Magnetisk-aktiverad Cell sortering strategier för att isolera och rena Synovial vätska-Derived mesenkymala stamceller från en kanin-modell

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Denna artikel presenterar en enkel och ekonomisk protokollet för enkel isolering och rening av mesenkymala stamceller från Nya Zeeland vit kanin ledvätska.

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mesenkymala stamceller (MSC) är den största cell källan för cell-baserad behandling. MSCs från artikulära hålighet ledvätska kan potentiellt användas för brosk vävnadsteknik. MSCs från ledvätska (SF-MSCs) har ansetts vara lovande kandidater för artikulära regenerering och deras potentiella terapeutiska fördelar har gjort dem ett viktigt forskningsområde för sent. SF-MSCs från knä hålighet i Nya Zeeland vit kanin kan vara anställd som en optimerad translationell modell att bedöma människors regenerativ medicin. Med hjälp av CD90-baserade magnetiska aktiverad cell sortering (Mac) teknik, detta protokoll erhåller framgångsrikt kanin SF-MSCs (rbSF-MSCs) från denna kanin modell och ytterligare visar fullt MSC fenotypen av dessa celler genom att förmå dem att differentiera till osteoblaster, adipocyter och kondrocyter. Därför kan detta tillvägagångssätt tillämpas i den cellbiologiska forskningen och tissue engineering använder enkel utrustning och förfaranden.

Introduction

MSCs har föreslagits som en värdefull källa för regenerativ medicin, särskilt för brosk lesioner. MSCs, inklusive kondrocyter, osteoblaster, adipocyter, skelett myocyter och viscerala stromaceller, expandera i stort sett områdena för stamcellstransplantation på grund av deras höga expansion ränta och flera härstamning differentiering potentiella1. MSCs kan isoleras från Skelett muskel, synovialvätskan, benmärg och fettvävnad2,3,4. Resultaten har också bekräftar förekomsten av MSCs i ledvätska och tidigare forskning har identifierat synovial vätska-derived MSCs (SF-MSCs) som lovande kandidater för artikulära regenerering5,6.

Forskning och prekliniska experiment på mänskliga prover omfattas emellertid många etiska frågor. I stället kaniner har varit och fortsätter att vara den vanligaste djurarter för att demonstrera att transplantation av MSCs kan reparera broskskador. Under senare år ett ökande antal forskare har studerat kanin mesenkymala stamceller (rbMSCs) båda in vitro- och in-vivo, som dessa celler liknar mänskliga MSCs i deras cellulära biologi och vävnad fysiologi. Likaså klarar rbMSCs av att följa plastytor, visar spindel-fibroblast morfologi som mänskliga MSCs. Dessutom är kanin mesenkymala prover enkel och lätt att få7. Dessutom är de viktigaste punkterna att rbMSCs uttrycker yta markörer, såsom CD44, CD90 och CD105, och att flera härstamning differentieringen potentiella bevaras, som är överens med kriterierna för identifiering av MSC populationer som definieras av den internationella föreningen för cellterapi8,9. I synnerhet klarar synovial vätska chondroprogenitors av icke-hypertrofisk kondrogenes när induceras av TGF-β1, vilket gör dem lämpliga cell källor för fenotypiskt ledbrosk regenerering10,11, 12.

Isolering av SF-MSCs skiljer sig dock kraftigt från andra vävnader, inklusive navelsträngen, fettvävnad, perifert blod och benmärg. För närvarande är de vanligaste metoderna för rening och sortering av SF-MSCs flödescytometri och immunmagnetisk pärla-baserade sortering, även om metoden flöde flödescytometri kräver en specifik miljö och mycket dyra instrument13.

Denna artikel presenterar en procedur för enkel och minimalt invasiv insamling av prover av ledvätska från Nya Zeeland vita kaniner. Under förfarandet, de rbSF-MSCs är stabilt expanderade in vitro- och sedan isoleras med CD90 positiv magnetisk pärla-baserade förfaranden. Slutligen visar protokollet skaffa MSCs med hög renhet och livskraft från skördade cell källor.

I detta protokoll kännetecknas de isolerade rbSF-MSCs baserat på deras morfologi, uttryck för specifika markörer och pluripotenta stamceller. Flöde flödescytometri-baserade immunophenotyping avslöjar ett betydande positivt uttryck för CD44 och CD105, uttryck för CD45 och CD34 är negativa. Slutligen visar in vitro- test för rbSF-MSCs osteogent, adipogena och chondrogenic differentiering av dessa celler.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alla djurförsök genomfördes i enlighet med riktlinjerna för regionalstöd etikkommittén och alla djur förfaranden godkändes av den institutionella djur vård och användning kommittén av Shenzhen andra människors sjukhus, Shenzhen universitet.

1. isolera och kultur de rbSF-MSCs

  1. Förberedelserna för förfarandet för djur
    1. Förbereda skeletalt mogna kvinnliga nya Zeeland vita kaniner för insamling av rbSF-MSCs. utföra en klinisk undersökning av kaninerna en dag före anestesi och arthrocentesis förfarandet.
      Obs: fysiska undersökningar bör innehålla vikt (2,0-2,5 kg), kön (kvinna), och kroppstemperatur, andningsfrekvens och puls. Parametern intervall för kliniskt friska kaniner är 30-50 min för respiration klassar, 220-280 min för puls och 38-39 ° C för kroppstemperatur.
    2. Snabbt djuren för 6 h före anestesi.
  2. Preparat och förfarandet för den animaliska anestesi
    1. Hindra kaninen med en bur (se Tabell för material), och sedan injicera 3% pentobarbital natrium i marginalnummer öra ven med en dos på 1 mL/kg för narkos.
    2. Placera kaninen i en bekväm dorsal-recumbent position.
    3. Övervaka den andningsfrekvens, puls och kroppstemperatur kaninens under anestesi.
    4. Använda oftalmologiska salva på sina ögon för att förhindra torrhet under anestesi.
    5. Bedöma djupet av anestesi efter Guedels klassificering14.
  3. Förberedelse för MSCs isolering och odling
    1. För att odla rbSF-MSCs, förbereda 500 mL kommersiella odlingsmedium (se Tabell för material) kompletteras med 10% kommersiella tillägg (se Tabell för material), 10% fetalt bovint serum (FBS), och 1% Penicillin-Streptomycin.
    2. Inkubera odlingssubstratet vid 37 ° C i ett vattenbad.
    3. Förbereda 500 mL fosfat buffert saltlösning (PBS) för cell isolering och cell tvätt.
    4. Förbereda 100 mL isoton koksaltlösning för knät hålet arthrocentesis förfarandet.
  4. Samling av artikulära synovial vätska från knäet av kanin
    1. Markera ett område ca 5 x 5 cm i storlek runt knät och raka kanin håret från detta område med hjälp av en säkerhet rakapparat.
    2. Växelvis, desinficera webbplatsen förfarande 3 x med povidon jod lösning och 75% etanol. Applicera sedan, sterila draperier efter området torkat ordentligt.
    3. Injicera 1-2 mL isoton koksaltlösning, med en steril hypodermic spruta (2 mL), i knäet gemensam hålighet från den laterala artikulära rymden, flytta knät 3-4 x, och sedan suga ut alla ledvätskan i rumstemperatur.
    4. Filtrera den synovial fluid genom en 40 µm nylon cell SIL ta bort eventuellt skräp inom 4 h.
  5. Kultur av de rbSF-MSCs
    1. Samla de filtrerade fluid i 50 mL centrifugrör och centrifugera vid 1500 rpm i 10 min i rumstemperatur.
    2. Kassera supernatanten efter centrifugeringen, tvätta pelleten med PBS, återsuspendera pelleten med komplett odlingsmediet och sedan platta mediet i 100 mm rätter.
    3. Inkubera vid 37 ° C i en fuktad atmosfär som innehåller 5% CO2rätter.
    4. Efter 48 h, fylla på rätter med färska medium att ta bort alla icke-anhängare celler. Ersätta mediet två gånger i veckan i 2 veckor som passage 0 (P0).
      Obs: Det bör finnas ca 1 x 104 vidhäftande celler. Livskraftiga celler/ml i SF är ca 2 x 102/ml.
    5. Efter 14 dagar efter den inledande pläteringen, bör många kolonier har bildat i kultur maträtter. Markera kolonierna som är större än 2 mm i diameter. Mark var valda kolonierna finns genom att spåra deras omkrets nedtill maträtt.
    6. Kassera kolonierna < 2 mm bred, med hjälp av cell skrapor. Smälta de valda kolonierna med cirka 5 µL av 0,25% trypsin, använder en kloning cylinder, och överföra kolonierna till en ny maträtt som passage 1 (P1).
  6. Postoperativ djurvård
    1. Följ standard institutionella operativa förfaranden för postoperativ övervakning och återhämtning från anestesi.
    2. Övervaka det livsviktiga teckenet av kaninen varje 10 min tills den har återfått medvetandet. Slutligen, överföra den medvetna djuren till buren. Returnera inte en kanin som har genomgått operation för att företaget av andra djur tills det har återhämtat sig helt.
    3. Efter operation, desinficera platsen med 0,1% povidon jod, 2 x per dag i 3 dagar.

2. CD90-positiv magnetisk aktiverad Cell sortering (Mac) av rbSF-MSCs och primära kultur

  1. Provberedning
    1. När cellerna når runt 80% konfluens, aspirera på medellång och Lägg sedan till 1-2 mL av 0,25% Trypsin-EDTA till varje maträtt.
    2. Inkubera rätter för 2-3 min att tillåta cellen avlossning.
    3. När cellerna är fristående, lägga till en lika stor mängd odlingssubstratet att inaktivera trypsin.
    4. Passera en 40 µm cell SIL cellsuspension, samla upp filtratet i en 15 mL tub och sedan snurra ner cellerna på 600 × g under 10 minuter vid rumstemperatur.
    5. Återsuspendera cellpelleten i Mac-datorer med buffert (PBS, pH 7,2, 0,5% bovint serumalbumin och 2 mM EDTA) och sedan räkna antalet cell.
  2. Magnetisk märkning
    Obs: Sortera de rbSF-MSCs med en magnetisk-aktiverad cell sortering kit innehåller kolumner, en monter och separatorer (se Tabell för material).
    1. Bestämma antalet cell med en hemocytometer.
    2. Centrifugera cellsuspension på 300 × g under 10 minuter vid 4 ° C. Helt Aspirera supernatanten.
    3. Tillsätt 80 µL av resuspension buffert per 107 totala celler.
    4. För 107 totala celler, tillsätt 20 µL av mikrokulor konjugerat med en monoklonal anti-kanin CD90 antikropp.
    5. Blanda magnetiska pärlor och celler jämnt i rören, då Inkubera dem vid 4 ° C i 15 min i mörker.
    6. Tillsätt 1 mL buffert per 107 celler till röret, och sedan Centrifugera det 300 × g under 10 minuter vid 4 ° C att tvätta cellerna. Kassera supernatanten efter centrifugeringen.
    7. Återsuspendera pelleten i 500 µL buffert per 107 celler.
  3. Magnetisk separering
    1. Placera kolumnen för kolumn Wings på framsidan i det magnetiska fältet i den magnetiska avskiljaren.
    2. Skölj kolumnen magnetisk separator (MS) med 500 µL buffert per 107 celler.
    3. Över den enda cellsuspensionen till kolonnen. Låt de negativa cellerna passera genom magnetfältet att kassera dessa namnlösa celler.
    4. Tvätta kolonnen 1-2 x med 500 µL buffert per 107 celler och kassera genomflöde.
    5. Överföra kolumnen i ett centrifugrör (15 mL).
    6. Tillsätt 1 mL buffert per 107 celler till kolumnen och sedan omedelbart Skjut kolven i kolumnen för att spola ut de magnetiskt märkta cellerna.
    7. Upprepa det ovannämnda förfarandet med en andra MS-Column att öka renhet CD90+ celler, som kan berika den eluerade fraktionen.
    8. Centrifugera cellsuspension vid 300 × g i 10 min, Aspirera supernatanten och återsuspendera det med odlingssubstratet.
  4. Kultur av CD90+ rbSF-MSCs
    1. Inokulera cellerna i 100 mm rätter efter magnetiska aktiverad cell sorteringen.
    2. Inkubera vid 37 ° C i en fuktad cell inkubator med 5% CO2rätter.
    3. När 80-90% sammanflödet av primärkulturen uppnås, vid ca 7-10 dagar, smälta vidhäftande cellerna med 0,25% Trypsin-EDTA och passage dem vid en spädning på 1:2 att göra passage 2 (P2).
    4. Använd samma metod för att passera cellerna till passage 3 (P3), som kan användas för in vitro- analyserna.
      Obs: Efter subkultur och rening, ca 1 x 107 rbSF-MSCs erhålls.

3. identifiering av rbSF-MSCs

  1. Yta markör bekräftelse av de rbSF-MSCs av flödescytometri
    1. När MSCs är 80-90% konfluenta på P3, tvätta cellerna med PBS och behandla dem med 1 mL av 0,25% Trypsin-EDTA. Sedan, inkubera i MSCs vid 37 ° C i 2-3 min tills cellerna är fristående.
    2. Skörda cellerna med 10 mL PBS, överföra dem till ett koniskt rör (15 mL) och centrifugera dem 300 × g för 5 min i rumstemperatur.
    3. Kassera supernatanterna. Återsuspendera cellpelleten i 500 µL av PBS och överför det till en 1,5 mL tub.
    4. Inkubera en 1: 100 utspädning av FITC-konjugerad och PE-konjugerade antikroppar (isotyp, FITC-CD34/PE-CD45, FITC-CD105/PE-CD44) för 1 h i mörker vid 4 ° C.
    5. Centrifugera blandningen vid 300 × g i 5 min i rumstemperatur och tvätta cellerna två gånger med PBS genom centrifugering vid 300 × g i 5 min varje gång. Kassera supernatanterna.
    6. Resuspendera cellerna i 500 µL av PBS, överföra cellsuspensionen i en runda-botten röret (5 mL) och analysera den med en flödescytometer.
      Obs: Uppkopplingstyp på en cytometer med två fluorescens-kanaler: 533/30 och 585/40. För varje isotypen fluorescens, använda isotypen kontrollen för att justera lämplig laser spänningen och ange den minimisstyrka som krävs för att erhålla ett fluorescens histogram som visar både vänster- och högerkanterna av toppen. Samla minst 10 000 evenemang för de statistiska analyserna.
  2. Multidifferentiation av de rbSF-MSCs
    Obs: Använd P3 rbSF-MSCs för in vitro- multidifferentiation analyserna.
    1. Osteogena differentiering
      1. Förbereda osteogent induktion medium: DMEM basic (1 x) innehållande 50 mM L-ascorbic syra-2-fosfat, 10 mM av α-glycerofosfat och 100 nM av dexametason.
      2. Utsäde cellerna på 103 celler/cm2 i en 6-väl vävnadsodling tallrik och kultur dem osteogent induktion medium.
      3. Ändra det induktiv mediet varje 3 dagar i 3 veckor.
      4. Fixa cellerna med 4% formaldehyd i 30 min i rumstemperatur efter differentiering är slutförd, färga cellerna med 1% Alizarin red för 5 min och sedan tvätta dem 3 x med PBS15.
    2. Adipogena differentiering
      1. Förbereda adipogena induktion medium: DMEM basic (1 x) bestående av 100 mM av indometacin, 10 mg/mL rekombinant humant insulin, 1 mM av dexametason och 0,5 mM för 3-isobutyl-1-methylxanthine.
      2. Behandla de P3 rbSF-MSCs i 3 veckor i adipogena induktion medium.
      3. Färga de neutrala lipid vakuoler med Oil Red O bekräftar adipogena differentiering efter 3 veckor. Fixa cellerna i en 4% formaldehydlösning i 30 min i rumstemperatur och sedan tvätta dem 3 x med PBS16.
    3. Chondrogenic differentiering
      1. Förbereda chondrogenic induktion medium: DMEM basic (1 x) bestående av 10 ng/mL för TGFβ1, 1% dess tillägg, 0.35 mM L-prolin, 100 nM dexametason, 50 mM L-ascorbic syra-2-fosfat, och 1 mm av natrium pyruvat.
      2. Använd pellet odling för chondrogenic induktion. Centrifugera vid 1500 rpm i 10 min i en polypropylen rör (15 mL) att bilda en pellet 5 × 105 P3 rbSF-MSCs.
      3. Kultur pellets i 3 veckor med chondrogenic induktion medium.
      4. Ändra på medellång varje 3 dagar i 3 veckor.
      5. Efter 3 veckor induktion, bädda in cellpelleten med paraffin avsnitt det i 4 mm skivor och färga dem med 0,1% toluidin blå under 30 minuter vid rumstemperatur17.
  3. Total RNA-extraktion och analys av kvantitativ realtids polymeras-kedjereaktion (qRT-PCR)
    1. Isolera den total-RNA av cellerna efter 3 veckor differentiering induktion med den kommersiella RNA-extraktionen kit (se Tabell för material).
      1. Ta bort odlingssubstratet i kultur skålen och tillsätt därefter 1 mL isolering reagens.
      2. Lysera celler av upprepad pipettering tills lösningen är homogen. Odla den i rumstemperatur i 3 min.
      3. Överföra cellen lysate i ett 1,5 mL mikrocentrifug rör.
      4. Tillsätt 100 µL av kloroform, skaka det av hand 15 x och inkubera blandningen i rumstemperatur i 3 min.
      5. Centrifugera röret vid 12.000 × g i 15 minuter vid 4 ° C. Överföra supernatanterna till en ny 1,5 mL mikrocentrifug rör.
      6. Tillsätt 500 µL av isopropanol och fällningen RNA under 10 minuter vid rumstemperatur.
      7. Centrifugera vid 12 000 × g i 10 minat 4 ° C. RNA pelleten bör vara synlig på botten av röret.
      8. Avlägsna supernatanten och sedan tillsätt 500 µL av 75% etanol. Kort snurra röret i flera sekunder för att tvätta RNA pelleten. Centrifugera det 7.500 × g i 5 minuter vid 4 ° C.
      9. Ta bort återstående etanolen.
      10. Lös den RNA pelleten i 10 μl DEPC vatten och placera rören på is.
    2. Omvänd transkribera total-RNA till cDNA med en DNA-syntes kit (se Tabell för material).
      Obs: Utför följande procedurerna på is.
      1. Förbereda omvänd Transkription huvudmixen.
      2. Tillsätt 25 µL av DNAS-behandlade RNA till varje rör med 1 µg av RNA.
      3. Inkubera blandningen på följande temperaturer med hjälp av en PCR termocykel: 26 ° C i 10 minuter (för att möjliggöra den slumpmässiga hexamers att glödga) 42 ° C i 45 min (omvänd Transkription) och 75 ° C i 10 min (att inaktivera det omvänt transkriptas).
      4. Omedelbart analysera den resulterande cDNA av kvantitativ realtids-PCR, eller förvara den vid-20 ° C.
    3. Utföra gen uttryck analysen med en kvantitativ realtids PCR system.
      1. Använda qRT-PCR Master Mix (se Tabell för material) för att utföra PCR. PCR primers för GAPDH, Runx2, Agg och PPARγ listas i tabell 1.
      2. Beräkna genuttryck med metoden 2ΔΔCT .
      3. Genomföra en statistisk analys med hjälp av standard statistisk programvara. Använda en oberoende sampel t-test för att jämföra den grupp medlen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Isolering, rening och kultur av de rbSF-MSCs:
Detta protokoll använder Mac-datorer för att isolera rbSF-MSCs, baserat på uttrycket av MSC surface marker CD90. Ett processflödesdiagram rbSF-MSCs' isolering, rening, och karakterisering och protokollet i vitro kultur visas i figur 1.

Cellmorfologi efter magnetiska aktiverad Cell sortering (Mac) med CD90:
För det första för Mac, immunolabel MSCs med CD90 magnetiska pärlor. Efter centrifugering, Omsuspendera högst 107 celler i 80 µL av en förhandskyld sortering buffert och sedan Tillsätt 20 µL av CD90 magnetiska pärlor, följt av vortexa och inkubation vid 4 ° C under 15 minuter. Efter att tvätta cellerna med 1 mL av sortering bufferten och återsuspendera dem i 500 µL av sortering bufferten. Innan du fortsätter med den magnetiska sortering, upprepa tvätt. Denna kritiska procedur visas i figur 2.

Före sortering visas de vidhäftande kanin synovial vätska cellpopulationer heterogena morfologi, innehållande olika typer och storlekar (figur 3A-C). Följande Mac-datorer uppvisade cellpopulationer homogen morfologi. Cellen var ökat med subkultur (figur 3D-F).

Ytan egenskaper av MACS-berikade rbSF-MSCs:
Fluorescens-aktiverad Cell sortering (FACS) utfördes för att analysera anrikningen av rbSF-MSCs av Mac-datorer med CD90. Innan Mac bestod cell befolkningen av cirka 40% MSCs (figur 4 cD, isotyp kontroller i figur 4A,B). Följande Mac-datorer innehöll berikade befolkningen cirka > 99% MSCs (figur 4E,F). De hematopoetiska härstamning cell markörerna CD34 och CD45, på 0.318%, båda sällan uttrycktes efter Mac, vilket är en nedgång från deras ursprungliga uttryck på 25,9%. Före valet, fanns det ca 28% CD90+ celler (figur 4 g); efter rening, ca 98% CD90+ celler erhölls (figur 4 H).

Multilinjärt differentiering potentiella av rbSF-MSCs:
För att karakterisera rbSF-MSCs förmåga att differentieras till de olika härstamningar som osteogent, adipogena, och chondrogenic celler, de rbSF-MSCs berikas av Mac-datorer samtidigt odlades i en viss differentiering medium och i en differentiering medium utan cytokin som kontroller. När induktionen slutfördes, härstamning-specifika markörer analyserades av färgning och RT-PCR. Alizarin röda färgning av kalcium föreningar visade att mineraliserade knölar hade bildats i de rbSF-MSCs efter 3 veckor på osteogent induktion villkor (figur 5A). Efter 3 veckor av adipogena induktion, kunde en ansamling av lipid-rika vakuoler ha upptäckts av intracellulära olja röd O färgning (figur 5B). För 21 dagar av chondrogenic induktion, var cellpelleten histologiskt analyseras med toluidinblått blå färgning. Celler som är positiva för färgning (till proteoglykan) betraktades som chondrocyte-liknande celler (figur 5 c). Liknar detta resultat, en kvantitativ analys av genuttrycket av differentiering potentiella visade även funktionen differentiering av dessa celler. Uttrycksnivåerna av Agg (en chondrocyte markör), PPARγ (en adipogena markör) och Runx2 (en osteoblast markör) var uppreglerad inducerad villkor. Dessa data visade multipotenta differentiering förmåga rbSF-MSCs i trilineages (figur 5 d).

Figure 1
Figur 1: Full Schematisk av isolering, rening och karakterisering av de SF-MSCs nya Zeeland vita kaniner. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: protokoll för magnetiska aktiverad cell sortering (Mac) med CD90. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: morfologi av enskiktslager odlade rbSF-MSCs före och efter MACS som granskats i enlighet med vanliga inverterad mikroskopi. A-C) Före sortering Visa de vidhäftande kanin synovial vätska cellpopulationer heterogenitet. De innehåller olika typer och storlekar, till exempel ovala, lång-spindel, kort-spindeln och stjärnformade morfologi. Den huvudsakliga morfologin i P2 och P6 är en spindel morfologi (A: P2, B: P3, C: P6). D-F) Följande Mac-datorer med CD90 uppvisar cellpopulationer en homogen morfologi. Med en subkultur, cellen ökar (D: P2, E: P3, F: P6). Skalstapeln = 100 µm. vänligen klicka här för att visa en större version av denna siffra.

Figure 4
Figur 4: identifiering av rbSF-MSC ytmarkörer. Med hjälp av flödescytometri Flödesanalys, är de rbSF-MSCs positiva på MSC markörer CD44 och CD105, medan negativa för endotelceller markören CD34 och hematopoetiska cell markören CD45. Innan Mac-datorer har dessa celler en låg grad av positivitet för CD44 och CD105. Men efter Mac var graden av positivitet hög. A, B) Dessa topp två bilder visar de isotyp kontrolldata. C, D) Dessa resultat visar att innan MACS rbSF-MSC befolkningen består av cirka 40% MSC celler. E, F) Efter Mac innehåller anrikat befolkningen > 99% MSC celler. G, H) Dessa bilder visar flödet flödescytometri analys av CD90+ markör, (G) innan och (H) efter MACS sortering. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: analys av härstamning-specifika markörer av färgning och RT-PCR. (A) Alizarin röda färgning visar att mineraliserade knölar bildar under osteogent induktion i 3 veckor. B) efter 3 veckor av adipogena induktion, ansamling av lipid-rika vakuoler upptäcks av intracellulära olja röd O färgning. C) för 3 veckor av chondrogenic induktion, cellpelleten var histologiskt analyseras med toluidinblått blå färgning. Celler som är positiva för färgning (till proteoglykan) betraktades som chondrocyte-liknande celler. Skalstapeln = 100 µm. D) efter odling i 3 veckor, relativa mRNA uttryck för osteoblast markörer (Runx2), adipogena markörer (PPARγ) och chondrogenic markörer (Agg) är upptäckt. För alla analyser, p värden < 0,01 ansågs statistiskt signifikanta skillnader i Kruskal-Wallis test (visas som **). Klicka här för att se en större version av denna siffra.

Gener Vidarebefordra primer (5'-3') Reverse primer (5'-3')
Runx2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
AGG GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARΓ2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

Tabell 1: Lista över gener och primers som används i denna studie för kvantitativ realtids-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Existensen av MSCs i synovialvätska är ett alternativ för cell-baserad terapi. Tidigare studier har visat att skada platser innehåller högre mängder av mesenkymala stamceller i deras synovial vätska, vilket kan vara positivt korrelerade med efter skada perioden5. MSCs i ledvätska kan vara fördelaktigt att vävnad för att förbättra den spontan läkning efter en skada18,19. Klinisk tillämpning av SF-MSCs täckts sällan i litteraturen, främst eftersom mekanismerna för de SF-MSCs i lederna förblir odefinierad20. Jones et al. 21 rapporterade att hSF-MSC nummer i knäleder avsevärt öka 7-fold under de tidiga stadierna av osteoartrit (OA). De trodde att de ökade SF-MSCs kan bidra till att upprätthålla fysiologiska homeostas av lederna.

En idealisk djurmodell är ett oumbärligt verktyg i utvecklingen av therapeutics utnyttja regenerativ och translationell medicin. Även om det finns uppenbara skillnader mellan människor och kanin, kanin används flitigt som en djurmodell för att studera vävnad förnyelse7, därigenom motivera oss att välja det som modell för vår studie av SF-MSCs. En av de mer skrämmande hinder i denna strävan är att isoleringen av SF-MSCs ofta resulterar i varierad framgång priser och låga kolonin frekvenser, som rapporterats i tidigare forskning5. Många forskare har därför fokuserat på framgång priser och optimering av isoleringen av MSCs från SF.

Denna studyeffectively används ett Mac-förfarande för sortering högrena och livskraften hos CD90+ MACSs från kanin synovial vätska22. Detta Mac-system använder magnetiska mikrokulor konjugerat till mycket specifika antikroppar kopplade till en viss cell ytantigen, CD90 i detta fall, och möjliggör valet av viss cell måltypen, nämligen CD90 uttrycker celler. Innan rening med CD90 mikrokulor kultur vi oftast de primära rbSF-MSCs i 14 dagar. Under denna period bildas många kolonier i kultur maträtter. Detta protokoll antyder att välja kolonierna som är större än 2 mm i diameter. När du använder kloning cylindern för kolonin urval, följa vi noggrant den under mikroskopet. Den enda kolonin sprids vidare för rening.

Under processen för separation och rening lockas CD90 uttrycker cellerna som var magnetiskt märkt av det magnetiska fältet i separatorn i kolumnen medan omärkt cellerna flöda genom. Efter tvättprocessen, kolumnen tas bort från det magnetiska fältet i separatorn och målceller elueras från kolonnen. Detta specifika Mac microbead tillvägagångssätt gör att isoleringen av rbSF-MSCs som specifikt uttrycks de stamceller ytmarkörer CD44 och CD105, visar att dessa isolerade celler är mesenkymala stamceller i stället för hematopoetiska celler23. Dessa renat rbSF-MSCs kan vara odlade i vitro över lång tid utan någon betydande förändring av morfologiska egenskaper och markör uttryck. De rbSF-MSCs berikas av MACS uppvisar dessutom en multipotenta differentiering förmåga till flera härstamning celler, inklusive chondrogenic, adipogena och Osteogena celler.

Driften av Mac-datorer är en lätt-att-utföra protokoll och kan göras på bänk23. Dessutom den amerikanska Food and Drug Administration (FDA) har godkänt den MACS microbead-baserad tekniken, och därmed är det lätt att utföra för kliniska tillämpningar24. CD90 är en yta markör av mesenkymala stamceller, och forskare har visat att CD90 positiva MSCs har en bättre chondrogenic differentiering förmåga25,26. Pluripotency av MSCs karaktäriserats utifrån morfologi och uttrycket av specifika markörer för stamceller27.

Denna studie har flera begränsningar. Den första bristen i detta protokoll är relaterad till de yta markörer som vi granskat. Minimivillkoren för att definiera multipotenta MSCs baserat på ett uttalande av den internationella föreningen för cellulära terapi (ISCT), och är positivt för CD90, CD105, CD44 och CD73 och negativa för CD11b, CD14, CD34 eller CD45, och CD79a eller HLA-DR28. Med målet att lindra de ansträngningar och de kostnader som krävs för att testa hela panelen, utvalda forskare i denna studie noggrant två av de negativa markörerna och två av de positiva markörer som rekommenderas. För det andra, det tar lång tid att bilda kolonierna som ska väljas för vidare studier. Hypertrofi är dessutom ett stort problem under chondrogenic induktion av SF-MSCs i vitro. Vid senare skede, hypertrofisk kondrocyter alltid express typ X kollagen (COLX), matrix metalloproteinas 13 (MMP13) faktor alkaliska fosfataser (ALP) och runt-relaterade transkription 2 (Runx2)29. Forskning visar att den tredimensionella (3D) pellet kulturen, dynamisk kultur system och coculture med kondrocyter är fördelen för MSC stabilt chondrogenic differentiering30,31. I denna studie användes en pelletssystem kultur för chondrogenic induktion av MSC för att undvika hypertrofi.

Sammanfattningsvis har vi etablerat en enkel metod för isolering och rening av MSCs från artikulära hålighet rodnad vätska och kännetecknas av MSCs erhålls däri. Detta protokoll har skapat en plattform för prospektering och undersökning av artikulära synovial vätska-derived MSCs' potentiella nytta i romanen gemensamma regenerering strategier.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna förklarar att de har inga konkurrerande finansiella intressen.

Acknowledgments

Denna studie stöddes ekonomiskt av de följande bidrag: den naturvetenskapliga grunden i Kina (nr. 81572198; Nr. 81772394); Fonden för hög nivå medicinsk disciplin byggandet av Shenzhen universitet (No. 2016031638); Medicinsk forskningsstiftelsen provinsen Guangdong, Kina (nr. A2016314); och Shenzhen vetenskaps- och teknikprojekt (nr. JCYJ20170306092215436; Lol JCYJ20170412150609690; Lol JCYJ20170413161800287; Lol SGLH20161209105517753; Lol JCYJ20160301111338144).

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics