Magnetische aktiviert Zelle Sortieren Strategien zu isolieren und reinigen Synovial Flüssigkeit abgeleitet mesenchymalen Stammzellen aus einem Kaninchen-Modell

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Dieser Artikel stellt eine einfache und kostengünstige Protokoll für die einfache Isolierung und Reinigung von mesenchymalen Stammzellen aus New Zealand white Kaninchen Gelenkflüssigkeit.

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mesenchymaler Stammzellen (MSCs) sind die wichtigsten Zelle Quelle für zellbasierte Therapien. MSCs von Gelenkflüssigkeit Gelenk Hohlraum könnte für das Tissue Engineering von Knorpelgewebe verwendet werden. MSCs von Gelenkflüssigkeit (SF-MSCs) sind viel versprechende Kandidaten für die artikuläre Regeneration betrachtet worden, und ihre möglichen therapeutische Nutzen hat sie ein wichtiges Forschungsthema des späten. SF-MSCs aus dem Knie Hohlraum der New Zealand white Kaninchen können als eine optimierte translationale Modell eingesetzt werden, menschliche regenerativen Medizin zu beurteilen. Mittels CD90-basierte magnetisch aktivierte Zelle Sortieren (MACS) Technologien dieses Protokoll erfolgreich erhält Kaninchen SF-MSCs (RbSF-MSCs) von diesem Kaninchen-Modell und voll zeigt den MSC-Phänotyp dieser Zellen durch veranlassen, zu unterscheiden Adipozyten Osteoblasten und Chondrozyten. Daher kann dieser Ansatz in Zelle Biologie Forschung und Tissue Engineering mit einfachen Mitteln und Verfahren angewendet werden.

Introduction

MSCs sind als wertvolle Quelle für die regenerative Medizin, speziell für Knorpel Läsionen vorgeschlagen worden. MSCs, einschließlich Chondrozyten, Osteoblasten, Adipozyten, Skelett Myozyten und viszeralen Stromazellen Zellen erweitern im großen und ganzen die Bereiche für stammzelltransplantationen wegen ihrer hohen Ausdehnung Rate und Multi-Linie Differenzierung potenzielle1. MSCs können von den skelettartigen Muskel, Synovialis, dem Knochenmark und Fettgewebe2,3,4isoliert werden. Erkenntnisse haben auch bestätigte die Anwesenheit von MSCs in Gelenkflüssigkeit und die bisherige Forschung hat als aussichtsreiche Kandidaten für artikuläre Regeneration5,6synovial Flüssigkeit abgeleitet MSCs (SF-MSCs) identifiziert.

Forschung und präklinischen Erprobung auf humanen Proben unterliegen jedoch viele ethische Fragen. Stattdessen, Kaninchen wurden und auch weiterhin die am häufigsten verwendeten Tierarten nachweisen, dass die Transplantation von MSCs Knorpelschäden zu reparieren. In den letzten Jahren eine wachsende Zahl von Forschern untersuchten Kaninchen mesenchymalen Stammzellen (RbMSCs) beide in Vitro und in Vivo, als diese Zellen sind ähnlich wie menschliche MSCs in ihrer Biologie und Gewebe Zellphysiologie. Ebenso sind die RbMSCs in der Lage, des Festhaltens an Kunststoffoberflächen, Spindel-Fibroblasten Morphologie wie menschliche MSCs anzeigen. Darüber hinaus sind Kaninchen mesenchymalen Proben einfach und leicht zu7zu erhalten. Darüber hinaus sind die wichtigsten Punkte, dass RbMSCs oberflächenmarker wie CD44, CD90 und CD105, express und Multi-Linie Differenzierungspotenzial erhalten ist, ist in Übereinstimmung mit den Kriterien für die Identifizierung des MSC Populationen als durch die internationale Gesellschaft für Zelltherapie8,9definiert. Synovial Flüssigkeit Chondroprogenitors sind insbesondere in der Lage, nicht Hypertrophe werden wenn durch TGF-β1, wodurch sie geeignete Zelle Quellen für phänotypisch Gelenkknorpel Regeneration10,11induziert, 12.

Die Isolation der SF-MSCs ist jedoch sehr unterschiedlich zu anderen Geweben, einschließlich der Nabelschnur, Fettgewebe, peripherem Blut und Knochenmark. Derzeit sind die am häufigsten verwendeten Ansätze für die Reinigung und Sortierung von SF-MSCs Durchflusszytometrie und Immunomagnetic Wulst-basierte Sortierung, obwohl die Flow-zytometrie-Methode eine spezielle Umgebung und sehr teure Instrumente13 erfordert.

Dieser Artikel stellt ein Verfahren für die einfache und minimal-invasive Entnahme von Proben von Gelenkflüssigkeit aus Neuseeland weiße Kaninchen. Während des Verfahrens der RbSF-MSCs sind stabil erweiterten in-vitro- und dann mit CD90 positive magnetische Wulst-basierte Verfahren isoliert. Das Protokoll zeigt schließlich, wie MSCs mit hoher Reinheit und Wirtschaftlichkeit aus den geernteten Zelle Quellen zu erreichen.

In diesem Protokoll zeichnen sich die isolierte RbSF-MSCs anhand ihrer Morphologie, Ausdruck spezifischer Marker und Pluripotenz Stammzellen zu gewinnen. Flow Cytometry-basierte Immunphänotypisierung zeigt einen signifikanten positive Ausdruck CD44 und CD105, während der Ausdruck von CD45 und CD34 negativ ist. Schließlich zeigt ein in-vitro- Test für RbSF-MSCs osteogene adipogenen und Chondrogenic Differenzierung der Zellen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle Tierversuche wurden entsprechend den regionalen Ethik-Kommission Leitlinien durchgeführt, und alle tierische Verfahren von der institutionellen Animal Care und Nutzung Ausschuss von Shenzhen zweite Krankenhaus, Shenzhen-Universität angenommen wurden.

(1) isolieren und Kultur der RbSF-MSCs

  1. Vorbereitungen für das Tier Verfahren
    1. Bereiten Sie skelettartig Reifen weiblichen Neuseeland weiße Kaninchen für die Sammlung von RbSF-MSCs Perform eine klinische Untersuchung der Kaninchen einen Tag vor Ablauf der Anästhesie und gelenkpunktion.
      Hinweis: körperliche Untersuchungen gehören Gewicht (2,0-2,5 kg), Geschlecht (weiblich), und Körpertemperatur, Atemfrequenz und Herzfrequenz. Parameter-Intervalle für klinisch gesunde Kaninchen sind 30-50 min für Atmung, Herzfrequenz 220-280 min und 38-39 ° C für die Körpertemperatur.
    2. Schnell die Tiere für 6 Stunden vor der Narkose.
  2. Vorbereitungen und das Verfahren für die tierischen Anästhesie
    1. Die Kaninchen mit Käfig zurückhalten (siehe Tabelle der Materialien), und dann 3 % Pentobarbital-Natrium in die Vene marginal Ohr bei einer Dosis von 1 mL/kg für die Vollnarkose zu injizieren.
    2. Legen Sie die Kaninchen in einer bequemen Position dorsal-Liegerad.
    3. Überwachen Sie die Atemfrequenz, Herzfrequenz und Körpertemperatur des Kaninchens während der Narkose.
    4. Verwenden Sie ophthalmologische Salbe auf seine Augen, um Trockenheit während der Narkose zu verhindern.
    5. Die Tiefe der Narkose nach Guedel Klassifizierung14zu beurteilen.
  3. Vorbereitung für MSCs Isolierung und Kultivierung
    1. Um RbSF-MSCs zu kultivieren, 500 mL von kommerziellen Kulturmedium vorzubereiten (siehe Tabelle der Materialien) ergänzt mit 10 % kommerzielle ergänzen (siehe Tabelle der Materialien), 10 % fetalen bovine Serum (FBS) und 1 % Penicillin-Streptomycin.
    2. Inkubieren Sie das Nährmedium bei 37 ° C im Wasserbad.
    3. Zelle Isolation und Zelle waschen 500 mL von Phosphat Puffer Kochsalzlösung (PBS) vorbereiten.
    4. Das Knie Hohlraum gelenkpunktion Verfahren 100 mL isotonischer Kochsalzlösung vorbereiten.
  4. Sammlung von Gelenkknorpel synovialen fl Uid vom Knie des Kaninchens
    1. Wählen Sie einen Bereich ca. 5 x 5 cm in der Größe um das Knie und das Kaninchen Haar aus diesem Bereich mit einem Elektrorasierer Sicherheit.
    2. Abwechselnd, desinfizieren die Prozedur Website 3 X mit Povidon-Jod-Lösung und 75 % Ethanol. Wenden Sie dann sterile Tüchern, nach Bereich gründlich getrocknet ist.
    3. Injizieren Sie 3-4 x 1-2 mL Isotonische Kochsalzlösung, eine sterile Injektionsspritzen (2 mL), in die Knie gelenkspalt aus dem lateralen Gelenk Raum, bewegen Sie mit Hilfe des Knies zu, und dann saugen Sie die Gelenkflüssigkeit bei Raumtemperatur.
    4. Filtern der synovialen Geruchsbelastung durch ein 40 µm Nylon Zelle Sieb, Ablagerungen innerhalb von 4 Stunden zu entfernen.
  5. Kultur der RbSF-MSCs
    1. Sammeln Sie die gefilterten Geruchsbelastung in 50 mL Zentrifuge Tuben und Zentrifuge bei 1.500 u/min für 10 min bei Raumtemperatur.
    2. Den überstand nach der Zentrifugation zu verwerfen, das Pellet mit PBS waschen Aufschwemmen der Pellets mit dem kompletten Kulturmedium und dann Platte des Mediums in 100 mm Schalen.
    3. Inkubieren Sie die Gerichte bei 37 ° C in eine feuchte Atmosphäre mit 5 % CO2.
    4. Ergänzen Sie nach 48 h die Gerichte mit frischen Medium, nicht-adhärenten Zellen zu entfernen. Ersetzen Sie das Medium zweimal pro Woche für 2 Wochen als Durchgang 0 (P0).
      Hinweis: Sollte ca. 1 x 104 adhärente Zellen. Lebensfähige Zellen/ml in San Francisco sind etwa 2 x 102/mL.
    5. Nach 14 Tagen nach der ersten Beschichtung sollten viele Kolonien in den Kultur-Gerichten gebildet haben. Wählen Sie aus die Kolonien, die größer als 2 mm Durchmesser. Markieren Sie die ausgewählten Kolonien befinden sich durch ihren Umfang auf der Unterseite der Schüssel nachzeichnen.
    6. Die Kolonien < 2 mm breit, mit Zelle Schaber zu verwerfen. Verdauen Sie die ausgewählten Kolonien mit etwa 5 µL 0.25 % Trypsin, mit einem Klon Zylinder und übertragen Sie die Kolonien auf ein neues Gericht als Durchgang 1 (P1).
  6. Postoperative Pflege der Tiere
    1. Folgen Sie institutionelle operativen Standardverfahren für die postoperative Überwachung und Erholung aus der Narkose.
    2. Überwachen Sie die Vitalfunktionen des Kaninchens alle 10 Minuten, bis er das Bewusstsein wiedererlangt hat. Schließlich übertragen Sie das bewusste Tier in den Käfig. Ein Kaninchen, die Operation, um die Gesellschaft anderer Tiere durchlaufen hat, bis es vollständig erholt hat nicht zurück.
    3. Nach der Operation, Desinfizieren Sie die Website mit 0,1 % Povidon-Jod, 2 x pro Tag für 3 Tage.

2. CD90-Positive magnetische aktiviert Zelle Sortieren (MACS) des RbSF-MSCs und Primärkultur

  1. Vorbereitung der Probe
    1. Wenn die Zellen herum erreichen 80 % Konfluenz Aspirieren Sie das Medium, und fügen Sie 1-2 mL von 0,25 % Trypsin-EDTA, jedes Gericht.
    2. Inkubieren Sie die Gerichte für 2 – 3 min. zur Ablösung der Zelle zu ermöglichen.
    3. Sobald die Zellen getrennt sind, fügen Sie eine gleiche Menge des Kulturmediums, die Trypsin zu inaktivieren.
    4. Die Zellsuspension durch ein 40 µm Zelle Sieb passieren, das Filtrat in einem 15 mL Röhrchen zu sammeln und dann spin-down der Zellen bei 600 × g für 10 min bei Raumtemperatur.
    5. Aufschwemmen der Zelle Pellet in MACS mit Puffer (PBS, pH 7,2, 0,5 % Rinderserumalbumin und 2 mM EDTA) und zählen Sie die Anzahl von Zellen.
  2. Magnetische Kennzeichnung
    Hinweis: Sortieren der RbSF-MSCs mit einer magnetischen aktiviert Zelle Sortieren Kit mit Spalten, einem Ständer und Separatoren (siehe Tabelle der Materialien).
    1. Bestimmen Sie die Anzahl von Zellen mit einem Hemocytometer.
    2. Zentrifugieren der Zellsuspension bei 300 × g für 10 min bei 4 ° C. Aspirieren Sie völlig überstand.
    3. 80 µL Wiederfreisetzung Puffer pro 107 total Zellen hinzufügen.
    4. Fügen Sie für 107 total Zellen 20 µL Microbeads mit einem monoklonalen Anti-Kaninchen CD90 Antikörper konjugiert.
    5. Mischen Sie die magnetische Beads und Zellen gleichmäßig in den Röhren, dann inkubieren sie bei 4 ° C für 15 Minuten im Dunkeln.
    6. Das Rohr 1 mL Puffer pro 107 Zellen hinzu, und Zentrifugieren Sie es bei 300 × g für 10 min bei 4 ° C, die Zellen zu waschen. Entsorgen Sie den überstand nach der Zentrifugation.
    7. Das Pellet in 500 µL Puffer pro 107 Zellen aufzuwirbeln.
  3. Magnetische Trennung
    1. Setzen Sie die Säule mit der Spalte Flügel nach vorne in das Magnetfeld der Magnetabscheider.
    2. Spülen Sie die Spalte Magnetabscheider (MS) mit 500 µL Puffer pro 107 Zellen.
    3. Übertragen Sie die einzigen Zellsuspension in der Spalte. Lassen Sie die negativen Zellen durchlaufen das magnetische Feld um diese unbeschrifteten Zellen zu verwerfen.
    4. Waschen der Spalte 1-2 X mit 500 µL Puffer pro 107 Zellen und entsorgen Sie den Durchfluss.
    5. Übertragen Sie die Spalte in ein Zentrifugenröhrchen (15 mL).
    6. Fügen Sie 1 mL des Puffers pro 107 Zellen der Spalte, und schieben Sie dann sofort den Kolben in die Spalte zu spülen, die magnetisch markierten Zellen.
    7. Wiederholen Sie die vorgenannten Verfahren mit ein zweite MS Column die Reinheit des CD90 erhöhen+ Zellen, die der eluierten Bruchteil bereichern können.
    8. Die Zellsuspension bei 300 × g für 10 min zentrifugieren, überstand Aspirieren und mit dem Kulturmedium Aufschwemmen.
  4. Kultur von der CD90+ RbSF-MSCs
    1. Die Zellen in 100 mm Schalen nach magnetisch aktivierte Zellsortierung zu impfen.
    2. Inkubieren Sie die Gerichte bei 37 ° C in einem befeuchteten Zelle Inkubator mit 5 % CO2.
    3. Bei 80-90 % Zusammenfluss von der Primärkultur, bei etwa 7-10 Tage erreicht wird, verdauen die adhärenten Zellen mit 0,25 % Trypsin-EDTA und Passage bei einer Verdünnung von 1:2 zu Abschnitt 2 (P2).
    4. Verwenden Sie dieselbe Methode, die Zellen, die Passage 3 (P3) übergeben, die für die in-vitro- Tests verwendet werden kann.
      Hinweis: Nach der Subkultur und Reinigung, werden ca. 1 x 107 RbSF-MSCs gewonnen.

3. Identifizierung von RbSF-MSCs

  1. Surface Marker Bestätigung der RbSF-MSCs durch Durchflusszytometrie
    1. Wenn die MSCs 80-90 % Zusammenfluss bei P3 sind, die Zellen mit PBS waschen und behandeln sie mit 0,25 % 1 mL Trypsin-EDTA. MSCs bei 37 ° C für ca. 2-3 min inkubieren dann, bis die Zellen gelöst werden.
    2. Ernte der Zellen mit 10 mL PBS, übertragen Sie sie in einem konischen Rohr (15 mL) und Zentrifugieren sie 300 × g für 5 min bei Raumtemperatur.
    3. Entsorgen Sie die Überstände. Aufschwemmen der Zelle Pellet in 500 µL PBS und in einem 1,5 mL-Tube zu übertragen.
    4. Inkubieren Sie eine 1: 100 Verdünnung von FITC konjugiert und PE-konjugierten Antikörpern (Isotype, FITC-CD34/PE-CD45, FITC-CD105/PE-CD44) für 1 h im Dunkeln bei 4 ° c
    5. Zentrifugieren Sie dieses Gemisch bei 300 × g für 5 min bei Raumtemperatur und waschen Sie die Zellen zweimal mit PBS durch Zentrifugation bei 300 × g für 5 min jedes Mal zu. Entsorgen Sie die Überstände.
    6. Aufschwemmen der Zellen in 500 µL PBS, übertragen die Zellsuspension in ein Rundboden Röhrchen (5 mL) und es mit einem Durchflusszytometer analysiert.
      Hinweis: Daten auf eine Cytometer ausgestattet mit zwei Fluoreszenz Kanäle erwerben: 533/30 und 585/40. Verwenden Sie für jedes Isotype Fluoreszenz die Isotype-Steuerelement, um die geeigneten Laser-Spannung einstellen, und stellen Sie die minimale Intensität erforderlich, um ein Fluoreszenz-Histogramm zu erhalten, die linken und rechten Ränder der Spitze zeigt. Ein Minimum von 10.000 Veranstaltungen für die statistischen Analysen zu sammeln.
  2. Multidifferentiation von der RbSF-MSCs
    Hinweis: Verwendung P3 RbSF-MSCs für in-vitro- multidifferentiation Assays.
    1. Osteogene Differenzierung
      1. Bereiten Sie das osteogene Induktion Medium: DMEM Basic (1 X) mit 50 mM L-Ascorbinsäure-Säure-2-Phosphat, 10 mM von α-glycerophosphat und 100 nM von Dexamethason.
      2. Samen der Zellen bei 103 Zellen/cm2 in einer Gewebekultur 6-Well-Platte und Kultur sie mittelfristig osteogene Induktion.
      3. Ändern der Induktion Mittel alle 3 Tage für 3 Wochen.
      4. Befestigen Sie die Zellen mit 4 % Formaldehyd für 30 min bei Raumtemperatur nach Abschluss der Differenzierung, die Zellen färben mit 1 % Alizarin rot für 5 min und dann waschen Sie 3 X mit PBS15.
    2. Adipogenen Differenzierung
      1. Vorbereiten der adipogenen Induktion Medium: DMEM Basic (1 X) bestehend aus 100 mM von Indometacin, 10 mg/mL rekombinante Humaninsulin und 1 mM von Dexamethason 0,5 mM 3-Isobutyl-1-methylxanthin.
      2. Die P3-RbSF-MSCs für 3 Wochen in der adipogenen Induktion Medium zu behandeln.
      3. Färben Sie nach 3 Wochen die neutral Lipid Vakuolen mit Öl Rot O adipogenen Differenzierung zu bestätigen. Die Zellen in einer 4 % Formaldehyd-Lösung für 30 min bei Raumtemperatur zu beheben, und wasche sie dann 3 X mit PBS16.
    3. Chondrogenic Differenzierung
      1. Vorbereiten der Chondrogenic Induktion Medium: DMEM Basic (1 X), bestehend aus 10 ng/mL TGFβ1, 1 % seiner Ergänzung, 0,35 mM L-Prolin, 100 nM von Dexamethason, 50 mM L-Ascorbinsäure Säure-2-Phosphat und 1 mm Natrium Pyruvat.
      2. Verwenden Sie Pellet Kultivierung für die Chondrogenic Induktion. Zentrifugieren Sie 5 × 10-5 P3-RbSF-MSCs bei 1500 u/min für 10 min in einem Polypropylen Röhrchen (15 mL), eine Kugel zu bilden.
      3. Die Pellets für 3 Wochen mit dem Chondrogenic-Induktion-Medium-Kultur.
      4. Ändern Sie das Medium alle 3 Tage für 3 Wochen.
      5. Nach 3 Wochen Induktion, die Zelle Pellet mit Paraffin einbetten, in 4 mm Scheiben Abschnitt, und Färben sie mit 0,1 % Toluidin blau für 30 min bei Raumtemperatur-17.
  3. Insgesamt RNA-Extraktion und Analyse durch quantitative Real-Time Polymerase-Kettenreaktion (qRT-PCR)
    1. Isolieren der gesamte-RNS der Zellen nach 3 Wochen Differenzierung Induktion über die kommerzielle RNA-Extraktion kit (siehe Tabelle der Materialien).
      1. Entfernen Sie das Kulturmedium in der Kulturschale zu, und fügen Sie 1 mL Reagenz isoliert.
      2. Lyse der Zellen durch wiederholte pipettieren, bis die Lösung homogen ist. Inkubieren Sie es bei Raumtemperatur 3 min.
      3. Übertragen Sie die Zelle lysate zu einem 1,5 mL Microcentrifuge Schlauch.
      4. Fügen Sie 100 µL Chloroform hinzu, schütteln Sie sie von Hand 15 X und inkubieren Sie die Mischung bei Raumtemperatur 3 min.
      5. Zentrifugieren Sie das Rohr auf 12.000 × g für 15 min bei 4 ° C. Übertragen Sie die Überstände zu einem neuen 1,5 mL Microcentrifuge Schlauch.
      6. Fügen Sie 500 µL Isopropanol und überstürzen Sie sich die RNA für 10 min bei Raumtemperatur.
      7. Zentrifuge bei 12.000 × g für 10 Minat 4 ° C. Die RNA-Pellet sollten an der Unterseite des Rohres sichtbar.
      8. Entfernen Sie den überstand zu, und fügen Sie dann 500 µL 75 % Ethanol. Kurz drehen Sie das Rohr für einige Sekunden die RNA-Pellet zu waschen. Zentrifugieren sie bei 7.500 × g für 5 min bei 4 ° C.
      9. Entfernen Sie die restliche Ethanol.
      10. Lösen Sie die RNA-Pellet in 10 µL DEPC-Wasser auf und die Rohre auf Eis.
    2. Reverse Transkription total RNA in cDNA mit einer DNA-Synthese kit (siehe Tabelle der Materialien).
      Hinweis: Führen Sie die folgenden Verfahren auf Eis.
      1. Vorbereiten der reversen Transkription-master-Mix.
      2. Jedes Rohr mit 1 µg RNA 25 µL RNA DNase-behandelten hinzufügen.
      3. Inkubieren Sie die Mischung bei folgenden Temperaturen mit einer PCR-Thermocycler: 26 ° C für 10 min (um die zufällige Hexamers zu tempern zu ermöglichen), 42 ° C für 45 min. (reverse Transkription) und 75 ° C für 10 min (zu inaktivieren die Reverse Transkriptase).
      4. Sofort analysieren Sie die resultierende cDNA durch quantitative Echtzeit-PCR oder bei-20 ° c Lagern
    3. Führen Sie die Genanalyse Ausdruck mit einem quantitative Echtzeit-PCR-System.
      1. QRT-PCR Master Mix zu verwenden (siehe Tabelle der Materialien) PCR durchführen. Die PCR-Primer für GAPDH, Runx2, Agg und PPARγ sind in Tabelle 1aufgeführt.
      2. Gen-Expression mit 2ΔΔCT Methode zu berechnen.
      3. Führen Sie eine statistische Analyse mit statistischen Standardsoftware. Verwenden Sie einen unabhängige Stichproben t-Test, um die Gruppe Mittel vergleichen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Isolierung, Reinigung und Kultur der RbSF-MSCs:
Dieses Protokoll verwendet MACS, um RbSF-MSCs, basierend auf dem Ausdruck des MSC Oberfläche Markers CD90 zu isolieren. Ein Ablaufdiagramm RbSF-MSCs Isolierung, Charakterisierung, Reinigung, und die in-vitro- Kultur-Protokoll ist in Abbildung 1dargestellt.

Zellmorphologie nach magnetisch aktivierte Zelle Sortieren (MACS) mit CD90:
Zum einen, dass MACS, Immunolabel MSCs mit magnetischen Beads CD90. Aufschwemmen Sie nach Zentrifugation maximal 107 Zellen in 80 µL vorgekühlt Sortierung Puffer, und fügen Sie 20 µL CD90 magnetische Beads, gefolgt von aufschütteln und Inkubation bei 4 ° C für 15 Minuten. Danach waschen Sie die Zellen mit 1 mL des Puffers Sortier- und Aufschwemmen sie in 500 µL des Puffers sortieren. Wiederholen Sie bevor Sie mit der magnetischen sortieren waschen. Dieses wichtige Verfahren ist in Abbildung 2dargestellt.

Sortierung angezeigt, bevor die anhaftende Kaninchen synovial Flüssigkeit Zellpopulationen heterogene Morphologie mit unterschiedlichen Zelltypen und Größen (Abb. 3A-C). Im Anschluss an MACS ausgestellt die Zellpopulationen homogene Morphologie. Die Handynummer wurde mit Sub-Kultur (Abbildung 3D-F) erhöht.

Merkmale des MACS angereicherten RbSF-MSCs Oberfläche:
Fluoreszenz-aktivierte Zelle Sortieren (FACS) wurde durchgeführt, um die Anreicherung von RbSF-MSCs Analysieren von MACS mit CD90. Vor der MACS bestand die Zell-Population von etwa 40 % MSCs (Abbildung 4D; Isotype Steuerelemente in Abbildung 4A,B). Nach MACS enthielt die angereicherte Bevölkerung ca. > 99 % MSCs (Abbildung 4E,F). Die zellenmarkierungen hämatopoetischen Linie CD34 und CD45, bei 0.318 %, beide selten nach MACS, äußerte das ist ein Rückgang von ihren ersten Ausdruck bei 25,9 %. Vor der Auswahl, es gab etwa 28 % CD90+ Zellen (Abbildung 4); nach der Reinigung, etwa 98 % CD90+ Zellen stammen (Abbildung 4 H).

Multilineage mögliche Differenzierung der RbSF-MSCs:
Die Kapazität des RbSF-MSCs, sich in die verschiedenen Linien wie differenzieren zu charakterisieren osteogene, adipogenen und Chondrogenic Zellen, die RbSF-MSCs angereichert mit MACS waren gleichzeitig kultiviert in einem spezifischen Differenzierung Medium und in einer Differenzierung-Medium ohne Cytokine als Kontrollen dienen. Nach Abschluss die Induktion wurde Geschlecht-spezifische Marker analysiert wurden durch Färbung und RT-PCR. Alizarin rote Färbung der Calciumverbindungen gezeigt, dass mineralisierte Knötchen in der RbSF-MSCs nach 3 Wochen den knochenbildenden Induktion Bedingungen (Abbildung 5A) gebildet hatte. Nach 3 Wochen der adipogenen Induktion konnte eine Häufung von lipidreichen Vakuolen von intrazellulären Öl Rot O Färbung (Abb. 5 b) nachgewiesen werden. Für 21 Tage der Chondrogenic Induktion war die Zelle Pellet mit Toluidin blauer Färbung histologisch untersucht. Zellen, die positiv auf die Färbung (zu Proteoglykan) galten als Knorpelzelltransplantation-ähnliche Zellen (Abbildung 5). Ähnlich wie dieses Ergebnis zeigte sich eine Quantitative Analyse der Genexpression von Differenzierungspotenzial auch die Differenzierung Funktion dieser Zellen. Der Ausdruck Niveaus des Agg (Knorpelzelltransplantation Marker), PPARγ (ein adipogenen Marker) und Runx2 (ein Marker der Osteoblasten) wurden hochreguliert induzierten Bedingungen. Diese Daten erwiesen sich als die multipotenten Differenzierung Fähigkeit des RbSF-MSCs in Trilineages (Abbildung 5).

Figure 1
Abbildung 1: volle schematische Darstellung der Isolierung, Reinigung und Charakterisierung von SF-MSCs von New Zealand white Kaninchen. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Protokoll für magnetische aktivierten Zelle Sortieren (MACS) mit CD90. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: Morphologie der Monolage kultivierten RbSF-MSCs vor und nach MACS wie unter gewöhnlichen untersucht invertiert Mikroskopie. A-C) Vor dem Sortieren Anzeigen der anhaftende Kaninchen synovial Flüssigkeit Zellpopulationen Heterogenität. Sie enthalten verschiedene Zelltypen und Größen, z. B. Oval, lang-Spindel, kurz-Spindel und Ganglion Morphologie. Die wichtigsten Morphologie der P2 und P6 ist eine Spindel-Morphologie (A: P2, B: P3, C: P6). D-F) Im Anschluss an MACS mit CD90 ausstellen der Zell-Populationen eine homogene Morphologie. Mit einer Subkultur, erhöht sich die Anzahl von Zellen (D: P2, E: P3, F: P6). Maßstabsleiste = 100 µm. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: Identifizierung von RbSF-MSC oberflächenmarker. Mit Flow-zytometrie-Analyse sind die RbSF-MSCs positiv für die MSC-Marker CD44 und CD105, während negativ für die Endothelzellen Marker CD34 und der hämatopoetischen Zellmarkierung CD45. Vor der MACS haben diese Zellen eine niedrige Rate von Positivität für CD44 und CD105. Jedoch war die Rate der Positivität nach MACS, hoch. A, B) Diese oberen zwei Bilder zeigen die Isotype Steuerungsdaten. C, D) Diese Ergebnisse zeigen, dass vor MACS RbSF-MSC-Bevölkerung von ca. 40 % MSC Zellen zusammengesetzt ist. E, F) Nach MACS enthält die angereicherte Bevölkerung > 99 % MSC Zellen. G, H) Diese Bilder zeigen die Flow Cytometry Analyse der das CD90+ Marker, (G) vor und (H) nach MACS sortieren. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5: Analyse der Abstammung-spezifische Marker durch Färbung und RT-PCR. (A) Alizarin rote Färbung zeigt, dass mineralisierte Knötchen unter der knochenbildenden Induktion für 3 Wochen bilden. B) nach 3 Wochen der adipogenen Induktion, die Anhäufung von lipidreichen Vakuolen erkannt wird von intrazellulären Öl Rot O-Färbung. C) für 3 Wochen der Chondrogenic Induktion, war die Zelle Pellet mit Toluidin blauer Färbung histologisch untersucht. Zellen, die positiv auf die Färbung (zu Proteoglykan) galten als Knorpelzelltransplantation-wie Zellen. Maßstabsleiste = 100 µm. D) nach Kultivierung für 3 Wochen, ermittelt die relative mRNA Expression von Osteoblasten Marker (Runx2), adipogenen Marker (PPARγ) und Chondrogenic-Marker (Agg) ist. Für alle Analysen p Werte < 0,01 galten als statistisch signifikante Unterschiede mit dem Kruskal-Wallis-Test (dargestellt als **). Bitte klicken Sie hier für eine größere Version dieser Figur.

Gene Grundierung (5'-3') zu übermitteln Reverse Primer (5'-3')
Runx2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
AGG GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARΓ2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

Tabelle 1: Liste der Gene und Grundierungen, die in dieser Studie für die quantitative Echtzeit-PCR verwendet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Das Vorhandensein von MSCs in Gelenkflüssigkeit bietet eine Alternative für zellbasierte Therapien. Frühere Studien haben gezeigt, dass Verletzungen Websites höhere Mengen an mesenchymalen Stammzellen in die Gelenkflüssigkeit enthalten, die mit dem posttraumatischen Periode5positiv korreliert werden kann. Die MSCs in Gelenkflüssigkeit können Gewebe für die Verbesserung der spontanen Heilung nach einer Verletzung18,19hilfreich sein. Die klinische Anwendung des SF-MSCs wurde selten in der Literatur berichtet, vor allem, weil die Mechanismen der SF-MSCs in Gelenken undefinierten20bleiben. Jones Et al.. 21 berichtet, dass hSF-MSC Zahlen in Kniegelenken 7-fach erheblich während der frühen Stadien von Osteoarthritis (OA). Sie dachten, dass die erhöhte SF-MSCs zur Aufrechterhaltung der physiologischen Homöostase der Gelenke beitragen könnten.

Eine ideale Tiermodell ist ein unverzichtbares Werkzeug in der Entwicklung von Therapeutika, die Nutzung regenerativer und Translationale Medizin. Obwohl gibt es offensichtliche Unterschiede zwischen Mensch und Kaninchen, das Kaninchen werden weitgehend als Tiermodell für die Untersuchung von Gewebe Regeneration7, somit aufgefordert uns zu wählen es als Vorbild für unser Studium der SF-MSCs verwendet. Eines der gewaltige Hindernisse in diesem Bestreben ist, dass ergibt sich die Isolierung der SF-MSCs oft in unterschiedlichen Erfolgsraten und niedrigen Kolonie Frequenzen, wie in früheren Forschung5berichtet. Daher haben zahlreiche Forscher auf die Erfolgsraten und Optimierung der Isolierung von MSCs aus SF konzentriert.

Diese Studyeffectively verwendet ein MACS Verfahren für hochreine Sortier- und Lebensfähigkeit der CD90+ MACSs von Kaninchen synovial Flüssigkeit22. Dieses System MACS nutzt magnetische Microbeads konjugiert an hochspezifische Antikörper gekoppelt an eine bestimmte Zelle Oberflächenantigen, CD90 in diesem Fall und ermöglicht die Auswahl des Zelltyps bestimmtes Ziel, nämlich CD90 mit dem Ausdruck ihrer Zellen. Vor der Reinigung mit CD90 Microbeads Kultur wir in der Regel die primäre RbSF-MSCs für 14 Tage. Während dieser Zeit entstehen viele Kolonien in den Kultur-Gerichten. Dieses Protokoll legt nahe, Auswahl der Kolonien, die größer als 2 mm im Durchmesser. Beim Klonen Zylinder für die Kolonie Auswahl beobachten wir genau unter die Lupe genommen. Die einzige Kolonie wird weiter zur Reinigung weitergegeben.

Während des Prozesses der Trennung und Reinigung werden die CD90 mit dem Ausdruck ihrer Zellen, die magnetisch beschriftet waren durch das Magnetfeld des Separators in der Spalte angezogen, während die unbeschrifteten Zellen durchlaufen. Nach dem Waschvorgang die Spalte wird das Magnetfeld des Separators entzogen, und die Zielzellen sind von der Säule eluiert. Dieser spezifische MACS Microbead Ansatz ermöglicht die Isolation der RbSF-MSCs, die speziell die Stammzell-oberflächenmarker CD44 und CD105, zeigen, dass diese isolierten Zellen mesenchymalen Stammzellen statt hämatopoetischen Zellen23ausgedrückt. Diese gereinigten RbSF-MSCs können kultiviert in Vitro über eine lange Zeit ohne jede wesentliche Änderung der morphologischen Merkmale und Marker Ausdruck sein. Darüber hinaus weisen die RbSF-MSCs angereichert mit MACS eine multipotenten Differenzierung Fähigkeit in Multi-Linie, auch in Chondrogenic, adipogenen und osteogene Zellen Zellen.

Der Betrieb des MACS ist ein Protokoll zu führen und auf der Bank23durchgeführt werden kann. Darüber hinaus die US Food and Drug Administration (FDA) genehmigt die MACS Microbead-Technologie, und so ist es einfach für klinische Anwendungen24durchzuführen. CD90 ist ein Surface Marker von mesenchymalen Stammzellen, und Forscher haben gezeigt, dass positive MSCs CD90 eine bessere Chondrogenic Differenzierung Fähigkeit25,26. Die Pluripotenz der MSCs ist anhand der Morphologie und der Ausdruck spezifischer Marker für Stammzellen27charakterisiert worden.

Diese Studie hat einige Einschränkungen. Das erste Manko dieses Protokolls bezieht sich auf die oberflächenmarker, die wir untersucht. Basierend auf eine Aussage von der internationalen Gesellschaft für zelluläre Therapie (ISCT), die minimale Kriterien für die Definition von multipotenten MSCs ist für CD90, CD105, CD44 und CD73 positiv und negativ für CD11b, CD14, CD34 CD45, CD79a oder und HLA-DR-28. Mit dem Ziel der Minderung der Aufwand und die Kosten erforderlich, um das gesamte Panel testen Forscher in dieser Studie sorgfältig ausgewählten zwei negative Marker und der positiven Marker empfohlen. Zweitens dauert es lange, bis die Kolonien bilden, die für weitere Studie ausgewählt werden. Darüber hinaus ist Hypertrophie eines der Hauptprobleme während Chondrogenic Induktion von SF-MSCs in Vitro. In der späteren Phase der hypertrophen Chondrozyten immer express Typ X Kollagen (COLX), Matrix-Metalloproteinase 13 (MMP13) Faktor alkalische Phosphatase (ALP) und Zwerg-bezogene Transkription 2 (Runx2)29. Untersuchungen zeigen, dass die dreidimensionale (3D) Pellet-Kultur, dynamische Systeme und Coculture mit Chondrozyten Vorteile für MSC stabil sind Chondrogenic Differenzierung30,31. In dieser Studie wurde ein Pellet-Kultur-System für Chondrogenic Induktion von MSC zur Hypertrophie zu vermeiden.

Zusammenfassend haben wir eine einfache Methode zur Isolierung und Reinigung von MSCs aus dem Gelenk Hohlraum Spülung Fluid gegründet und zeichnet sich die MSCs darin erhalten. Dieses Protokoll hat eine Plattform für die Erforschung und Untersuchung der Gelenkknorpel synovial Flüssigkeit abgeleitet MSCs potenziellen Nutzen in neuartigen gemeinsame Regenerationsstrategien zur Verfügung gestellt.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, dass sie keine finanziellen Interessenkonflikte.

Acknowledgments

Diese Studie wurde finanziell unterstützt durch die folgende Zuschüsse: Natural Science Foundation of China (Nr. 81572198; (Nr. 81772394); der Fonds für hohe Niveau medizinische Disziplin Bau von Shenzhen-Universität (Nr. 2016031638); die medizinische Forschung Grundlage der Guangdong Provinz, China (Nr. A2016314); Shenzhen-Wissenschaft und Technologie-Projekte (No. JCYJ20170306092215436; Nein. JCYJ20170412150609690; Nein. JCYJ20170413161800287; Nein. SGLH20161209105517753; Nein. JCYJ20160301111338144).

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics