마그네틱 활성화 전략을 분리 하 고 정화 활 액 액체 파생 된 중간 엽 줄기 세포는 토끼 모델에서 정렬 셀

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

이 문서 간단 분리와 뉴질랜드 백색 토끼 활 액 액체에서 중간 엽 줄기 세포의 정화에 대 한 간단 하 고 경제적인 프로토콜을 제공합니다.

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

중간 엽 줄기 세포 (MSCs)는 세포 기반 치료에 대 한 주요 셀 소스. 관절 강 활 액 액체에서 MSCs 연골 조직 공학에 잠재적으로 사용할 수 있었습니다. 활 액 액체 (SF-MSCs)에서 MSCs 간주 되었습니다 관절 재생을 위한 유망한 후보자 그리고 그들의 잠재적인 치료 혜택 했다 그들 중요 한 연구 주제를 늦게. 뉴질랜드 백색 토끼의 무릎 구멍에서 SF-MSCs 인간의 재생 의학을 평가 하는 최적화 된 변환 모델로 사용할 수 있습니다. CD90 기반 자석 활성화 된 셀 정렬 (맥) 기술을 통해이 프로토콜 성공적으로 토끼 SF-MSCs (rbSF-MSCs)이 토끼 모델에서 가져오고 더 완벽 하 게 유도 하는 그들을 차별화 하 여 이러한 셀의 MSC 표현 형 보여줍니다. osteoblasts, adipocytes, 그리고 chondrocytes입니다. 따라서,이 방법은 세포 생물학 연구와 간단한 장비 및 절차를 사용 하 여 조직 공학에 적용할 수 있습니다.

Introduction

MSCs 연골 병 변을 위해 특히 재생 의학에 대 한 귀중 한 소스 제안 되어 있다. MSCs, chondrocytes, osteoblasts, adipocytes, 골격 myocytes 및 내장 stromal 세포를 포함 하 여 광범위 하 게 그들의 높은 확장 속도 멀티 혈통 차별화 잠재적인1인해 줄기 세포 이식에 대 한 영역을 확장 합니다. MSCs는 골격 근육, 막, 골 수 및 지방 조직2,,34에서 격리 될 수 있습니다. 결과 또한 confirmed 활 액 액체에서 MSCs의 존재 그리고 이전 연구는 관절 재생5,6유망한 후보자로 활 액 액체 파생 MSCs (SF-MSCs)를 발견 했다.

그러나, 연구와 임상 실험 인간의 샘플에 많은 윤리적 문제에 적용 됩니다. 대신, 토끼 고 가장 일반적으로 사용 되는 동물 종 MSCs의 이식 연골 손상을 복구할 수 있습니다 설명 하기 위해 계속. 최근 몇 년 동안, 연구원의 증가 수는 토끼 중간 엽 줄기 세포 (rbMSCs) 모두 공부 생체 외에서 그리고 vivo에서이 세포는 그들의 세포질 생물학 및 조직 생리학에서 인간의 비슷합니다 MSCs. 마찬가지로, rbMSCs는 인간의 MSCs에서 스핀 들 섬유 형태를 표시 하는 플라스틱 표면에 고착 할 수 있다. 또한, 토끼 중간 엽 샘플 간단 하 고 쉽게7을 얻을 수 있다. 또한, 가장 중요 한 포인트는 rbMSCs CD44, CD90, CD105, 등 표면 마커를 표현 하 고 기준으로 MSC 인구의 식별에 대 한 동의 잠재적인 다중 계보 차별화 유지 되는 세포 치료8,9에 대 한 국제 사회에 의해 정의. 특히, synovial 유체 chondroprogenitors 때 TGF-β1, 따라서 그들 phenotypically 관절 연골 재생10,11, 적당 한 셀 소스 만들기에 의해 유도 된 비 hypertrophic chondrogenesis 할 수 있다 12.

그러나, SF MSCs의 절연 탯, 지방 조직, 말 초 혈액 및 골 수를 포함 하 여 다른 조직에서 크게 다르다. 현재, 비록 흐름 cytometry 방법을 사용 하려면 특정 환경 및 매우 비싼 악기13cytometry 및 immunomagnetic 구슬 기반 정렬 정화 및 SF-MSCs의 정렬에 대 한 가장 일반적인 방식입니다.

이 문서는 흰 토끼 뉴질랜드에서 활 액 액체 샘플의 간단 하 고 최소한 침략 적 컬렉션에 대 한 절차를 제공합니다. 절차 동안, rbSF-MSCs 안정적으로 확장 된 생체 외에서 그리고 CD90 긍정적인 자기 비드 기반 절차와 격리. 마지막으로, 프로토콜에는 높은 순도와 수확된 셀 소스에서 생존 MSCs를 구하는 방법을 보여 줍니다.

이 프로토콜에서 격리 rbSF-MSCs는 그들의 형태학, 특정 마커 및 pluripotency 줄기 세포에 대 한 표현에 따라 특징 이다. CD45와 CD34의 표현 부정적인 반면 교류 cytometry 기반 immunophenotyping CD44 및 CD105의 중요 한 긍정적인 표현을 보여준다. 마지막으로, 분석 결과 생체 외에서 rbSF-MSCs에 대 한이 셀의 osteogenic, adipogenic, 및 chondrogenic 분화를 보여 줍니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

모든 동물 실험 지역 윤리 위원회 지침에 따라 실시 했다 그리고 모든 동물성 절차 기관 동물 관리 및 사용 위원회의 심천 제 2 인민 병원, 심천 대학으로 승인 했다.

1. 격리와 rbSF-MSCs 문화

  1. 동물 절차에 대 한 준비
    1. RbSF의 컬렉션에 대 한 skeletally 성숙 여성 뉴질랜드 백색 토끼를 준비-MSCs. 마 취와 arthrocentesis 절차 전에 어느 날 토끼의 임상 시험 수행.
      참고: 검 무게 (2.0-2.5 k g), 성별 (여성), 고 체온, 호흡 속도 심장 박동을 포함 해야 합니다. 임상적으로 건강 한 토끼에 대 한 매개 변수 간격 있으며 호흡 속도 대 한 30-50 분, 심장 박동에 대 한 220-280 분 38-39 ° C 온도 대 한.
    2. 동물 마 취 전에 6 h에 대 한 빠른.
  2. 준비 및 동물 마 취에 대 한 절차
    1. 감 금 소를 가진 토끼를 억제 ( 재료의 표참조), 다음 3 %pentobarbital 나트륨 전신 마 취에 대 한 1 mL/kg의 복용량에 한계 귀 정 맥에 주사 하 고.
    2. 토끼 편안한 휴식 등 쪽 위치에 놓습니다.
    3. 마 취 동안 토끼의 체온, 심장 박동, 호흡 속도 모니터링 합니다.
    4. 그것의 눈에 안과 연 고를 사용 하 여 마 취 동안 건조를 방지 하기 위해.
    5. Guedel의 분류14다음 마 취의 깊이 평가 합니다.
  3. MSCs 절연 및 재배에 대 한 준비
    1. RbSF-MSCs를 육성, 상업 문화 매체의 500 mL 준비 보충 ( 재료의 표참조) 10% 상업 보충 ( 재료의 표참조), 10% 태아 둔감 한 혈 청 (FBS), 그리고 1% 페니실린-스.
    2. 물 욕조에 37 ° C에서 배양을 품 어.
    3. 세포 분리 및 세포 세척에 대 한 인산 염 버퍼 식 염 수 (PBS)의 500 mL를 준비 합니다.
    4. 무릎 구멍 arthrocentesis 절차에 대 한 100 mL isotonic 식 염 수 솔루션의 준비.
  4. 토끼의 무릎에서 관절 활 액 흐름이 uid의 컬렉션
    1. 크기는 무릎 주위에 지역 약 5 x 5 cm를 선택 하 고 안전 전기 면도기를 사용 하 여이 영역에서 토끼 머리를 면도.
    2. 또는 소독 절차 사이트 3 povidone 요오드 솔루션 및 75% 에탄올 x. 영역은 완전히 말린 후, 무 균 커튼 적용.
    3. 3-4 x, isotonic 식 염 수 솔루션을 사용 하 여 살 균 피하 주사기 (2 mL), 측면 관절 공간에서 무릎 관절 구멍으로 무릎을 이동 1-2 mL를 주사 하 고 실 온에서 모든 활 액 액체를 빨 아.
    4. 4 h 이내 어떤 파편 든 지 제거 하 40 µ m 나일론 셀 스 트레이너를 통해 synovial fluid를 필터링 합니다.
  5. RbSF-MSCs의 문화
    1. 50 mL 원심 분리기 튜브에 실 온에서 10 분 원심 1500 rpm에서 필터링 된 fluid를 수집 합니다.
    2. 원심 분리 후에 상쾌한 삭제, PBS 가진 펠 릿을 세척, 완전 한 문화 매체와 펠 릿 resuspend 그리고 접시 100mm 요리에서 매체.
    3. 37 ° c 5% CO2를 포함 하는 습도 분위기에서 요리를 품 어.
    4. 48 h 후 어떤 비 부착 한 세포를 제거 하는 신선한 매체와 요리를 보충. 대체 매체 통로 0 (P0)으로 2 주 동안 일주일에 두 번.
      참고: 약 1 × 104 부착 셀을 하 고 있어야 합니다. SF에서 가능한 셀/ml은 약 2 × 102/mL.
    5. 14 일 후 초기 도금 따르고, 많은 식민지 문화 요리에서 형성 해야한다. 직경에서 2 m m 보다 큰 식민지를 선택 합니다. 선택 된 식민지 접시 바닥에 그들의 둘레를 추적 하 여 위치를 표시 합니다.
    6. 식민지 < 2 폭 mm, 세포 스 크레이 퍼를 사용 하 여 삭제 합니다. 복제 실린더를 사용 하 여 0.25 %trypsin 약 5 µ L로 선택 된 식민지를 소화 하 고 통과 1 (P1)로 새로운 접시에 식민지를 전송.
  6. 수술 동물 치료
    1. 수술 후 모니터링 및 마 취에서 회복 기관 표준 운영 절차를 따르십시오.
    2. 의식 회복 될 때까지 10 분 마다 토끼의 생체 신호를 모니터링 합니다. 마지막으로, 의식 동물 케이지 전송. 그것은 완전히 복구 될 때까지 다른 동물의 회사를 수술을 겪고 있다 토끼를 반환 하지 않습니다.
    3. 후 작업, 0.1 %povidone 요오드, 2 3 일 동안 하루 x 사이트를 소독.

2. CD90 긍정적인 자기 활성화 셀 정렬 (맥) rbSF-MSCs 및 주 문화

  1. 샘플 준비
    1. 80 %confluency, 매체, 발음 한 다음 0.25%의 1-2 mL을 추가 셀 주위에 도달 하는 때 각 요리에 트립 신-EDTA.
    2. 셀 분리 수 있도록 2-3 분 요리를 품 어.
    3. 세포 분리는 일단 비활성화는 트립 신 문화 매체의 동일한 금액을 추가 합니다.
    4. 40 µ m 셀 스 트레이너를 통해 세포 현 탁 액을 통과, 15 mL 튜브에 여과 액을 수집 하 고 실 온에서 10 분 600 × g에서 셀 아래로 회전.
    5. 버퍼를 실행 하는 맥에서 셀 펠 릿 resuspend (PBS, pH 7.2, 0.5% 소 혈 청 알 부 민와 2 mM EDTA) 및 셀 수를 계산 하는 다음.
  2. 마그네틱 라벨
    참고: 자기 활성화 셀 정렬 열, 서, 및 구분 기호 ( 자료의 표참조)를 포함 하는 키트 rbSF-MSCs를 정렬 합니다.
    1. hemocytometer를 사용 하 여 셀 수를 결정 합니다.
    2. 4 ° c.에서 10 분 동안 300 × g에서 세포 현 탁 액을 원심 완전히는 상쾌한 발음.
    3. 107 총 셀 당 물의 resuspension 버퍼의 80 µ L를 추가 합니다.
    4. 107 총 셀에 대 한 단일 클로 널 항 토끼 CD90 항 체로 활용 하는 microbeads의 20 µ L를 추가 합니다.
    5. 어둠 속에서 15 분 동안 4 ° C에서 그들을 품 어 다음 자석 구슬 및 셀 튜브에 균등 하 게 섞는다.
    6. 튜브, 107 셀 당 버퍼의 1 mL을 추가 하 고 셀을 씻어 4 ° C에서 10 분 동안 300 × g에서 원심. 원심 분리 후에 상쾌한 폐기.
    7. 107 셀 당 버퍼의 500 µ L에 펠 릿을 resuspend.
  3. 자력 분리
    1. 장소는 열 열 자석 분리기의 자기장으로 앞에 날개.
    2. 107 셀 당 버퍼의 500 µ L 자석 분리기 (MS) 열을 씻어.
    3. 열에 단일 세포 현 탁 액을 전송 합니다. 이러한 레이블이 셀을 삭제 하는 자기장을 통과 하는 부정적인 세포를 하자.
    4. 107 셀 당 열 버퍼의 500 µ L 1-2 x를 세척 하 고 흐름을 통해 삭제.
    5. 원심 분리기 튜브 (15 mL)에 열을 전송 합니다.
    6. 107 셀 당 버퍼의 1 mL는 열을 추가 하 고 즉시에 자석으로 레이블이 지정 된 셀에 밖으로 플러시 열에 플런저를 밀어.
    7. CD90의 순도 높이기 위해 두 번째 MS 열 상기 절차 반복+ 세포, eluted 분수의 질을 높일 수 있습니다.
    8. 10 분 동안 300 × g에서 세포 현 탁 액을 원심, 상쾌한, 발음 그리고 문화 매체와 resuspend.
  4. 문화는 CD90의+ rbSF-MSCs
    1. 마그네틱 활성화 된 세포 분류 후 100 mm 접시에 셀을 예방.
    2. 5% CO2습도 셀 인큐베이터에서 37 ° C에서 요리를 품 어.
    3. 주 문화의 합류 점 80-90% 달성, 약 7-10 일 때 0.25% Trypsin EDTA와 통로와 부착 세포 소화 통로 2 (P2)을 1:2 희석에 그들.
    4. 통과 셀 통로 3 (P3), 체 외에서 분석 실험을 위해 사용 될 수 있는 동일한 메서드를 사용 합니다.
      참고: 하위 문화 정화 후 약 1 x 107 rbSF-MSCs 얻을 수 있습니다.

3입니다. rbSF-MSCs의 식별

  1. Cytometry에 의해 rbSF MSCs의 표면 표식 확인
    1. MSCs P3에 80-90% 합칠 때, PBS로 세포 세척 하 고 0.25%의 1 mL와 함께 그들을 치료 트립 신-EDTA. 그런 다음 셀 분리 될 때까지 2-3 분 동안 37 ° C에서 MSCs 품 어.
    2. PBS의 10 mL를 사용 하 여 셀을 수확, 원뿔 튜브 (15 mL)에 그들을 전송 하 고 실 온에서 5 분 동안 300 × g에서 원심.
    3. supernatants 삭제 합니다. PBS의 500 µ L에서 셀 펠 릿을 resuspend 하 고 1.5 mL 튜브에 그것을 전송.
    4. FITC 활용 및 PE 활용 된 항 체의 (isotype, FITC CD34/PE CD45, FITC CD105/PE CD44) 4 ° c.에 어둠 속에서 1 시간에 1: 100 희석을 품 어
    5. 실 온에서 5 분 동안 300 × g에이 혼합물을 원심 고 PBS로 두 번 셀 때마다 5 분 300 × g에서 원심 분리 하 여 세척. supernatants 삭제 합니다.
    6. PBS의 500 µ L에 셀 resuspend, 라운드-하단 튜브 (5 mL)에 세포 현 탁 액 전송 및 교류 cytometer를 사용 하 여 분석.
      참고: 두 개의 형광 채널을 갖춘 cytometer에서 데이터 수집: 533/30 고 585/40. 각 isotype 형광에 isotype 컨트롤을 사용 하 여 적절 한 레이저 전압을 조정 하 고 피크의 왼쪽 및 오른쪽 가장자리를 표시 하는 형광 막대 그래프를 얻을 하는 데 필요한 최소 강도 설정 합니다. 통계 분석에 대 한 10000 이벤트의 최소를 수집 합니다.
  2. RbSF-MSCs의 multidifferentiation
    참고: 사용 P3 rbSF-MSCs는 생체 외에서 multidifferentiation 분석 실험에 대 한.
    1. Osteogenic 차별화
      1. Osteogenic 유도 매체 준비: DMEM basic (1x) L-아 스 코르 빈 산-2-인산 염, α-glycerophosphate의 10 m m 100의 50mm 포함 dexamethasone의 nM.
      2. 6 잘 조직 문화 접시에 103 셀/c m2 에서 셀 씨 고 osteogenic 유도 매체에 문화.
      3. 3 주 동안 3 일 마다 유도 매체를 변경 합니다.
      4. 분화가 완료 된 후 실 온에서 30 분 동안 4% 포름알데히드와 셀을 수정, 셀 얼룩 5 분, 그리고 다음 세척 그들 3에 대 한 1% 알리자린 레드 PBS15x.
    2. Adipogenic 차별화
      1. Adipogenic 유도 매체 준비: DMEM basic (1 x) indomethacin의 100 m m, 재조합 인간 인슐린의 10 mg/mL, dexamethasone의 1 m m와 0.5 m m 3-isobutyl-1-methylxanthine의 구성 된.
      2. Adipogenic 유도 매체에 3 주 동안 P3 rbSF-MSCs를 취급 합니다.
      3. 3 주 후, 기름 빨간 O를 사용 하 여 adipogenic 차별화를 확인 하는 중립 지질 그들을 얼룩. 실 온에서 30 분 동안 4% 포름알데히드 용액에 셀을 수정 하 고 그들을 씻어 다음 PBS163 배.
    3. Chondrogenic 차별화
      1. Chondrogenic 유도 매체 준비: DMEM basic (1 x)으로 구성 된 TGFβ1, 1%의 10 ng/mL의 그것의 보충, L-프롤린, 100 nM dexamethasone의, 나트륨 pyruvate의 L-아 스 코르 빈 산-2-인산 염, 및 1 m m의 50mm의 0.35 m m.
      2. 펠 릿 chondrogenic 유도 배양을 사용 합니다. 5 × 105 P3 rbSF-MSCs는 펠 릿을 형성 하는 폴 리 프로필 렌 튜브 (15 mL)에서 10 분 1500 rpm에서 원심
      3. Chondrogenic 유도 매체와 3 주 동안 알 약을 문화.
      4. 3 주 동안 3 일 마다 매체를 변경 합니다.
      5. 3 주 유도 후 파라핀으로 셀 펠 릿을 포함, 4 m m 조각으로 섹션 및 0.1%를 사용 하 여 얼룩 톨루이 블루 실내 온도17시 30 분.
  3. 총 RNA 추출 및 정량 실시간 중 합 효소 연쇄 반응 (qRT-PCR) 분석
    1. 분리 상업 RNA 적 출을 사용 하 여 3 주 분화 유도 후 세포의 총 RNA 키트 ( 재료의 표참조).
      1. 문화 접시에 있는 문화 매체를 제거 하 고 격리 시 약의 1 mL를 추가 합니다.
      2. 솔루션은 동 질 때까지 반복 pipetting으로 세포를 lyse. 3 분 동안 실내 온도에 그것을 품 어.
      3. Microcentrifuge 1.5 mL 튜브에 세포 lysate를 전송할.
      4. 클로 프롬의 100 µ L을 추가 하 고 손으로 15 x, 그것을 흔들어 3 분 동안 실내 온도에 혼합물을 품 어.
      5. 4 ° c.에 15 분 동안 12000 × g에서 관을 원심 새로운 1.5 mL microcentrifuge 관으로는 supernatants 전송.
      6. 소 프로 파 놀의 500 µ L을 추가 하 고 실 온에서 10 분 동안 RNA 침전.
      7. 12000 × g에서 원심 분리기는 10 minat 위한 4 ° c. RNA 펠 릿은 튜브의 맨 아래에 표시 되어야 합니다.
      8. 제거는 상쾌한 고 75% 에탄올 500 µ L를 추가 합니다. 짧게 RNA 펠 릿을 세척을 몇 초 동안 튜브를 회전 합니다. 4 ° c.에서 5 분 동안 7500 × g에서 원심
      9. 잔여 에탄올을 제거 합니다.
      10. DEPC 물 10 µ L에서 RNA 펠 릿을 녹이 고 얼음에 튜브를 놓습니다.
    2. 반대로 cDNA DNA 합성으로 총 RNA 녹음 키트 ( 재료의 표참조).
      참고: 얼음에 모두 다음 절차를 수행 합니다.
      1. 반전 녹음 방송 마스터 믹스를 준비 합니다.
      2. RNA의 1 µ g 각 튜브를 DNase 취급 RNA의 25 µ L를 추가 합니다.
      3. PCR 열 cycler를 사용 하 여 다음과 같은 온도에서 혼합물을 품 어: 26 ° C (anneal 하 임의 hexamers 수 있도록) 10 분, 45 분 (반전 녹음 방송)와 75 ° C 10 분 (비활성화는 역전사) 42 ° C.
      4. 즉시 분석 정량 실시간 PCR에 의해 결과 cDNA 또는-20 ° c.에 그것을 저장합니다
    3. 실시간 정량 PCR 시스템과 유전자 표정 분석을 수행 합니다.
      1. QRT-PCR 주인 혼합 사용 ( 재료의 표참조) PCR을 수행 하. GAPDH, Runx2, Agg를 가진 PCR 뇌관은 표 1에 나열 됩니다.
      2. 유전자 발현 2ΔΔCT 메서드를 사용 하 여 계산 합니다.
      3. 표준 통계 소프트웨어를 사용 하 여 통계 분석을 수행 합니다. 독립 표본 t-검정을 사용 하 여 그룹 방법 비교.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

고립, 정화, 및 rbSF-MSCs의 문화:
이 프로토콜 맥을 사용 하 여 rbSF-MSCs, MSC 표면 마커 CD90의 식에 따라 분리. RbSF-MSCs의 고립, 정화, 그리고 특성화 및 생체 외에서 문화 프로토콜의 공정 흐름도 그림 1에 표시 됩니다.

마그네틱 활성화 셀 CD90와 (맥)을 정렬 후 셀 형태:
첫째, 맥, CD90 자석 구슬 가진 immunolabel MSCs에 대 한 원심, 후 resuspend precooled 정렬 버퍼의 80 µ L에 107 셀의 최대 고 CD90 자석 구슬, vortexing와 15 분 동안 4 ° C에 외피 다음의 20 µ L를 추가 합니다. 그 후, 셀 정렬 버퍼의 1 mL을 세척 하 고 정렬 버퍼의 500 µ L에 그들을 resuspend. 자기 정렬를 계속 하기 전에 세척 단계를 반복 합니다. 중요 한이 절차는 그림 2에 표시 됩니다.

정렬 하기 전에 부착 토끼 synovial 유체 세포 인구는 이기종 형태학, 포함 하는 다양 한 세포 유형 및 크기 (그림 3A-C) 표시. 맥, 다음 셀 인구가 동질적인 형태 전시. 셀 수는 하위 문화 (그림 3D-F)로 증가 되었다.

표면 특성의 맥 농축 rbSF-MSCs:
형광 활성화 된 세포 분류 (FACS) rbSF-MSCs의 농축 분석 하 CD90로 맥에 의해 수행 되었다. 맥, 전에 약 40 %MSCs (그림 4CD; 그림 4A,B에 isotype 컨트롤) 세포 인구에 의하여 이루어져 있다. 맥, 다음 풍부한 인구 약 > 99 %MSCs (그림 4E,F) 포함. 조 혈 모 계보 셀 표식 CD34, CD45, 0.318%, 둘 다 거의 표현 되었다 맥, 후는 25.9%에 그들의 초기 식에서 감소. 선택 하기 전에 약 28 %CD90 했다+ (그림 4G) 세포; + , 약 98 %CD90 정화 후 셀 (그림 4 H)를 획득 했다.

Multilineage 차별화 잠재적인 rbSF MSCs의:
와 같은 다양 한 혈통으로 차별화 하는 rbSF-MSCs의 용량 특성 osteogenic, adipogenic, 및 chondrogenic, rbSF-MSCs 맥으로 농축 했다 동시에 교양 특정 차별화 매체에서와 cytokine 컨트롤 역할을 하지 않고 차별화 매체입니다. 리니지 관련 마커 얼룩에 의해 분석 되었다 유도, 완료 될 때 및 RT-PCR. 알리자린 레드 칼슘 화합물의 얼룩 시연 광물 화 된 혹 (그림 5A) osteogenic 유도 조건 3 주 후 rbSF-MSCs에 형성 했다. Adipogenic 유도의 3 주 후 지질이 풍부한 그들의 축적 세포내 기름 빨간 O (그림 5B) 얼룩에 의해 검출 될 수 있습니다. Chondrogenic 유도의 21 일에 대 한 셀 펠 릿은 톨루이 블루 얼룩과 조직학 분석 했다. 셀 (proteoglycan)을 얼룩에 대 한 긍정적인 chondrocyte 같은 세포 (그림 5C)로 간주 되었다. 이 결과 마찬가지로, 잠재적인 차별화의 유전자 발현의 정량 분석은 또한이 세포의 분화 능력 입증. Agg (chondrocyte 표식), 가진 (adipogenic 마커) 및 Runx2의 식 수준 (osteoblast 마커) upregulated 유발된 조건 하에서 했다. 이러한 데이터는 trilineages (그림 5D)에 rbSF-MSCs의 multipotent 차별화 기능을 입증 했다.

Figure 1
그림 1: 고립, 정화, 및 뉴질랜드 백색 토끼의 SF MSCs의 특성화의 전체 회로도. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: CD90 (맥) 정렬을 자석 활성화 된 셀에 대 한 프로토콜. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: 형태는 단층의 경작 하기 전에 rbSF-MSCs와 맥에서 일반 검사 후 현미경을 거꾸로. A-C) 정렬 하기 전에 부착 토끼 synovial 유체 세포 인구는이 표시합니다. 그들은 다양 한 세포 유형 및 크기, 타원형, 긴-스핀 들, 짧은-스핀 들, 방사상 형태학 등 포함. P2와 P6의 주요 형태는 스핀 들 형태학 (A: P2, B: P3, C: P6). D-F) CD90로 맥, 다음 셀 인구가 동질적인 형태 전시. 하위 문화, 셀 숫자 증가 (D: P2, E: P3, F: P6). 눈금 막대 = 100 µ m. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4: rbSF MSC 표면 마커 식별. 교류 cytometry 분석을 사용 하 여, rbSF-MSCs는 내 피 세포 마커 CD34 및 조 혈 세포 마커 CD45 부정 하면서 MSC 마커 CD44 및 CD105에 대 한 긍정적 이다. 맥, 이전이 세포 CD44 및 CD105 양성의 낮은 속도가지고. 그러나, 맥, 후 양성의 비율이 높았다. A, B) 이 최고 두 이미지 isotype 컨트롤 데이터를 표시합니다. C, D) 이러한 결과 전에 맥 rbSF-MSC 인구가 약 40 %MSC 세포의 구성 되어 보여줍니다. E, F) 맥, 후 풍부한 인구 > 99 %MSC 셀을 포함합니다. G, H) 이러한 이미지는 CD90의 흐름 cytometry 분석 표시+ 마커, 전에 (G) (H) 맥 정렬 후. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 5
그림 5: 리니지 전용 마커 얼룩에 의해 분석 및 RT-PCR. A) 알리자린 광물 화 된 혹 3 주 동안 osteogenic 유도에서 형성 하는 것을 보여줍니다 빨간 얼룩. B) adipogenic 유도의 3 주 후 지질이 풍부한 그들의 축적 감지 되 면 세포내 기름 빨간 O 얼룩에 의해. C) chondrogenic 유도의 3 주 동안 셀 펠 릿은 톨루이 블루 얼룩과 조직학 분석 한다. 셀 (proteoglycan)을 얼룩에 대 한 긍정적인 chondrocyte 같은 세포로 간주 되었다. 눈금 막대 = 100 µ m. D) 3 주 동안 배양 후 osteoblast 마커 (Runx2), adipogenic 마커 (가진), 그리고 chondrogenic 마커 (Agg)의 표정은 상대 mRNA 감지. 모든 분석에 대 한 p 값 < 0.01 고려 되었다 통계적으로 큰 차이가 Kruskal-월리스 테스트를 사용 하 여 (으로 표시 된 * *). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

유전자 뇌관 (5'-3')를 전달 반전 뇌관 (5'-3')
Runx2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
AGG GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARΓ2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

표 1: 목록 유전자와 실시간 양이 많은 PCR에 대 한이 연구에 사용 된 뇌관.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

활 액 액체에 MSCs의 존재 휴대에 기초를 둔 치료에 대 한 대안을 제공합니다. 이전 연구 부상 사이트 후 부상 기간5와 긍정적으로 상관 될 수 있습니다 그들의 활 액 액체에 중간 엽 줄기 세포의 높은 금액을 포함 나타났습니다. 활 액 액체에 MSCs 부상18,19후 자연 치유 향상을 위한 조직에 도움이 될 수 있습니다. 문학에서 SF MSCs의 임상 적용 거의 적용 되었습니다 주로 하기 때문에 관절에 SF MSCs의 메커니즘 남아 정의 되지 않은20. 존스. 21 보고는 무릎 관절에 hSF-MSC 숫자는 크게 7-fold 증가 관절염 (OA)의 초기 단계. 그들은 증가 SF MSCs 관절의 생리 적 항상성 유지에 기여할 수 있는 생각.

이상적인 동물 모델 재생 및 변환 약을 이용 하 여 치료제의 개발에 필수적인 도구입니다. 인간, 토끼, 토끼 사이 존재 하는 분명 한 차이가 있지만 광범위 하 게 사용 됩니다 동물 모델로 서 조직 재생7, 따라서 SF MSCs의 우리의 학문을 위한 모형으로 그것을 선택 하 라는 연구에 대 한. 이 노력에 더 어려운 장애물 중 하나은 종종 SF MSCs의 절연 다양 한 성공 속도와 낮은 식민지 주파수 결과 이전 연구5보고입니다. 따라서 수많은 연구자 성공률 및 SF에서 MSCs의 절연의 최적화에 집중 했다.

정렬 순도 CD90의 생존 능력에 대 한 맥 절차를 사용 하는이 studyeffectively+ MACSs 토끼 synovial 유체22에서. 이 맥 시스템 자석 microbeads이 경우에 특정 세포 표면 항 원, CD90에 결합 하는 매우 구체적인 항 체 활용을 활용 하 고 특정 대상 셀 형식, 즉 CD90 표현 세포의 선택에 대 한 수 있습니다. CD90 microbeads와 정화 하기 전에 우리는 일반적으로 14 일에 대 한 기본 rbSF MSCs 문화. 이 기간 동안, 많은 식민지는 문화 요리에 형성 된다. 이 프로토콜 제안 직경에서 2 m m 보다 큰 식민지를 선택 합니다. 때 식민지 선택에 대 한 복제 실린더를 사용 하 여, 우리가 신중 하 게 관찰 그것 현미경. 단일 식민지 더 정화에 대 한 전파 됩니다.

분리 및 정화의 과정, CD90 표현 셀 자석으로 분류 했다 반면 레이블이 셀 통해 흐름 구분 기호 열에서의 자기장에 의해 매료 됩니다. 세척 과정 후 열이 구분의 자기장에서 제거 하 고 열에서 대상 세포는 eluted. 이 특정 맥 microbead 접근 특히 줄기 세포 표면 마커 CD44, CD105,이 고립 된 세포는 조 혈 모 세포23보다는 중간 엽 줄기 세포를 보여주는 표현 rbSF MSCs의 격리 수 있습니다. 이 정화 rbSF MSCs 형태학 기능 및 마커 식의 어떤 중요 한 변화 없이 오랜 시간 동안 경작에 생체 외에서 될 수 있습니다. 또한, 맥에 의해 농축 rbSF MSCs chondrogenic, adipogenic, 및 osteogenic 셀에 포함 하 여 다중 계보 셀에 multipotent 차별화 능력을 전시 한다.

맥의 작업 수행 하기 쉬운 프로토콜 이며 벤치23에 행 해질 수 있다. 또한,는 미국 식품 및 의약품 안전 청 (FDA) 승인 맥 microbead 기반 기술, 그리고 따라서 임상 응용 프로그램24수행 하기 쉽습니다. CD90 중간 엽 줄기 세포의 표면 마커 이며 연구자 나타났습니다 CD90 긍정적인 MSCs는 더 나은 chondrogenic 차별화 능력25,26. MSCs의 pluripotency 형태학 및 줄기 세포27에 대 한 특정 마커의 표현에 따라 특징 되었습니다 했다.

이 연구에는 몇 가지 한계는 합니다. 이 프로토콜의 첫 번째 단점은 우리가 검사 표면 표식에 관련 되어 있습니다. 에 따라 성명 국제 사회에 의해 세포 치료 (ISCT), multipotent MSCs를 정의 하기 위한 최소한의 기준을 CD90, CD105, CD44와 CD73, 긍정적이 고 부정적인 CD11b, CD14, CD34, CD45 그리고 CD79a 또는 HLA-DR28입니다. 노력과 비용 전체 패널을 테스트 하는 데 필요한 완화의 목적으로이 연구에서 연구자 선정 두 부정적인 마커 및 권장 긍정적인 마커의 두 됩니다. 둘째, 그것은 추가 연구에 대 한 선택 될 것입니다 식민지를 형성 하는 데 시간이 오래 걸립니다. 또한, 비 생체 외에서SF MSCs의 chondrogenic 유도 중 중요 한 문제입니다. 나중에 무대, hypertrophic chondrocytes 항상 명시적 형식 X 콜라겐 (COLX), 매트릭스 metalloproteinase 13 (MMP13), 알칼리 성 인산 가수분해 효소 (높은 산), 그리고 송아지 관련 된 녹음 방송 요인 2 (Runx2)29. 연구는 3 차원 (3D) 펠 릿, 역동적인 문화 시스템, 문화와 chondrocytes와 coculture는 MSC에 대 한 혜택 안정적으로 나왔다 chondrogenic 차별화30,31. 이 연구에서 펠 릿 문화 시스템 chondrogenic 유도 MSC의 비를 피하기 위해 사용 되었다.

결론적으로, 우리 분리와 관절 강 물 내리는 액체에서 MSCs의 정화에 대 한 간단한 방법을 설립 하 고 거기에 얻은 MSCs를 특징. 이 프로토콜은 탐사와 소설 공동 재생 전략에 관절 활 액 액체 파생 MSCs의 잠재적인 유틸리티의 조사에 대 한 플랫폼을 제공 하고있다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자 들은 아무 경쟁 금융 관심사 선언 합니다.

Acknowledgments

이 연구는 다음 교부 금에 의해 재정적으로 지원 되었다: 중국의 자연 과학 재단 (No. 81572198; No. 81772394); 심천 대학 (No. 2016031638); 높은 수준의 의료 분야 건설을 위한 기금 광 동성, 중국 (번호의 의료 연구 재단 A2016314); 심천 과학 및 기술 프로젝트 (제 JCYJ20170306092215436; 롤 JCYJ20170412150609690; 롤 JCYJ20170413161800287; 롤 SGLH20161209105517753; 롤 JCYJ20160301111338144)입니다.

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics