Célula activada por el magnético clasificación estrategias para aislar y purificar sinovial líquido mesenquimales células madre derivadas de un modelo de conejo

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Este artículo presenta un protocolo sencillo y económico para el simple aislamiento y purificación de células madre mesenquimales del líquido sinovial del conejo blanco de Nueva Zelanda.

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Las células madre mesenquimales (MSCs) son la fuente principal de la célula para terapia basada en células. Pueden utilizar MSCs de líquido sinovial de la cavidad articular para la ingeniería del tejido fino del cartílago. MSCs de líquido sinovial (SF-MSCs) han sido considerados candidatos prometedores para la regeneración articular, y su potencial beneficio terapéutico les ha hecho un tema de investigación importante últimamente. SF-MSCs de la cavidad de la rodilla del conejo Nueva Zelanda blanco pueden ser empleados como modelo traduccional optimizado para evaluar humana medicina regenerativa. Por medio de CD90-basado celular activado magnética clasificación tecnologías (MACS), este protocolo con éxito obtiene conejo SF-MSCs (rbSF-MSCs) de este modelo de conejo y completamente demuestra el fenotipo MSC de estas células induciendo a distinguir a osteoblastos, adipocitos y condrocitos. Por lo tanto, este enfoque puede aplicarse en la investigación en biología celular e Ingeniería del tejido fino usando procedimientos y equipos sencillos.

Introduction

MSCs se han sugerido como una fuente valiosa para la medicina regenerativa, especialmente para las lesiones de cartílago. MSCs, incluyendo condrocitos, osteoblastos, adipocitos, miocitos esqueléticos y viscerales células stromal, ampliamente amplían las áreas para el trasplante de células madre debido a su alta expansión tasa y multilineal diferenciación potencial1. MSCs pueden ser aislados de los esquelético muscular, membrana sinovial, la médula ósea y tejido adiposo2,3,4. Resultados tienen también confirmó la presencia de MSCs en el líquido sinovial, y la investigación anterior ha identificado MSCs derivados del líquido sinoviales (SF-MSCs) como candidatos prometedores para la regeneración articular5,6.

Sin embargo, investigación y experimentación preclínica en muestras humanas están sujetas a muchas cuestiones éticas. En cambio, conejos han sido y siguen siendo los más utilizados las especies animales para demostrar que el trasplante de MSCs puede reparar el daño de cartílago. En los últimos años un número creciente de investigadores ha estudiado las células madre mesenquimales conejo (rbMSCs) ambos en vitro y en vivo, como estas células son MSCs similares al ser humano en su fisiología celular biología y tejido. Asimismo, los rbMSCs son capaces de adherirse a las superficies plásticas, mostrando morfología de fibroblastos fusiformes en MSCs humanos. Además, las muestras mesenquimales conejo son simples y fáciles de obtener7. Además, los puntos más importantes son que rbMSCs expresan marcadores de superficie, como el CD44, CD90, CD105, y que se conserva la diferenciación multilineal potencial, que está de acuerdo con los criterios para la identificación de las poblaciones de MSC como definido por la sociedad internacional de terapia celular8,9. En particular, son capaces de condrogénesis no hipertrófica cuando inducida por TGF-β1, así haciéndolos fuentes celular adecuado para el cartílago articular fenotípicamente regeneración10,11, chondroprogenitors líquidos sinoviales 12.

Sin embargo, el aislamiento de SF-MSCs es mucho diferente de otros tejidos, incluyendo el cordón umbilical, tejido adiposo, sangre periférica y médula ósea. Actualmente, los enfoques más comunes para la purificación y separación de SF-MSCs son citometría de flujo y basado en grano separación inmunomagnética, aunque el método de citometría de flujo requiere un entorno específico y altamente costosos instrumentos13.

Este artículo presenta un procedimiento para la recolección simple y mínimamente invasivo de muestras de líquido sinovial de Nueva Zelanda conejos blancos. Durante el procedimiento, los MSCs rbSF estable expandida en vitro y entonces aislaron con CD90 positivos procedimientos magnéticos basados en grano. Por último, el protocolo muestra cómo se obtiene MSCs con alta pureza y viabilidad de las fuentes de células cosechadas.

En el presente Protocolo, el aislado rbSF-MSCs se caracterizan basado en su morfología, expresión de marcadores específicos y pluripotencia de células madre. Immunophenotyping de basados en citometría de flujo revela una expresión positiva significativa de CD44 y CD105, mientras que la expresión de CD45 y CD34 es negativa. Por último, un ensayo en vitro para MSCs rbSF demuestra la diferenciación osteogénica adipogenic y condrogénica de estas células.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos los experimentos con animales se realizaron conforme a las directrices regionales del Comité de ética, y todos los procedimientos animales fueron aprobados por las institucional Animal Care y uso Comité de Shenzhen segundo pueblo de Hospital, Universidad de Shenzhen.

1. aislar y cultura rbSF-MSCs

  1. Preparaciones para el procedimiento de animales
    1. Preparar esqueléticamente maduros mujer Nueva Zelanda conejos blancos para la colección de rbSF-MSCs. realizar un examen clínico de los conejos, un día antes del procedimiento anestesia y artrocentesis.
      Nota: debe incluir exámenes físicos peso (2.0-2.5 kg), género (mujer) y temperatura corporal, frecuencia respiratoria y frecuencia cardíaca. Parámetro intervalos para conejos clínicamente sanos son 30-50 min para tarifa de respiración, 220-280 min de ritmo cardíaco y 38-39 º C de temperatura corporal.
    2. Rápidamente los animales de 6 h antes de la anestesia.
  2. Preparación y procedimiento de la anestesia animal
    1. Refrenar el conejo con una jaula (véase Tabla de materiales) y luego inyectar 3% pentobarbital sódico en la vena marginal de la oreja en una dosis de 1 mL/kg para anestesia general.
    2. Coloque el conejo en una posición dorsal reclinada cómoda.
    3. Vigilar la frecuencia respiratoria, frecuencia cardíaca y temperatura corporal del conejo durante la anestesia.
    4. Utilice pomada oftalmológica en sus ojos para evitar la sequedad durante la anestesia.
    5. Evaluar la profundidad de la anestesia después clasificación14 de Guedel.
  3. Preparación para el cultivo y aislamiento de MSCs
    1. Para cultivar rbSF MSCs, preparar 500 mL de medio de cultivo comercial (véase Tabla de materiales) suplementado con 10% comercial suplemento (véase Tabla de materiales), 10% suero bovino fetal (FBS) y 1% penicilina-estreptomicina.
    2. Incubar el medio de cultivo a 37 ° C en un baño de agua.
    3. Preparar 500 mL de solución salina buffer fosfato (PBS) para aislamiento de células y lavado de células.
    4. Preparar 100 mL de solución salina isotónica para el procedimiento de artrocentesis de rodilla cavidad.
  4. Colección de uid to sinovial intra-articular de la rodilla del conejo
    1. Seleccione un área de 5 x 5 cm de tamaño alrededor de la rodilla y afeitar el pelo del conejo de esta zona usando una máquina de afeitar eléctrica de seguridad.
    2. Alternativamente, desinfectar el sitio del procedimiento 3 x con povidona yodo solución y 75% etanol. Luego, aplicar cortinas estériles cuando la zona se haya secado completamente.
    3. Inyectar 1-2 mL de solución salina isotónica, con una jeringa hipodérmica estéril (2 mL), en la cavidad articular de la rodilla desde el espacio articular lateral, movimiento de la rodilla 3-4 x y luego aspirar hacia fuera todo el líquido sinovial a temperatura ambiente.
    4. Filtro de la fluid sinovial a través de un colador de celular de nylon 40 μm para remover cualquier suciedad dentro de 4 h.
  5. Cultura de las MSCs rbSF
    1. Recoger el filtrado fluid en tubos de centrífuga de 50 mL y centrifugar a 1.500 rpm por 10 min a temperatura ambiente.
    2. Desechar el sobrenadante después de la centrifugación, lavar el sedimento con PBS, Resuspender el precipitado con el medio de cultivo completo y entonces el medio en platos de 100 mm de la placa.
    3. Incubar las placas a 37 ° C en una atmósfera humidificada con 5% CO2.
    4. Después de 48 h, reponer los platos con medio fresco para eliminar cualquier célula no adherente. Reemplazar el medio dos veces a la semana durante 2 semanas como paso 0 (P0).
      Nota: Debe haber cerca de 1 x 104 células adherentes. Células viable/ml en SF son aproximadamente 2 x 102/ml.
    5. Después de 14 días después de la chapa inicial, muchas colonias deben han formado en los platos de la cultura. Seleccione las colonias mayores de 2 mm de diámetro. Marque donde se encuentran las colonias seleccionadas por trazar su circunferencia en la parte inferior del plato.
    6. Deseche las colonias < 2 mm de ancho, utilizando raspadores de células. Digerir las colonias seleccionadas con 5 μl de tripsina 0.25%, utilizando un cilindro de clonación y transferir las colonias a una nueva placa como paso 1 (P1).
  6. Cuidado postoperatorio de los animales
    1. Siga los procedimientos estándar de operación institucionales para el seguimiento postoperatorio y recuperación de la anestesia.
    2. Monitorear los signos vitales del conejo cada 10 minutos hasta que ha recuperado la conciencia. Finalmente, transferir el animal consciente a la jaula. No devuelva un conejo que ha experimentado la cirugía para la compañía de otros animales hasta que haya recuperado completamente.
    3. Después de la operación, desinfectar la zona con povidona yodo al 0.1%, 2 x al día durante 3 días.

2. CD90-positivo magnético activado celular clasificación (MACS) de la cultura primaria y MSCs rbSF

  1. Preparación de la muestra
    1. Cuando las células alcanzan alrededor de 80% de confluencia, aspirar el medio y luego añadir 1-2 mL de 0.25% tripsina-EDTA a cada plato.
    2. Incubar los platos para 2-3 min permitir la separación de la célula.
    3. Una vez que las células son separadas, añadir una cantidad igual de medio de cultivo para hacer inactivo de la tripsina.
    4. Pasar la suspensión celular a través de un tamiz de 40 μm celular, recoger el filtrado en un tubo de 15 mL y luego girar por las células a 600 × g por 10 min a temperatura ambiente.
    5. Resuspender el precipitado de células en MACS corriendo buffer (PBS, pH 7.2, 0.5% albúmina de suero bovino y 2 mM EDTA) y luego contar el número de celular.
  2. Etiquetado magnético
    Nota: Ordenar los MSCs rbSF con una célula activada por el magnético clasificación kit de columnas, un soporte y separadores (véase Tabla de materiales).
    1. Determinar el número de celular utilizando un hemocitómetro.
    2. Centrifugar la suspensión celular en 300 × g por 10 min a 4 ° C. Aspire completamente el sobrenadante.
    3. Añadir 80 μl de buffer de resuspensión por 107 de células totales.
    4. Para 107 de células totales, añadir 20 μl de conjugado con un anticuerpo monoclonal de CD90 anti-conejo microbeads.
    5. Mezclar los granos magnéticos y células uniformemente en los tubos, luego incubar a 4 ° C durante 15 min en la oscuridad.
    6. Añadir 1 mL de buffer por 107 células en el tubo y luego la centrifugar a 300 × g por 10 min a 4 ° C para lavar las células. Desechar el sobrenadante después de la centrifugación.
    7. Resuspender el precipitado en 500 μl de buffer por 107 células.
  3. Separación magnética
    1. Coloque la columna con las alas de la columna al frente en el campo magnético del separador magnético.
    2. Enjuagar la columna separador magnético (MS) con 500 μl del buffer por 107 células.
    3. Transferir la suspensión sola celda en la columna. Que las células negativas pasan por el campo magnético para desechar estas células sin etiqueta.
    4. Lavar la columna 1-2 x con 500 μl del buffer por 107 células y descartar el flujo a través.
    5. Transferencia de la columna en un tubo de centrífuga (15 mL).
    6. Añada 1 mL de buffer por 107 células en la columna y entonces inmediatamente empuje el émbolo en la columna para eliminar las células magnéticamente etiquetadas.
    7. Repita el procedimiento anterior con una segunda columna MS para aumentar la pureza de CD90+ las células, que pueden enriquecer la fracción eluída.
    8. Centrifugar la suspensión celular en 300 × g durante 10 minutos, aspirar el sobrenadante y resuspender con el medio de cultivo.
  4. Cultura de la CD90+ rbSF MSCs
    1. Inocular las células en los platos de 100 mm después de la clasificación magnética celular activado.
    2. Incubar las placas a 37 ° C en un incubador celular humidificada con 5% CO2.
    3. Cuando se consigue el 80-90% de confluencia de la cultura primaria, en unos 7-10 días, digerir las células adherentes con 0.25% tripsina-EDTA y paso a una dilución de 1:2 para hacer el paso 2 (P2).
    4. Utilice el mismo método para pasar las células a paso 3 (P3), que pueden ser utilizadas para las pruebas en vitro .
      Nota: Después de la subcultura y la purificación, se obtienen aproximadamente 1 x 107 rbSF-MSCs.

3. identificación de MSCs rbSF

  1. Confirmación de marcador superficial de las rbSF MSCs mediante citometría de flujo
    1. Cuando las MSCs son 80-90% confluente en P3, lavan las células con PBS y tratar con 1 mL de 0.25% tripsina-EDTA. Luego, incubar las MSCs a 37 ° C durante 2-3 min hasta que las células son separadas.
    2. Cosecha de las células, usando 10 mL de PBS, transferir a un tubo cónico (15 mL) y centrifugar a 300 x g durante 5 min a temperatura ambiente.
    3. Deseche el sobrenadante. Resuspender el precipitado de células en 500 μl de PBS y transferir a un tubo de 1,5 mL.
    4. Incubar una dilución 1: 100 del conjugado con FITC y PE-conjugado anticuerpos (isotipo, FITC-CD34/PE-CD45, FITC-CD105/PE-CD44) por 1 h en la oscuridad a 4 ° C.
    5. Centrifugar la mezcla a 300 x g durante 5 min a temperatura ambiente y lavan las células dos veces con PBS por centrifugación a 300 x g durante 5 minutos cada vez. Deseche el sobrenadante.
    6. Resuspender las células en 500 μl de PBS, transfiera la suspensión de células en un tubo de fondo redondo (5 mL) y analizarlos utilizando un citómetro de flujo.
      Nota: Adquirir datos en un citómetro equipado con dos canales de fluorescencia: 533/30 y 585/40. Para cada isotipo de la fluorescencia, utilice el control de isotipo para regular el voltaje del láser adecuado y ajustar la intensidad mínima necesaria para obtener un histograma de fluorescencia que muestra los bordes izquierdo y derecho del pico. Recoger un mínimo de 10.000 eventos para los análisis estadísticos.
  2. Multidifferentiation de las MSCs rbSF
    Nota: Uso P3 rbSF-MSCs para los ensayos de multidifferentiation en vitro .
    1. Diferenciación osteogénica
      1. Preparar el medio de inducción osteogénica: DMEM basic (1 x) que contiene 50 mM de L-ascórbico ácido-2-fosfato 10 mM de α-glicerofosfato y 100 nM de la dexametasona.
      2. Las células en 103 células/cm2 en una placa de cultivo de tejidos 6 bien la semilla y de la cultura en el medio de inducción osteogénica.
      3. Cambiar el medio de inducción cada 3 días durante 3 semanas.
      4. Fijar las células con formaldehído al 4% durante 30 min a temperatura ambiente una vez finalizada la diferenciación, las células de tinción con rojo de alizarina 1% por 5 min y lavar luego ellos 3 x con PBS15.
    2. Diferenciación de Adipogenic
      1. Preparar el medio de inducción de adipogenic: DMEM basic (1 x) que consta de 100 mM de indometacina 10 mg/mL de insulina humana recombinante, 1 mM de dexametasona y 0,5 mM de 3-isobutil-1-metilxantina.
      2. Tratar el P3 rbSF-MSCs para 3 semanas en el medio de inducción de adipogenic.
      3. Después de 3 semanas, mancha las vacuolas del lípido neutral usando aceite rojo O para confirmar la diferenciación adipogenic. Fijar las células en una solución de formaldehído 4% durante 30 min a temperatura ambiente y luego lavar 3 veces con PBS16.
    3. Diferenciación condrogénica
      1. Preparar el medio de inducción condrogénica: DMEM basic (1 x) que consta de 10 ng/mL de TGFβ1, 1% de su suplemento, 0.35 m m de la L-Prolina, 100 nM de dexametasona, 50 mM de L-ascórbico ácido-2-fosfato y 1 mM de piruvato de sodio.
      2. Utilizar pellets de cultivo para la inducción condrogénica. Centrifugar 5 × 105 P3 rbSF-MSCs a 1500 rpm durante 10 min en un tubo de polipropileno (15 mL) para formar un pellet.
      3. La cultura las pastillas durante 3 semanas con el medio de inducción condrogénica.
      4. Cambiar el medio cada 3 días durante 3 semanas.
      5. Después de la inducción de 3 semanas, incrustar el sedimento celular con parafina, sección en rodajas de 4 mm y con 0.1% de la mancha azul de toluidina durante 30 min a temperatura ambiente de17.
  3. Extracción de RNA total y análisis por reacción en cadena de la polimerasa en tiempo real cuantitativa (qRT-PCR)
    1. Aislar el ARN total de las células después de la inducción de la diferenciación de 3 semanas usando la extracción de RNA comercial kit (véase Tabla de materiales).
      1. Retire el medio de cultivo en la placa de cultivo y añadir 1 mL de reactivo de aislamiento.
      2. Lyse las células mediante pipeteo repetido hasta que la solución es homogénea. Incubar a temperatura ambiente durante 3 minutos.
      3. Transferir el lisado de células en un tubo de microcentrífuga de 1,5 mL.
      4. Añada 100 μl de cloroformo, agitar por 15 x mano e incubar la mezcla a temperatura ambiente durante 3 minutos.
      5. Centrifugar el tubo a 12.000 x g durante 15 min a 4 ° C. Transferir el sobrenadante a un tubo nuevo de microcentrífuga de 1,5 mL.
      6. Añadir 500 μl de isopropanol y precipitar el ARN durante 10 min a temperatura ambiente.
      7. Centrifugar a 12.000 g del × de minat 10 4 ° C. El pellet de RNA debe ser visible en la parte inferior del tubo.
      8. Quite el sobrenadante y añadir 500 μl de etanol 75%. Brevemente, haga girar el tubo durante varios segundos para lavar el pellet de RNA. Centrifugue a 7.500 × g por 5 min a 4 ° C.
      9. Eliminar el etanol residual.
      10. Disolver el pellet de RNA en 10 μl de agua DEPC y coloque los tubos en hielo.
    2. Inversa transcribir ARN en ADNc con una síntesis de la DNA kit (véase Tabla de materiales).
      Nota: Realice los siguientes procedimientos en el hielo.
      1. Preparar la mezcla principal de reversa de la transcripción.
      2. Añada 25 μl de RNA tratado con DNasa a cada tubo con 1 μg de ARN.
      3. Incubar la mezcla a las temperaturas siguientes utilizando un termociclador PCR: 26 ° C durante 10 minutos (para permitir el random hexamers a Recueza), 42 ° C por 45 min (transcripción reversa) y 75 ° C durante 10 minutos (inactivar la transcriptasa inversa).
      4. Inmediatamente analizar la resultante cDNA por PCR cuantitativa en tiempo real y almacenar a-20 ° C.
    3. Realizar el análisis de expresión génica con un sistema PCR en tiempo real cuantitativo.
      1. Uso de qRT-PCR Master Mix (véase Tabla de materiales) para llevar a cabo la polimerización en cadena. Los cebadores PCR de GAPDH, Runx2, Agg y PPARy se enumeran en la tabla 1.
      2. Calcular la expresión del gen mediante el métodoΔΔCT 2.
      3. Realizar un análisis estadístico utilizando el software estadístico estándar. Use una prueba t de muestras independientes para comparar las medias de grupo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Aislamiento, purificación y la cultura de las rbSF MSCs:
Este protocolo utiliza MACS para aislar rbSF-MSCs, basados en la expresión del marcador de superficie MSC CD90. Figura 1muestra un diagrama de flujo proceso de rbSF-MSCs aislamiento, purificación, caracterización y el protocolo de cultivo en vitro .

Morfología de la célula después de la célula activada magnética clasificación (MACS) con CD90:
En primer lugar, para Mac, immunolabel MSCs con bolas magnéticas CD90. Después de la centrifugación, suspender un máximo de 107 células en 80 μl de un buffer de ordenación preenfriado y luego añadir 20 μl de granos magnéticos CD90, seguido de Vortex y la incubación a 4 ° C durante 15 minutos. Después, lavar las células con 1 mL de la solución de clasificación y resuspender en 500 μl de la solución de clasificación. Antes de proceder a la separación magnética, repita el paso de lavado. Este procedimiento fundamental se muestra en la figura 2.

Antes de la clasificación, las poblaciones de conejo adherente líquido sinovial de la célula muestran morfología heterogénea, que contiene la célula diversos tipos y tamaños (Figura 3A-C). Después de MACS, las poblaciones celulares exhiben morfología homogénea. El número de células fue aumentado con subcultura (figura 3D-F).

Superficie enriquecida con características de MACS rbSF-MSCs:
Fluorescencia activada célula clasificación (FACS) fue realizada para analizar el enriquecimiento de MSCs rbSF MACS con CD90. Antes de MACS, la población de células consistía en aproximadamente 40% MSCs (figura 4D; controles de isotipo en la Figura 4A,B). Después de MACS, la población enriquecida contiene aproximadamente > 99% MSCs (figura 4E,F). Los marcadores de la célula de linaje hematopoyético CD34 y CD45, 0.318%, ambos raramente se expresaron después de Mac, que es una disminución de su expresión inicial en 25.9%. Antes de la selección, había aproximadamente un 28% CD90+ las células (figura 4); después de la purificación, cerca de 98% CD90+ las células fueron obtenidas (figura 4 H).

Diferenciación del multilineage potencial de rbSF MSCs:
Para caracterizar la capacidad de rbSF MSCs para diferenciarse en los diferentes linajes como osteogénico, adipogenic y condrogénica células, las MSCs rbSF enriquecidos por MACS fueron simultáneamente cultivadas en un medio de diferenciación específica y en un medio de diferenciación sin citocinas para servir como controles. Cuando la inducción se completó, marcadores específicos del linaje fueron analizados por la coloración y RT-PCR. Alizarina roja de compuestos de calcio demostró que se habían formado nódulos mineralizados en el MSCs rbSF después de 3 semanas bajo las condiciones de inducción osteogénica (figura 5A). Después de 3 semanas de inducción adipogenic, podría detectarse una acumulación de vacuolas ricas en lípidos intracelulares aceite rojo O manchas (figura 5B). Durante 21 días de inducción condrogénica, el precipitado de células fue probado histológico con tinción de azul de toluidina. Células positivas para la tinción (para proteoglicanos) fueron miradas como condrocitos-como las células (figura 5). Similar a este resultado, un análisis cuantitativo de la expresión de genes de diferenciación potencial demostrado también la capacidad de diferenciación de estas células. Los niveles de expresión de Runx2, Agg (un marcador de condrocitos) y PPARy (un marcador de adipogenic) (un marcador de osteoblastos) fueron el alza inducida en condiciones. Estos datos demostraron la capacidad de diferenciación multipotentes de rbSF MSCs en trilineages (figura 5).

Figure 1
Figura 1: esquema completo de aislamiento, purificación y caracterización de las SF-MSCs de conejos Nueva Zelanda blanco. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: protocolo para magnético celular activado clasificación (MACS) con CD90. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: morfología de la monocapa cultivado rbSF MSCs antes y después de MACS que examina bajo ordinario invertido microscopia. A-C) Antes de la clasificación, las poblaciones de conejo adherente líquido sinovial de la célula muestran heterogeneidad. Contienen células diversos tipos y tamaños, como óvalo, eje largo, eje corto y morfología radiada. La morfología principal de P2 y P6 es una morfología del huso (A: P2, B: P3, C: P6). D-F) Después de MACS con CD90, las poblaciones celulares exhiben una morfología homogénea. Con una sub cultura, aumenta el número de células (D: P2, E: P3, F: P6). Barra de escala = 100 μm. haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: identificación de marcadores de superficie rbSF-MSC. Usando análisis de citometría de flujo, los MSCs rbSF son positivas para los marcadores MSC CD44 y CD105, mientras que la negativa para el marcador CD34 de células endoteliales y el marcador de células hematopoyéticas CD45. Antes de MACS, estas células tienen una baja tasa de positividad para CD44 y CD105. Sin embargo, después de Mac, la tasa de positividad era alta. A, B) Estas dos imágenes superiores muestran los datos de control de isotipo. C, D) Estos resultados demuestran que antes de MACS la población rbSF MSC está compuesto por aproximadamente 40% MSC células. E, F) Después de MACS, la población enriquecida contiene las células MSC de > 99%. G, H) Estas imágenes muestran el análisis de citometría de flujo de la CD90+ marcador, (G) antes y (H) después de la clasificación de Mac. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: Análisis de marcadores específicos del linaje por la coloración y RT-PCR. A) alizarina coloración roja demuestra que forman nódulos mineralizados en la inducción osteogénica durante 3 semanas. B) después de 3 semanas de inducción adipogenic, la acumulación de vacuolas ricas en lípidos se detecta por la coloración de aceite rojo O intracelular. C) de 3 semanas de inducción condrogénica, el precipitado de células fue probado histológico con tinción de azul de toluidina. Células positivas para la tinción (para proteoglicanos) fueron miradas como condrocitos-como las células. Barra de escala = 100 μm. D) después de cultivo durante 3 semanas, el mRNA relativa expresión de marcadores de osteoblastos (Runx2), marcadores de adipogenic (PPARy) y marcadores condrogénica (Agg) es detectada. Para todos los análisis, valores de p < 0.01 se consideraron como estadísticamente diferencias significativas con el test de Kruskal-Wallis (mostrado como **). Haga clic aquí para ver una versión más grande de esta figura.

Genes Avance primer (5'-3') Reverse primer (5'-3')
RUNX2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
AGG GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARΓ2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

Tabla 1: Lista de genes y cartillas utilizadas en este estudio por PCR cuantitativa en tiempo real.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

La existencia de las MSCs en el líquido sinovial proporciona una alternativa para la terapia celular. Estudios anteriores han demostrado que lesiones sitios contienen cantidades más altas de células madre mesenquimales en su líquido sinovial, que puede ser correlacionado positivamente con el período posterior a la lesión5. El MSCs en el líquido sinovial pueden ser beneficiosos al tejido para mejorar la curación espontánea después de una lesión18,19. La aplicación clínica de SF-MSCs raramente ha sido cubierta en la literatura, principalmente porque los mecanismos de las SF-MSCs en articulaciones siendo indefinido20. Jones et al. 21 informó que los números de hSF-MSC en empalmes de la rodilla aumentan significativamente 7-fold durante las primeras etapas de la osteoartritis (OA). Pensaron que el SF-MSCs mayor podrían contribuir a mantener la homeostasis fisiológica de las articulaciones.

Un modelo animal ideal es una herramienta indispensable en el desarrollo de la terapéutica utilizando medicina regenerativa y traslacional. Aunque existen diferencias obvias entre los seres humanos y conejos, el conejo se utiliza extensivamente como modelo animal para el estudio de tejidos regeneración7, así que nos elija como el modelo para el estudio de SF-MSCs. Uno de los obstáculos más difícil de este esfuerzo es que el aislamiento de SF-MSCs a menudo resulta en tasas de éxito variado y Colonia bajas frecuencias, como se informó en la anterior investigación5. Por lo tanto, numerosos investigadores se han centrado en las tasas de éxito y optimización del aislamiento de MSCs de SF.

Este studyeffectively utilizó un procedimiento de MACS para clasificación de alta pureza y viabilidad de CD90+ MACSs del conejo líquido sinovial22. Este sistema Mac utiliza microesferas magnéticas conjugado con anticuerpos altamente específicos juntados a un antígeno de superficie celular particular, CD90, en este caso y permite la selección del tipo de la célula objetivo particular, es decir, células expresando CD90. Antes de la purificación con microesferas CD90, generalmente cultura el principal rbSF-MSCs para 14 días. Durante este período, muchas colonias se forman en los platos de la cultura. Este protocolo sugiere seleccionar las colonias mayores de 2 mm de diámetro. Cuando se utiliza el cilindro de clonación para la selección de Colonia, cuidadosamente observamos al microscopio. La Colonia solo se propaga aún más para la purificación.

Durante el proceso de separación y purificación, las células expresa CD90 magnéticamente fueron etiquetadas son atraídas por el campo magnético del separador en la columna, mientras que las células fluyen a través. Después del proceso de lavado, la columna se retira del campo magnético del separador, y las células diana se eluyen de la columna. Este enfoque específico de microbead MACS permite el aislamiento de rbSF-MSCs que expresa específicamente los célula de vástago marcadores de superficie CD44 y CD105, demostrar que estas células aisladas son las células madre mesenquimales en lugar de células hematopoyéticas23. Estos purificadas rbSF-MSCs pueden ser cultivadas en vitro durante mucho tiempo sin ningún cambio significativo de las características morfológicas y de expresión de marcador. Por otra parte, los MSCs rbSF enriquecidos por MACS exhiben una capacidad de diferenciación multipotentes en multilineal células, incluyendo células osteogénicos, adipogenic y condrogénica.

La operación de Mac es un protocolo fácil de realizar y se puede hacer en el Banco23. Además, la US Food y Drug Administration (FDA) ha aprobado la Mac del microbead tecnología, y por lo tanto es fácil de realizar para aplicaciones clínicas24. CD90 es un marcador de superficie de las células madre mesenquimales y los investigadores han demostrado que CD90 MSCs positivo tienen un mejor condrogénica diferenciación capacidad25,26. La pluripotencia de MSCs se ha caracterizado basado en la morfología y la expresión de marcadores específicos de células madre27.

Este estudio tiene varias limitaciones. La primera deficiencia del presente Protocolo se relaciona con los marcadores superficiales que examinamos. Basada en una declaración de la sociedad internacional de terapia celular (ISCT), los criterios mínimos para la definición de MSCs multipotentes es positivo para CD73, CD90, CD105 y CD44 y negativa para CD34, CD11b, CD45 y CD79a es CD14 o HLA-DR28. Con el objetivo de mitigar el esfuerzo y los gastos necesarios para poner a prueba todo el panel, los investigadores en este estudio cuidadosamente seleccionan dos de los marcadores negativos y dos de los marcadores positivos recomendados. En segundo lugar, se necesita mucho tiempo para formar las colonias que serán seleccionadas para un estudio más profundo. Además, la hipertrofia es un problema importante durante la inducción condrogénica de SF-MSCs en vitro. En la etapa posterior, el colágeno de tipo siempre expresa X de condrocitos hipertróficos (COLX), metaloproteinasa de la matriz 13 (MMP13), fosfatasa alcalina (ALP) y relacionados con runt transcripción factor 2 (Runx2)29. La investigación sugiere que la cultura de pellet (3D) tridimensional, sistemas de cultivo dinámico y el cocultivo con condrocitos son beneficio para MSC estable de30,de diferenciación condrogénica31. En este estudio, se utilizó un sistema de cultivo de pellets para inducción condrogénica de MSC para evitar la hipertrofia.

En conclusión, hemos establecido un método simple para el aislamiento y purificación de MSCs del líquido de lavado de cavidad articular y caracteriza el MSCs obtenidos en ella. Este protocolo ha proporcionado una plataforma para la exploración y la investigación de la utilidad potencial de articular sinovial líquido derivado MSCs estrategias de regeneración conjunto nuevo.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores declaran que no tienen intereses financieros que compiten.

Acknowledgments

Este estudio fue apoyado financieramente por las siguientes becas: la Fundación de Ciencias naturales de China (no. 81572198; Nº 81772394); el fondo para la construcción de alto nivel disciplina médica de la Universidad de Shenzhen (Nº 2016031638); la Fundación de investigación médica de la provincia de Guangdong, China (no. A2016314); Shenzhen Ciencia y tecnología proyectos (no. JCYJ20170306092215436; No. JCYJ20170412150609690; No. JCYJ20170413161800287; No. SGLH20161209105517753; No. JCYJ20160301111338144).

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics