Magnetische-geactiveerde cel sorteren van strategieën om te isoleren en zuiveren van de synoviale vloeistof afkomstige mesenchymale stamcellen uit het Model van een konijn

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dit artikel presenteert een eenvoudige en economische protocol voor het eenvoudig isolatie en zuivering van mesenchymale stamcellen uit Nieuw-Zeeland wit konijn gewrichtsvocht.

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mesenchymale stamcellen (MSCs) zijn de bron van de belangrijkste cel voor cel-gebaseerde therapie. MSCs van articulaire holte gewrichtsvocht zou kunnen worden gebruikt voor weefselengineering van kraakbeen. MSCs van gewrichtsvocht (SF-MSCs) zijn veelbelovende kandidaten voor articulair regeneratie beschouwd heeft, en hun potentiële therapeutische voordeel hen een belangrijk onderzoeksonderwerp van laat. SF-MSCs uit de holte van de knie van het Nieuw-Zeeland wit konijn kunnen worden ingezet als een geoptimaliseerde translationeel model te beoordelen van menselijke regeneratieve geneeskunde. Door middel van CD90 gebaseerde magnetische geactiveerde cel sorteren (MACS) technologieën, dit protocol met succes verkrijgt konijn SF-MSCs (rbSF-MSCs) van dit model konijn en volledig toont verder het fenotype van de MSC van deze cellen door het inducerende hen om te differentiëren naar Botcellen, adipocytes en chondrocyten. Daarom kan deze aanpak worden toegepast in het onderzoek van de biologie van de cel- en weefseltechnologie met behulp van eenvoudige apparatuur en procedures.

Introduction

MSCs hebben gesuggereerd als een waardevolle bron voor regeneratieve geneeskunde, vooral voor kraakbeen letsels. MSCs, met inbegrip van de chondrocyten, botcellen, adipocytes, skelet myocytes en viscerale stromale cellen, expand in grote lijnen de gebieden voor stamceltransplantatie vanwege hun hoge uitbreiding tarief en multi lineage differentiatie potentiële1. MSCs kunnen worden geïsoleerd uit de skeletal muscle, synovia, beenmerg en adipeus weefsel2,3,4. Bevindingen hebben ook confirmed de aanwezigheid van MSCs in het gewrichtsvocht, en vorige onderzoek synoviale vloeistof afkomstige MSCs (SF-MSCs) heeft geïdentificeerd als veelbelovende kandidaten voor articulair regeneratie5,6.

Onderzoek en preklinische experimenten met menselijke specimens zijn echter onderworpen aan veel ethische kwesties. In plaats daarvan, konijnen geweest en blijven de meest gebruikte diersoorten om aan te tonen dat de transplantatie van MSCs kraakbeenletsels kan repareren. In de afgelopen jaren een stijgend aantal onderzoekers hebben bestudeerd konijn mesenchymale stamcellen (rbMSCs) beide in vitro en in vivo, als deze cellen zijn vergelijkbaar met menselijke MSCs in hun cellulaire biologie en weefsel fysiologie. Ook zijn de rbMSCs geschikt voor het vasthouden aan kunststofoppervlakken, spindel-fibroblast morfologie in menselijke MSCs weergeven. Bovendien, konijn mesenchymale monsters zijn eenvoudig en gemakkelijk te verkrijgen van7. Bovendien, zijn de meest cruciale punten dat rbMSCs express oppervlakte markers, zoals CD44, CD90 en CD105, en dat de potentiële multi lineage-differentiatie is bewaard gebleven, die is in overeenstemming met de criteria voor de identificatie van MSC populaties als gedefinieerd door de International Society for cellulaire therapie8,9. In het bijzonder de synoviale vloeistof chondroprogenitors staat niet-hypertrofische chondrogenesis wanneer geïnduceerd door TGF-β1, waardoor ze geschikt mobiele bronnen voor fenotypische articulair kraakbeen regeneratie10,11, zijn 12.

Het isolement van de SF-MSCs verschilt echter sterk van andere weefsels, met inbegrip van de navelstreng, adipeus weefsel, perifeer bloed en beenmerg. Momenteel zijn de meest voorkomende benaderingen voor de zuivering en sortering van SF-MSCs stroom cytometry en immunomagnetic kraal gebaseerde sorteren, hoewel de stroom cytometry methode een specifieke omgeving en zeer dure instrumenten13 vereist.

Dit artikel presenteert een procedure voor het eenvoudig en minimaal invasieve collectie van monsters van synoviale vloeistof uit Nieuw-Zeeland witte konijnen. Tijdens de procedure, de rbSF-MSCs zijn stabiel uitgevouwen in vitro en vervolgens geïsoleerd met CD90 positieve magnetische kraal gebaseerde procedures. Tot slot, het protocol laat zien hoe MSCs met een hoge zuiverheid en de levensvatbaarheid van de geoogste cel bronnen verkrijgen.

In dit protocol worden de geïsoleerde rbSF-MSCs gekenmerkt op basis van hun morfologie, de expressie van specifieke markers en pluripotent voor stamcellen. Stroom cytometry gebaseerde immunophenotyping blijkt een aanzienlijke positieve uitdrukking van CD44 en CD105, overwegende dat de uitdrukking van CD45 en de CD34 negatief is. Tot slot, een in vitro assay voor rbSF-MSCs toont de differentiatie van het osteogenic, adipogenic en chondrogenic van deze cellen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle dierproeven zijn uitgevoerd met inachtneming van de richtsnoeren inzake regionale ethische Commissie, en alle dierlijke procedures werden goedgekeurd door de institutionele Animal Care en gebruik Comité van Shenzhen tweede People's Hospital, Universiteit Shenzhen.

1. isoleren en cultuur van de rbSF-MSCs

  1. Voorbereidingen voor de dierlijke procedure
    1. Bereiden van vrouwelijke Nieuw-Zeeland schouderfunctie witte konijnen voor de inzameling van rbSF-MSCs. uitvoeren van een klinisch onderzoek van de konijnen een dag voorafgaand aan de narcose en arthrocentesis procedure.
      Opmerking: er zijn lichamelijke onderzoeken dient gewicht (2.0-2.5 kg), geslacht (vrouw), en lichaamstemperatuur, ademhaling en hartslag. Met de parameter intervallen voor klinisch gezonde konijnen zijn 30-50 min. voor ademhalingsfrequentie, 220-280 min voor hartslag en 38-39 ° C voor lichaamstemperatuur.
    2. Snel de dieren gedurende 6 uur voordat de verdoving.
  2. Voorbereidingen en de procedure voor de dierlijke anesthesie
    1. Beperken van het konijn met een kooi (Zie Tabel of Materials), en dan 3% pentobarbital natrium te injecteren in de ader van de marginale oor bij een dosis van 1 mL/kg voor de narcose.
    2. Plaats het konijn in een comfortabele dorsal-lig positie.
    3. Het volgen van de ademhaling, hartslag en lichaamstemperatuur van het konijn tijdens anesthesie.
    4. Oogheelkundig zalf op zijn ogen gebruiken om te voorkomen dat droogte tijdens anesthesie.
    5. De diepte van de verdoving na Guedel de classificatie14te beoordelen.
  3. Voorbereiding voor MSCs isolatie en teelt
    1. Voorbereiden om te cultiveren rbSF-MSCs, 500 mL commerciële kweekmedium (Zie Tabel van materialen) aangevuld met 10% commerciële aanvulling (Zie Tabel of Materials), 10% foetale runderserum (FBS), en 1% penicilline-streptomycine.
    2. Incubeer bij 37 ° C in een waterbad voedingsbodem.
    3. 500 mL fosfaat buffer zoutoplossing (PBS) voorbereiden van isolatie van de cel en de cel wassen.
    4. 100 mL isotone zoutoplossing voorbereiden op de knie holte arthrocentesis procedure.
  4. Collectie van articulaire synoviale omkaderd uid van de knie van het konijn
    1. Selecteer een gebied ongeveer 5 x 5 cm in omvang rond de knie en scheren van het haar konijn uit dit gebied met behulp van een elektrisch scheerapparaat van veiligheid.
    2. Afwisselend, Desinfecteer de procedure site 3 x met Povidon jodium oplossing en 75% ethanol. Vervolgens passen steriele gordijnen nadat het gebied grondig is opgedroogd.
    3. Injecteer 1-2 mL isotone zoutoplossing, met behulp van een steriele hypodermische spuit (2 mL), in de gezamenlijke holte van de knie van de laterale articulaire ruimte, bewegen van de knie 3-4 x, en vervolgens zuigen uit alle de synoviale vloeistof bij kamertemperatuur.
    4. Filtreer de synoviale fluid door een 40 µm nylon cel zeef te verwijderen elke puin binnen 4 uur.
  5. Cultuur van de rbSF-MSCs
    1. Het verzamelen van de gefilterde fluid in 50 mL centrifuge buizen en centrifugeer bij 1500 omwentelingen per minuut gedurende 10 minuten bij kamertemperatuur.
    2. Verwijder het supernatant na het centrifugeren, wassen van de pellet met PBS resuspendeer de pellet met het volledige kweekmedium en vervolgens plaat het medium in 100 mm gerechten.
    3. Incubeer bij 37 ° C in een bevochtigde sfeer met 5% CO2gerechten.
    4. Na 48u, vullen de gerechten met verse medium voor het verwijderen van niet-aanhanger cellen. Vervang het medium tweemaal per week voor 2 weken als passage 0 (P0).
      Opmerking: Er dient ongeveer 1 x 104 Adherente cellen. Levensvatbare cellen/ml in SF zijn ongeveer 2 x 102/mL.
    5. Na 14 dagen na het eerste laagje, moeten veel koloniën hebben gevormd in de cultuur-gerechten. Selecteer de kolonies die groter zijn dan 2 mm in diameter. Markeren waar de geselecteerde kolonies bevinden zich door het traceren van hun omtrek aan de onderkant van de schotel.
    6. Gooi de kolonies < 2 mm breed, met behulp van cel schrapers. De geselecteerde kolonies met ongeveer 5 µL van 0,25% trypsine, met behulp van een klonen cilinder, verteren en de koloniën overbrengen in een nieuwe schotel als passage 1 (P1).
  6. Post-operatieve dierenverzorgers
    1. Volg institutionele operationele standaardprocedures voor postoperatieve bewaking en herstel van anesthesie.
    2. Volgen de vitale tekenen van het konijn iedere 10 minuten totdat het bewustzijn heeft herwonnen. Daarna kopieert u het bewuste dier naar de kooi. Een konijn dat heeft ondergaan chirurgie aan het gezelschap van andere dieren tot het volledig is hersteld niet terugkeren.
    3. Na operatie, desinfecteren van de site met 0,1% Povidon jodium, 2 x per dag gedurende 3 dagen.

2. CD90-positieve magnetische geactiveerd cel sorteren (MACS) van de rbSF-MSCs en primaire cultuur

  1. Bereiding van de monsters
    1. Wanneer de cellen bereiken rond 80% confluentie, gecombineerd het medium, en voeg vervolgens 1-2 mL van 0,25% trypsine-EDTA aan elk gerecht.
    2. Incubeer de gerechten voor 2-3 min om mobiele-detachement.
    3. Zodra de cellen worden losgemaakt, voeg een gelijke hoeveelheid van het kweekmedium aan de inactivering van de trypsine.
    4. De celsuspensie passeren een 40 µm cel zeef, Vang het filtraat op in een tube van 15 mL en draai vervolgens beneden de cellen bij 600 × g gedurende 10 minuten bij kamertemperatuur.
    5. Resuspendeer de pellet cel in MACS met buffer (PBS, pH 7,2, 0,5% bovien serumalbumine en 2 mM EDTA) en dan het aantal cellen te tellen.
  2. Magnetische etiketten
    Opmerking: Sorteren de rbSF-MSCs met een magnetische-geactiveerde cel Sorteren kit met kolommen, een stand, en scheidingstekens (Zie Tabel van materialen).
    1. Het nummer van de cel met behulp van een hemocytometer te bepalen.
    2. Centrifugeer de celsuspensie bij 300 × g gedurende 10 minuten bij 4 ° C. Volledig gecombineerd het supernatant.
    3. Voeg 80 µL van resuspensie buffer per 107 totaal aantal cellen.
    4. Voor 107 totaal aantal cellen, Voeg 20 µL van microbeads geconjugeerd met een monoklonaal anti-konijn CD90 antilichaam.
    5. Meng de magnetische kralen en cellen gelijkmatig in de buizen, dan hen bij 4 ° C gedurende 15 min. in het donker uit te broeden.
    6. Voeg 1 mL buffer per 107 cellen aan de buis en het vervolgens Centrifugeer bij 300 × g gedurende 10 minuten bij 4 ° C te wassen van de cellen. Verwijder het supernatant na het centrifugeren.
    7. Resuspendeer de pellet in 500 µL van buffer per 107 cellen.
  3. Magnetische scheiding
    1. De kolom met de vleugels van de kolom aan de voorzijde in het magnetisch veld van de Magneet separator plaatsen.
    2. Spoel de kolom magnetische scheidingsteken (MS) met 500 µL van de buffer per 107 cellen.
    3. Spoel de suspensie van één cel in de kolom. Laat de negatieve cellen passeren van het magnetisch veld te ontdoen van deze labelloze cellen.
    4. Was de kolom 1-2 x met 500 µL van de buffer per 107 cellen en gooi de doorstroming.
    5. Breng de kolom in een centrifugebuis (15 mL).
    6. 1 mL van de buffer per 107 cellen toevoegen aan de kolom en vervolgens onmiddellijk duw de zuiger in de kolom te spoelen van de magnetisch gelabelde cellen.
    7. Herhaal de bovengenoemde procedure met een tweede MS-Column om de zuiverheid van CD90+ cellen, die de eluted fractie kunnen verrijken.
    8. Centrifugeer de celsuspensie bij 300 × g gedurende 10 min, gecombineerd het supernatant en resuspendeer het met het kweekmedium.
  4. Cultuur van de CD90+ rbSF-MSCs
    1. Inoculeer cellen in 100 mm gerechten na het magnetische geactiveerde cel sorteren.
    2. Incubeer bij 37 ° C in een broedstoof bevochtigde cel met 5% CO2gerechten.
    3. Wanneer de samenvloeiing van de 80-90% van de primaire cultuur wordt bereikt, op ongeveer 7-10 dagen, verteren de Adherente cellen met 0,25% trypsine-EDTA en passage hen bij een verdunning 1:2 te maken passage 2 (P2).
    4. Gebruik dezelfde methode om door te geven van de cellen aan de passage 3 (P3), die kunnen worden gebruikt voor het in vitro testen.
      Opmerking: Na de subcultuur en zuivering, ongeveer 1 x 107 rbSF-MSCs worden verkregen.

3. identificatie van rbSF-MSCs

  1. Oppervlakte marker bevestiging van de rbSF-MSCs door stroom cytometry
    1. Wanneer de MSCs 80-90% heuvels op P3, wassen van de cellen met PBS en behandelen met 0,25% 1 mL trypsine-EDTA. Vervolgens, Incubeer de MSCs bij 37 ° C gedurende 2-3 minuten totdat de cellen zijn vrijstaand.
    2. Oogsten van de cellen met behulp van 10 mL PBS, ze vervolgens overbrengen naar een conische buis (15 mL) en centrifugeer ze bij 300 × g gedurende 5 minuten bij kamertemperatuur.
    3. Gooi het supernatant. Resuspendeer de pellet cel in 500 µL van PBS en breng dit in een 1,5 mL-buis.
    4. Incubeer een 1:100 verdunning van het FITC-geconjugeerd en PE-geconjugeerde antilichamen (isotype, FITC-CD34/PE-CD45, FITC-CD105/PE-CD44) gedurende 1 uur in het donker bij 4 ° C.
    5. Centrifugeer dit mengsel bij 300 × g gedurende 5 minuten bij kamertemperatuur en de cellen tweemaal met PBS door centrifugeren bij 300 × g gedurende 5 minuten elke keer wassen. Gooi het supernatant.
    6. Resuspendeer de cellen in 500 µL van PBS, de celsuspensie overboeken naar een ronde-onderkant-buis (5 mL) en analyseren met behulp van een cytometer stroom.
      Opmerking: Verwerven gegevens over een cytometer uitgerust met twee kanalen van de fluorescentie: 533/30 en 585/40. Elke isotype fluorescentie, het besturingselement isotype kruisspanning passende laser, en stel de minimale intensiteit vereist voor het verkrijgen van een fluorescentie-histogram waarin zowel linker- en rechterrand van de piek. Verzamel minimaal 10.000 gebeurtenissen voor de statistische analyses.
  2. Multidifferentiation van de rbSF-MSCs
    Opmerking: Gebruik P3 rbSF-MSCs voor de tests in vitro multidifferentiation.
    1. Osteogenic differentiatie
      1. Bereiden van het medium osteogenic inductie: DMEM basic (1 x) met 50 mM van L-ascorbinezuur zuur-2-fosfaat, 10 mM van α-glycerophosphate en 100 nM van dexamethason.
      2. Zaad van de cellen op 103 cellen/cm2 in een 6-well weefselkweek plaat en cultuur hen in het medium osteogenic inductie.
      3. Wijzig het inductie-medium om de 3 dagen voor 3 weken.
      4. Herstellen van de cellen met de 4% formaldehyde gedurende 30 minuten bij kamertemperatuur, nadat de differentiatie is voltooid, de cellen vlek met 1% Alizarine rood voor 5 minuten, en daarna wassen ze 3 x met PBS15.
    2. Adipogenic differentiatie
      1. Bereiden van het medium van de inductie adipogenic: DMEM basic (1 x), bestaande uit 100 mM indomethacin, 10 mg/mL recombinante menselijke insuline, 1 mM van dexamethason en 0,5 mM 3-isobutyl-1-methylxanthine.
      2. De P3 rbSF-MSCs voor 3 weken in het medium van de inductie adipogenic behandelen.
      3. Na 3 weken, vlek de neutrale lipide vacuolen olie Red O met de differentiatie van de adipogenic bevestigen. Bevestigen van de cellen in een 4% formaldehyde-oplossing gedurende 30 minuten bij kamertemperatuur, en dan was ze 3 x met PBS16.
    3. Chondrogenic differentiatie
      1. Bereiden van het medium van de inductie chondrogenic: DMEM basic (1 x), bestaande uit de 10 ng/mL TGFβ1, 1% zijn supplement, L-proline, 100 nM van dexamethason, 50 mM van L-ascorbinezuur zuur-2-fosfaat, en 1 mM van natrium pyruvaat 0.35 mM.
      2. Gebruik pellet kweken voor de chondrogenic-inductie. Centrifugeer 5 × 105 P3 rbSF-MSCs bij 1500 omwentelingen per minuut gedurende 10 minuten in een polypropyleen buis (15 mL) vormen een pellet.
      3. De pellets voor 3 weken met het medium van de inductie chondrogenic cultuur.
      4. Wijzig het medium om de 3 dagen voor 3 weken.
      5. Na 3 weken inductie, insluiten de cel pellet met paraffine, deel het in 4 mm plakjes en vlek met behulp van 0,1% toluïdine blauw gedurende 30 minuten bij kamertemperatuur17.
  3. Totaal RNA extractie en analyse door kwantitatieve real-time polymerasekettingreactie (qRT-PCR)
    1. Isolaat totaal RNA van cellen na 3 weken differentiatie inductie met behulp van de commerciële RNA extractie kit (Zie Tabel van materialen).
      1. Verwijder het kweekmedium in de cultuur-schotel en voeg vervolgens 1 mL van isolatie reagens.
      2. Lyse de cellen door herhaalde pipetteren totdat de oplossing is een homogeen. Na het bebroeden bij kamertemperatuur gedurende 3 minuten.
      3. Breng de cel lysate in een tube van 1,5 mL microcentrifuge.
      4. Voeg 100 µL van chloroform, schud het met de hand 15 x en Incubeer het mengsel bij kamertemperatuur gedurende 3 minuten.
      5. Centrifugeer de buis bij 12.000 × g gedurende 15 min bij 4 ° C. Breng het supernatant in een nieuwe 1,5 mL microcentrifuge buis.
      6. Voeg 500 µL van isopropanol en neerslag van het RNA gedurende 10 minuten bij kamertemperatuur.
      7. Centrifuge op 12.000 × g voor 10 minat 4 ° C. De RNA-pellet moet worden weergegeven aan de onderkant van de buis.
      8. Verwijder het supernatant en voeg vervolgens 500 µL van 75% ethanol. Kort draaien de buis gedurende enkele seconden om te wassen van de RNA-pellet. Centrifugeer het bij 7.500 × g gedurende 5 min bij 4 ° C.
      9. Verwijder de resterende ethanol.
      10. Los van de RNA-pellet in 10 µL van DEPC water en plaats de buizen op ijs.
    2. Omgekeerde transcriberen totaal RNA in cDNA met een DNA-herstelsynthese kit (Zie Tabel van materialen).
      Opmerking: Alle de volgende procedures uitvoeren op ijs.
      1. De master mix van omgekeerde transcriptie voor te bereiden.
      2. Voeg 25 µL van RNA DNase behandeld aan elke buis met 1 microgram van RNA.
      3. Incubeer het mengsel bij de volgende temperaturen met behulp van een PCR thermische cycler: 26 ° C gedurende 10 min (voor de willekeurige hexamers te gloeien), 42 ° C voor 45 min (reverse transcriptie) en 75 ° C gedurende 10 minuten (aan de inactivering van de reverse-transcriptase).
      4. Onmiddellijk de resulterende cDNA door kwantitatieve PCR in real time analyseren of opgeslagen bij-20 ° C.
    3. Het gen expressie analyses uitvoeren met een kwantitatieve real-time PCR-systeem.
      1. QRT-PCR Master Mix gebruiken (Zie Tabel of Materials) voor het uitvoeren van PCR. De PCR inleidingen voor de GAPDH, Runx2, Agg en PPARγ zijn vermeld in tabel 1.
      2. Bereken met behulp van de methode van deΔΔCT 2genexpressie.
      3. Voeren een statistische analyse met behulp van statistische standaardsoftware. Gebruik een onafhankelijke sample t-test te vergelijken van de groep betekent.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Isolatie, zuivering en cultuur van de rbSF-MSCs:
Dit protocol maakt gebruik van MACS te isoleren rbSF-MSCs, gebaseerd op de expressie van de MSC oppervlakte markering CD90. Een processtroomdiagram rbSF-MSCs isolatie, zuivering, karakterisering en het in vitro cultuur protocol is afgebeeld in Figuur 1.

De morfologie van de cel na magnetische geactiveerde cel sorteren (MACS) met CD90:
In de eerste plaats voor MACS, immunolabel MSCs met CD90 magnetische kralen. Na het centrifugeren, een maximum van 107 cellen in 80 µL van een precooled sorteren buffer resuspendeer en voegt u 20 µL van CD90 magnetische kralen, gevolgd door vortexing en incubatie bij 4 ° C gedurende 15 minuten. Daarna wassen van de cellen met 1 mL van de sorteer buffer en resuspendeer hen in 500 µL van de sorteer buffer. Herhaal de wassen stap voordat u verdergaat met de magnetische sorteren. Deze kritische procedure is afgebeeld in Figuur 2.

Voordat u sorteert weergegeven de bevolking van de synoviale vloeistof cel aanhangend konijn heterogene morfologie, met diverse celtypes en maten (figuur 3A-C). Naar aanleiding van MACS tentoongesteld de cel populaties homogene morfologie. Het celaantal werd verhoogd met subcultuur (figuur 3D-F).

Oppervlakte kenmerken van MACS verrijkte rbSF-MSCs:
Fluorescentie-Activated Cell Sorting (FACS) werd uitgevoerd voor het analyseren van de verrijking van rbSF-MSCs door MACS met CD90. Voorafgaand aan de MACS bestond de celpopulatie uit ongeveer 40% MSCs (figuur 4CD; isotype besturingselementen in figuur 4A,B). Naar aanleiding van MACS bevatte de verrijkte bevolking ongeveer > 99% MSCs (figuur 4E,F). De markeringen van hematopoietische lineage cel CD34 en CD45, op 0.318%, beide zelden geuit na MACS, dat is een daling van hun eerste uitdrukking bij 25,9%. Vóór selectie, waren er ongeveer 28% CD90+ cellen (Figuur 4 g); na zuivering, ongeveer 98% CD90+ cellen werden verkregen (Figuur 4 H).

Multilineage differentiatie mogelijkheden van rbSF-MSCs:
Kenmerkt de capaciteit van rbSF-MSCs te onderscheiden in de verschillende geslachten, zoals osteogenic, adipogenic en chondrogenic cellen, de rbSF-MSCs verrijkt door MACS werden gelijktijdig gekweekt in een specifieke differentiatie medium en in een differentiatie medium zonder cytokine om te dienen als besturingselementen. Wanneer de inductie was voltooid, geslacht-specifieke markeringen werden geanalyseerd door de kleuring en RT-PCR. Alizarine rode kleuring van calcium verbindingen aangetoond dat gemineraliseerde knobbeltjes in de rbSF-MSCs hadden gevormd na 3 weken onder de voorwaarden van de osteogenic inductie (figuur 5A). Na 3 weken van adipogenic inductie, kon een opeenstapeling van lipide-rijke vacuolen worden opgespoord door intracellulaire olie Red O kleuring (figuur 5B). Voor 21 dagen van chondrogenic inductie, was de cel pellet histologisch vehiculumcontrolegroep met toluïdine blauw kleuring. Cellen positief voor de kleuring (naar Proteoglycaan) werden beschouwd als chondrocyten-achtige cellen (figuur 5C). Vergelijkbaar met dit resultaat, een kwantitatieve analyse van de genexpressie van differentiatie potentiële bewees ook het vermogen van de differentiatie van deze cellen. De niveaus van de expressie van Agg (een marker van de chondrocyten), PPARγ (een marker van de adipogenic) en Runx2 (een osteoblast marker) werden upregulated geïnduceerde omstandigheden. Deze gegevens bleken de multipotente differentiatie mogelijkheden van rbSF-MSCs in trilineages (figuur 5D).

Figure 1
Figuur 1: volledige schema van isolatie, zuivering en karakterisering van de SF-MSCs van Nieuw-Zeeland witte konijnen. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: Protocol voor magnetische geactiveerde cel sorteren (MACS) met CD90. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: morfologie van de enkelgelaagde gekweekte rbSF-MSCs vóór en na de MACS onderzocht onder gewone ondersteboven microscopie. A-C) De bevolking van de synoviale vloeistof cel aanhangend konijn weergeven voordat u sorteert, heterogeniteit. Ze bevatten diverse celtypes en maten, zoals ovaal, lang-spindle en korte-spindle Notti morfologie. De belangrijkste morfologie van P2 en P6 is de morfologie van een spindel (A: P2, B: P3, C: P6). D-F) Na MACS met CD90 vertonen de populaties van de cel een homogene morfologie. Met een subcultuur, verhoogt het celaantal (D: P2, E: P3, F: P6). Schaal bar = 100 µm. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: identificatie van rbSF-MSC oppervlakte markeerders. Met behulp van stroom cytometry analyse, zijn de rbSF-MSCs positief voor de MSC markers CD44 en CD105, terwijl negatief voor de markering endothelial cel CD34 en de hematopoietische cel markering CD45. Voorafgaand aan de MACS hebben deze cellen een lage snelheid van positiviteit voor CD44 en CD105. Echter na MACS was het tarief van positiviteit hoog. A, B) Deze top twee beelden tonen de controlegegevens isotype. C, D) Deze resultaten blijkt dat de bevolking van de rbSF-MSC voor MACS is samengesteld uit ongeveer 40% MSC cellen. E, F) Na MACS bevat de verrijkte bevolking > 99% MSC cellen. G, H) Deze beelden tonen de stroom cytometry analyse van de CD90+ marker, (G) vóór en (H) na MACS sorteren. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5: analyse van geslacht-specifieke markers door kleuring en RT-PCR. A) Alizarine rode kleuring aantoont dat gemineraliseerde knobbeltjes onder de osteogenic inductie voor 3 weken vormen. B) na 3 weken van adipogenic inductie, de accumulatie van lipide-rijke vacuolen wordt gedetecteerd door intracellulaire olie Red O kleuring. C) voor 3 weken van chondrogenic inductie, was de cel pellet histologisch vehiculumcontrolegroep met toluïdine blauw kleuring. Cellen positief voor de kleuring (naar Proteoglycaan) werden beschouwd als chondrocyten-achtige cellen. Schaal bar = 100 µm. D) na het kweken voor 3 weken, de relatieve mRNA uitdrukking van osteoblast markeringen (Runx2), adipogenic markeringen (PPARγ) en chondrogenic-markeringen (Agg) is gedetecteerd. Voor alle analyses, p waarden < 0.01 werden beschouwd als statistisch significante verschillen met de Kruskal-Wallis-test (weergegeven als **). Klik hier voor een grotere versie van dit cijfer.

Genen Toekomen primer (5'-3') Omgekeerde primer (5'-3')
Runx2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
AGG GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARΓ2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

Tabel 1: Lijst van genen en gebruikt in deze studie voor kwantitatieve real-time PCR inleidingen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Het bestaan van MSCs in gewrichtsvocht biedt een alternatief voor cel-gebaseerde therapie. Eerdere studies hebben aangetoond dat letsel sites bevatten hogere hoeveelheden mesenchymale stamcellen in hun gewrichtsvocht, die positief kunnen worden gecorreleerd met de periode van na letsel5. De MSCs in gewrichtsvocht kunnen zinvol zijn om weefsel voor het verbeteren van de spontane genezing na een letsel18,19. De klinische toepassing van SF-MSCs is zelden gecoverd in de literatuur, vooral omdat de mechanismen van de SF-MSCs in gewrichten ongedefinieerd20 blijven. Jones et al. 21 gemeld dat hSF-MSC getallen in knie gewrichten aanzienlijk 7-fold verhogen tijdens de vroege stadia van osteoartritis (OA). Zij dachten dat de verhoogde SF-MSCs zou kunnen bijdragen aan het behoud van de fysiologische homeostase van gewrichten.

Een ideale diermodel is een onmisbaar hulpmiddel bij de ontwikkeling van therapeutics met behulp van regeneratieve en translationeel geneeskunde. Hoewel er duidelijke verschillen bestaan tussen mensen, konijnen en het konijn wordt uitgebreid gebruikt als een dierlijk model voor de studie van weefsel regeneratie7, dus te vragen ons te kiezen als het model voor onze studie van de SF-MSCs. Een van de meer ontmoedigende obstakels in dit streven is dat de isolatie van SF-MSCs vaak in gevarieerde slagingspercentages en lage kolonie frequenties resulteert, zoals gemeld in vorige onderzoek5. Daarom, talrijke onderzoekers hebben gericht aan de slagingspercentages en de optimalisatie van de isolatie van MSCs van SF.

Deze studyeffectively gebruikt een MACS-procedure voor hoge sorteren zuiverheid en levensvatbaarheid van CD90+ MACSs van konijn synoviale vloeistof22. Dit MACS-systeem maakt gebruik van magnetische microbeads geconjugeerd met zeer specifieke antilichamen, gekoppeld aan een bepaalde cel oppervlakte-antigeen, CD90 in dit geval, en zorgt voor de selectie van het specifieke doelorgaan celtype, namelijk CD90 waarin cellen. Voordat de reiniging met CD90 microbeads cultuur we meestal de primaire rbSF-MSCs voor 14 dagen. Tijdens deze periode, worden veel kolonies gevormd in de cultuur-gerechten. Dit protocol stelt de kolonies die groter zijn dan 2 mm diameter selecteren. Wanneer u de klonen cilinder voor de selectie van de kolonie, observeren wij het zorgvuldig onder de loep. De één kolonie wordt verder doorgegeven voor de zuivering.

Tijdens het proces van scheiding en zuivering, worden de CD90 waarin cellen die magnetisch waren gelabeld aangetrokken door het magnetisch veld van de scheidingslijn in de kolom, overwegende dat de labelloze cellen doorstromen. Na het wassen proces, wordt de kolom verwijderd uit het magnetische veld van het scheidingsteken geplaatst, en de doelcellen zijn geëlueerd uit de kolom. Deze specifieke MACS microbead benadering biedt het isolement van rbSF-MSCs die specifiek de stamcel oppervlakte markers CD44 en CD105, waaruit blijkt dat deze geïsoleerde cellen mesenchymale stamcellen in plaats van hematopoietische cellen23uitgedrukt. Deze gezuiverde rbSF-MSCs kunnen gekweekt in vitro over een lange tijd zonder enige significante verandering van morfologische kenmerken en marker expressie. Bovendien, de rbSF-MSCs verrijkt door MACS vertonen een vermogen van multipotente differentiatie in meerdere lineage cellen, met inbegrip van in chondrogenic, adipogenic en osteogenic cellen.

De werking van de MACS is een gemakkelijk-te-voeren-protocol en kan worden gedaan op de Bank23. Bovendien, de Amerikaanse Food and Drug Administration (FDA) heeft goedgekeurd de MACS microbead gebaseerde technologie, en is daarom gemakkelijk uit te voeren voor klinische toepassingen24. CD90 is een oppervlakte marker van mesenchymale stamcellen, en onderzoekers hebben aangetoond dat CD90 positieve MSCs een betere chondrogenic differentiatie vermogen25,26 hebben. De pluripotent van MSCs was gekenmerkt op basis van morfologie en de expressie van specifieke markers voor stamcellen27.

Deze studie heeft verscheidene beperkingen. De eerste tekortkoming van dit protocol is gerelateerd aan de oppervlakte markers die we onderzocht. Op basis van een verklaring door de International Society voor cellulaire therapie (ISCT), de minimale criteria voor het definiëren van multipotente MSCs is positief voor de CD90, CD105, CD44 en CD73, en negatief voor de CD11b, CD14, CD34 of CD45, en CD79a of HLA-DR28. Met het doel om de inspanningen en de kosten die nodig zijn voor het testen van het gehele paneel te verzachten, onderzoekers in deze studie zorgvuldig geselecteerd twee van de negatieve markers en twee van de positieve markers aanbevolen. Ten tweede, duurt het een lange tijd om te vormen van de koloniën die worden geselecteerd voor verdere studie. Daarnaast, is hypertrofie een groot probleem tijdens chondrogenic inductie van SF-MSCs in vitro. In de latere fase, hypertrofische chondrocyten altijd uitdrukkelijke type X collageen (COLX), matrix metalloproteinase 13 (MMP13) factor alkalische fosfatase (ALP), en runt-gerelateerde transcriptie 2 (Runx2)29. Onderzoek suggereert dat de driedimensionale (3D) pellet-cultuur, dynamische cultuur systemen, en de coculture met chondrocyten voordeel voor MSC stabiel zijn chondrogenic differentiatie30,31. In deze studie werd een pellet cultuur systeem gebruikt voor chondrogenic inductie van MSC te vermijden hypertrofie.

Kortom, hebben wij een eenvoudige methode voor de isolatie en zuivering van MSCs van de articulaire holte Afboekingsmethode vloeistof opgericht en gekenmerkt de MSCs verkregen daarin. Dit protocol heeft bood een platform voor de verkenning en het onderzoek van de potentiële nut van de articulaire synoviale vloeistof afkomstige MSCs' in nieuwe gezamenlijke regeneratie strategieën.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren dat zij geen concurrerende financiële belangen hebben.

Acknowledgments

Deze studie werd financieel ondersteund door de volgende subsidies: de Natural Science Foundation van China (nr. 81572198; Nr. 81772394); het Fonds voor hoog niveau medische Discipline bouw van Universiteit Shenzhen (nr. 2016031638); de medische Research Foundation van de provincie Guangdong, China (nr. A2016314); en Shenzhen wetenschaps- en technologieprojecten (nr. JCYJ20170306092215436; Nr. JCYJ20170412150609690; Nr. JCYJ20170413161800287; Nr. SGLH20161209105517753; Nr. JCYJ20160301111338144).

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics