dans25,26). Jeter toutes les séquences non montées.
  3. Effectuer des analyses après une de novo ouvert unité taxonomique (UTO) cueillette protocole (tel que décrit dans 27).
    1. Bin les séquences dans un fichier unique fastq par sampleID et des séquences de groupe avec 97 % ou une plus grande similitude dans OTUs, comme décrit dans le 28. Aligner les séquences représentant de cœur serti de longueur de la séquence minimale de 150 et 75 % pour cent identité29,30. Assignez taxonomie comme décrit28.
      Remarque : Les échantillons peuvent être mis en cellule et analysé31, suivie d’attribution taxonomique et OTU tableau construction32.
    2. Créer un fichier de mappage qui identifie les noms descriptifs et les caractéristiques des échantillons pour relier à l’identification des échantillons et de valider la cartographie fichier33,34.
    3. Faire un réseau OTU OTUs aux descriptions d’échantillon à l’aide d’un fichier de mappage35.
    4. Calculer les résumés de taxonomie en termes d’abondance relative en résumant les taxons par parcelles36.
    5. Explorez la diversité alpha des échantillons à profondeur uniforme de séquençage approprié d’échantillons. Pour définir la profondeur appropriée pour la diversité alpha, résumer les comptages totaux observées dans chaque échantillon en utilisant la commande résumer-table de biome, comme décrit dans 37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Plusieurs études ont démontré que la pratique de la médecine esprit-corps améliore les résultats de santé. De même, chez la souris, enrichissement environnemental améliore les résultats, y compris la durée de vie améliorée et tumeur plaie réparation6. Par conséquent, une procédure EE a été développée dans le but de définir le rôle du microbiote dans ce phénotype en premier normalisant le microbiome avant le début de l’expérience (Figure 1). Ce qui est important, tous les animaux d’élevage sont intégrés dans la colonie de souris au moins un mois avant le début de l’élevage, et nouveau-nés sont conjointement logés avec les mères dans une grande cage pour normaliser le microbiote transmission avant l’expérience. Lorsque les animaux sont entre 21 et 28 jours, un nombre égal de chaque génotype est sevré dans leur logement respectif, EE ou environnements NE (Figure 2A). À 16 semaines, selles de tous les animaux sont recueillis et homogénéisé (Figure 2B), suivie par l’isolement de l’ADN bactérien. Enfin, 16 s amplicons sont amplifiés de tabouret microbiome ADN et code à barres indexé pour permettre de SEQUENÇAGE de toutes les bibliothèques de microbiome simultanément (Figure 3). Les séquences uniques identifiés dans WT et tumeur portant des animaux dans des conditions NE et de EE sont indiquées à la Figure 4. Fait intéressant, EE n’améliore pas la biodiversité des animaux WT, mais augmente considérablement la biodiversité des animaux porteurs de tumeurs (Figure 4), ce qui démontre que cette méthode permet d’améliorer la biodiversité. Cette augmentation de la biodiversité peut être attribuée à la présence accrue du phylum des Proteobacteria, avec importante augmente dans les classes Alphaproteobacteria et Betaproteobacteria et diminue en pathogène Gammaproteobacteria (Figure 5 ; La Table 1). La hausse la plus importante est dans le Betaproteobacteria classe est le genre Sutterella, un commensal probablement impliqués dans la dégradation de l’IgA sécrétée (Figure 6, aussi voir38).

Figure 1
Figure 1 : Une représentation du montage expérimental. Les bandes courtes représentent 7 jours windows, comme la plupart du Protocole s’effectue par incréments de 7 jours. Cela contribue également à la visualisation de la gamme d’âges de chiot dans l’ensemble de l’expérience. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : EE et NE logement conditions et homogénats de selles (comme décrit dans le protocole). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Préparation de bibliothèque pour le Microbiome 16 s. (A) PCR non-purifiés amplicon produits dérivés de l’ADN génomique de selles. ()B) graphique plaque d’indexation conçu selon le logiciel utilisé (Table des matières, 23). Les combinaisons de double index, I7 (indice 1 ; Rangée) et I5 (Index 2 ; Voir colonne) sont indiqués pour chaque échantillon. Chaque index est 8 bp en longueur. Le nombre d’échantillon reportez-vous aux numéros respectifs souris provenant d’études EE. (C) des produits PCR non-purifiés de Index. (D) analyse de la qualité de la final, purifié et mis en commun de 16 bibliothèques. (A, C, D) Flèches noires correspondent aux 550 bp amplicon et 668 bp bibliothèque indexée. Flèches rouges désignent des produits non spécifiques qui sont éliminés après purification, comme le montre D. Supérieur et inférieurs marqueurs sont ajoutés à l’échantillon de référence de la taille des marqueurs de taille. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : Changements dans la diversité alpha après EE de Tcf4Het / + ApcMin / + animaux. La diversité alpha de WT et Tcf4Het / + ApcMin / + tumeur portant des animaux. À 20 000 lectures, NE et EE de WT, p= 0,64 et NE et EE de Tcf4Het / + ApcMin / +, p= 0,03 à l’aide de t-test à deux échantillons avec correction de Welch. Adapté du Bice et al., 20176. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : Changements EE EE de la suite Tcf4Het / + ApcMin / + animaux. R-ggplot2 généré rectangle moustaches parcelles qui dénote des changements dans l’abondance du phylum des protéobactéries et classes Alphaproteobacteria, Betaproteobacteria et Gammaproteobacteria. Les observations aberrantes sont notés comme des cercles. p= 0,005 à l’aide de tests t deux échantillons avec correction de Welch. Barres d’erreur calculées à l’aide d’écart-type de la moyenne (SEM). Adapté du Bice et al., 20176. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 6
Figure 6 : Les changements dans l’abondance relative des Sutterella suite EE de Tcf4Het / + ApcMin / + animaux. Les observations aberrantes sont notés comme des cercles. p= 0,005 à l’aide de t-test à deux échantillons avec correction de Welch. Barres d’erreur calculées à l’aide de SEM. adapté de Bice et al., 20176. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Supplemental Table 1
Supplémentaire tableau 1 : Classification des bactéries isolées des selles recueillies chez des souris NE et EE. Classement entre les génotypes au niveau Phylum (A), classe (B), (C) ordre, famille (D) et (E) genre. Comparaisons de la NE et EE du même génotype ou WT à Tcf4Het / + ApcMin / +. P-valeurs sont calculées à l’aide d’un t-test à deux échantillons avec correction de Welch. Adapté du Bice et al., 20176. S’il vous plaît cliquez ici pour télécharger ce fichier.

Ordre du jour Superficie totale (pouce2) Superficie totale (cm2) Cage taille (po) L x l x H Cage taille (cm) L x l x H
Un seul contrôle Cage (NE) 68,25 440.32 10,5 x 6,5 x 5,5 26,67 x 16,51 x 13.97
Une grande Cage (EE) 264.36 1706.32 13,87 x 19.06 x 7,75 35,24 x 48,42 x 19.69
Deux grandes Cages (EE) 528.72 3412.64 2 @ 13.87 x 19.06 x 7,75 2 @ 35,24 x 48,42 x 19.69
Deux plates-formes (EE) 93 600 2 @ 11,8 x 3,94 x 2,95 2 @ 30 x 10 x 7,5
Deux grandes Cages avec deux plates-formes (EE) 621.72 4013 2 @ 13.87 x 19.06 x 7.75 + 2 @ 11,8 x 3,94 x 2,95 2 @ 35,24 x 48,42 x 19.69 + 2 @ 30 x 10 x 7,5

Tableau 1 : EE et Cage NE taille et surface au sol.

Animaux admis en Cage Nécessaires pouces carrés par Animal Zone de Cage EE (pouces2) Total animaux admis
Jusqu'à 25 12 622 dans2 (4013 cm2) jusqu'à 25
25 + 15 622 dans2 (4013 cm2) jusqu'à 41
Femelle avec litière 51 622 dans2 (4013 cm2) jusqu'à 12

Tableau 2 : permis nombre d’animaux dans des Cages selon l’espace de plancher 15 .

Amorces de PCR de l’amplicon
Vers l’avant 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3 '
Marche arrière 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 '
Des séquences spécifiques de locus sont indiquées en caractères gras et le non gras est la séquence d’adaptateur de surplomb.

Tableau 3: des amorces de PCR de l’Amplicon.

Réaction de PCR Amplicon mises en place
Volume
ADN microbien (5ng/μl) 2,5 μl
Primer en avant (1 μM ; d’après l’étape 5.1.2) 5.0 μl
Inverser l’apprêt (1 μM ; d’après l’étape 5.1.2) 5.0 μl
2 x HotStart Ready Mix 12,5 μl
Total 25,0 μl

Tableau 4: Mix Amplicon PCR.

Amplicon PCR mis en place
95 ° C pendant 3 minutes
25 cycles de :
95 ° C pendant 30 secondes
55 ° C pendant 30 secondes
72 ° C pendant 60 secondes
72 ° C pendant 3 minutes
Tenir à 4 ° C

Tableau 5 : Amplicon PCR programme mis en place.

Ensemble de codes à barres de PCR de l’index
ADN 2,5 μl
Amorce d’index 1 (N7XX) 2,5 μl
Primer d’indice 2 (S5XX) 2,5 μl
2 x HotStart Ready Mix 12,5 μl
Eau de qualité PCR 5 μl
Total 25 μl

Tableau 6: Index PCR Mix.

Installation PCR index
95 ° C pendant 3 minutes
8 cycles de :
95 ° C pendant 30 secondes
55 ° C pendant 30 secondes
72 ° C pendant 30 secondes
72 ° C pendant 5 minutes
Tenir à 4 ° C
Conserver à-20 ° C

Tableau 7: programme PCR Index Set up.

Exemple de formule Concentration pour la mise en commun
(Concentration d’ADN dans le ng/μl) x 106 = Concentration en nM
(660 g/mol x taille moyenne bibliothèque)
Un exemple de cette étude est :
(85.2 ng/μl) x 10 ^ 6 = 193,3 nM
(660 g / mol x 668 bp)

Tableau 8: formule pour normaliser avant la mise en commun des échantillons

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Cette procédure permet l’analyse du microbiote isolé dans les selles après enrichissement environnemental normal ou tumeur portant des animaux. Parce que ce sont de grandes expériences qui impliquent des reproducteurs afin d’obtenir de nombreux animaux de sexe différent et de génotypes, normalisant le microbiome entre animaux avant le début de l’expérience est essentielle pour éviter d’autres effets sur le microbiome liés biodiversité.

Par souci de cohérence entre les conditions NE et EE, du processus de sélection est effectué afin que toutes les souris ont au départ une exposition à des microbes mêmes et, par conséquent, sont censés sont semblables sur le microbiome. Il est possible, et sans doute, que le génotype souris affecte microbiome composition. Pour cette raison, nombre de souris par génotype est maintenues entre NE et EE conditions requises pour être certain que tout animal qui consomme selles rencontrera une diversité semblable du microbiome.

Plusieurs difficultés apparaissent lorsque les expériences de conception d’EE. Tout d’abord, le nombre total d’animaux nécessaires pour les expériences dépend des détails expérimentaux, mais le nombre total est également limité par le nombre d’animaux admis dans la cage. Par exemple, survie de souris environnant les données historiques dans une expérience préliminaire de EE ont servi à calculer le nombre d’animaux pour définir le mécanisme sous-jacent amélioration de la survie observée dans des expériences antérieures. D’après les résultats, un total de 17 animaux du groupe témoin ont été nécessaires pour une puissance de 80 % détecter une différence de survie dans un t-test recto verso où alpha = 0,05. Donc, 4-5 animaux du groupe témoin vs 20-24 (ou jusqu'à 41) animaux par cage dans le groupe expérimental doit accueillir un calcul de puissance. Par conséquent, plusieurs cages de groupe de contrôle sont nécessaires ainsi que la cage expérimentale. En outre, avec des génotypes complexes, c’est difficile d’obtenir le nombre suffisant d’animaux chaque génotype, ce qui nécessite un grand nombre de femelles reproductrices nécessaires. Cependant, avec d’autres modèles où se trouvent des différences moins transgéniques, plus d’animaux de même génotype peuvent être analysés dans ce système et moins éleveurs sont nécessaires. Aux États-Unis, 12 femmes enceintes peuvent être logées dans le 6332 d’espace (tableau 2). Le problème avec ceci est que mesure chiots vieillissent, ils prennent plus de place. Étant donné que les petits mâles sont séparés des femelles chiots à 14 à 21 jours, une exception approuvée à la règle de l’espace dans certains pays pourrait être réalisable. Dans le cas contraire, mâles et femelles peut être génotypées sélectionné et puis séparés à un plus jeune âge avec les mères de rester en dessous du nombre maximal de souris. Il est essentiel d’obtenir l’approbation pour ces études et d’adhérer aux règles locales sur les restrictions de l’espace. Enfin, avec le microbiote, le nombre d’animaux nécessaires pour détecter même de petites différences dans la composition de la microflore est difficile de calculer a priori. Alors que dans cette étude, des différences significatives dans la microflore trouvées avec 4 animaux par groupe, il est possible que l’augmentation de ce nombre d’animaux révélerait microbiote qui sont plus variables entre souris EE ou sont seulement légèrement altérées par EE.

Cet article de méthode décrit les propres équipements et Articles de literie qui sont utilisés, qui sur la surface peut ne pas apparaître essentiel. Cependant, plusieurs questions non évidente qui affectent la consistance peuvent être rencontrées et doivent être abordées avant de se lancer dans ces très grandes, cher et des études longues. Un problème majeur est la ventilation de la cage. Avec un grand nombre d’animaux dans une cage, ventilation devient un problème et est une question que la plupart des chercheurs ne prennent pas en compte lorsque vous tentez d’offrent un environnement cohérent entre contrôle et cages expérimentales. Toutes les cages dans la configuration décrite sont placés dans une armoire ventilée pour égaliser la ventilation entre l’expérimental et contrôler des cages. Cela ne peut être accompli lorsqu’à l’aide de cages qui ne rentre ne pas dans une armoire ventilée. Autres moyens de normaliser la ventilation entre expérimental et de contrôler animaux puisse être testées et appliquées uniformément, mais ces méthodes ne sont pas abordés dans cette étude. Les problèmes de cohérence semblables se posent avec literie. Dans le système de modèle du cancer du côlon utilisé dans cette étude, les animaux qui ont des maladies digestives seront ingérer certains types de literie, surtout les épi de maïs literie, entraînant des blocages digestifs et les maladies. Il est important de garder cela à l’esprit si on sait que les animaux ingèrent literie quand non occupé, comme dans l’environnement de contrôle. Ce phénomène et les effets ultérieurs de santé incompatible affectera profondément toutes les données.

Le gène ribosomal 16 s a servi comme un moyen d’étudier les populations bactériennes. Elle contient neuf régions qui expriment la variabilité génétique, V1-V9 et entrecoupées de régions conservées qui restent relativement inchangées entre espèces bactériennes39. La région de V1-V3, en particulier, donne la probabilité la plus élevée de l’identification de l’espèce-niveau39. V1-V3 semblables études sur le Cancer Colorectal (CRC) et adénome Colorectal avancé trouvés changements à trois embranchements d’intérêt : Bacteroidetes et Firmicutes Proteobacteria21,40,41. Il a également été signalé que l’exercice peut déplacer la population microbienne et conduire à une augmentation des Firmicutes42. Pour cette raison, cette étude a identifié microbiome populations en utilisant les amorces V1-V3 après un 16 s métagénomique bibliothèque prép protocole22 à définir éventuellement les effets de l’enrichissement environnemental sur ces embranchements connus pour être modifié dans l’adénome et CRC. Cette procédure peut être modifiée pour amplifier et autres régions variables des gènes ARNr 16 s de la séquence. Une façon consiste à utiliser la sonde Match pour comprendre la classification phylogénétique des micro-organismes présents dans l’échantillon qui sera identifié par la sonde. De cette façon, les sondes peuvent être ciblés pour définir plus précisément et classer phylogénétiquement les microbes d’intérêt. Cela permet une qualification différente de la microflore présente dans les échantillons de selles et peut révéler des altérations liées à EE supplémentaires dans le microbiome de tumeur portant des souris qui peuvent affecter la progression de la maladie.

En utilisant cette procédure, le genre Sutterella a été identifié comme le genre plus altéré EE de tumeur animaux à la suite. Cette procédure peut être adaptée pour tenir compte des études qui utilisent n’importe quelle méthode destinée à analyser les effets d’une perturbation sur la composition de microbiome dans génétiquement modifiés modèles de maladies humaines. Par exemple, à la place de EE, souris pourraient être inoculés avec Sutterella pour définir si l’inoculation Sutterella est suffisante pour augmenter la biodiversité microbienne et enroulé de réparation en 16 semaines tumeur mâle animaux à.

Sans aucun doute, l’aspect unique de ce protocole craint le microbiote avant EE et de normalisation maintenant microbiome diversité dans les études EE. Car microbiome études sont améliorent sans cesse, il est probable que des méthodes plus robustes pour caractériser le microbiome surgiront, et la caractérisation de microbiome dans le présent protocole deviendra obsolète. Par exemple, avec l’étude actuelle, les sondes utilisées pour amplifier l’ARNr 16 s ont partialité, selon les sondes qui sont choisis et ne pas caractériser toutes les bactéries présentes dans le microbiome. Alors que les méthodes utilisées pour recenser et caractériser le microbiome améliorera sans aucun doute, les bases de la conception et l’exécution de EE expérimente alors que compte tenu de la normalisation de la microbiome restera un aspect essentiel des expériences d’EE.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent qu’ils n’ont aucun conflit d’intérêt.

Acknowledgements

Nous remercions B. Dalley, dans le centre de génomique de l’Université de l’Utah pour le séquençage de la bibliothèque et K. Boucher dans le noyau de biostatistique de l’Université de l’Utah pour conseils statistiques et l’accès à ces carottes techniques pris en charge par le prix de l’Institut National du Cancer P30 CA042014. Le projet décrit a été appuyé par le National Cancer Institute subventions P01 CA073992 et K01 CA128891 et la Fondation du Cancer de Huntsman.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics