Magnetisk-aktivert celle sortering strategier for å isolere og rense Synovial Fluid-avledet Mesenchymal stamceller fra en kanin modell

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Denne artikkelen presenterer en enkel og økonomisk protokoll for enkel isolasjon og rensing av mesenchymal stamceller fra New Zealand hvit kanin synovial væske.

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Stamceller (MSCs) er den viktigste celle for celle-basert terapi. MSCs fra articular hulrom synovial væske kan potensielt brukes brusk vev engineering. MSCs fra synovial væske (SF-MSCs) har vært betraktet som lovende kandidater for articular gjenfødelse, og deres potensielle terapeutiske fordel har gjort dem en viktig forskning emne for sent. SF-MSCs fra i kneet hulrommet i New Zealand hvite kaninen kan anvendes som en optimalisert translasjonsforskning modell å vurdere menneskelige regenerativ medisin. Ved hjelp av CD90-baserte magnetiske aktivert celle sortering (Mac) teknologier, denne protokollen henter vellykket kanin SF-MSCs (rbSF-MSCs) fra denne kanin modellen og ytterligere viser fullt MSC fenotypen av disse cellene av til å differensiere å osteoblasts, adipocytter og chondrocytes. Derfor kan denne tilnærmingen brukes i biologi forskning og vev engineering bruker enkel utstyr og prosedyrer.

Introduction

MSCs har blitt foreslått som en verdifull kilde for regenerativ medisin, spesielt for brusk lesjoner. MSCs, inkludert chondrocytes, osteoblasts, adipocytter, skjelettlidelser myocytter og visceral stromal celler, bredt utvide områdene for stilk cellen transplantasjon på grunn av deres høye ekspansjon rate og flere avstamning differensiering potensielle1. MSCs kan isoleres fra skjelettlidelser muskler, fagområder, benmargen og fettvev2,3,4. Funnene har også confirmed tilstedeværelsen av MSCs i synovial væske, og tidligere forskning har identifisert synovial fluid-avledet MSCs (SF-MSCs) som lovende kandidater i articular gjenfødelse5,6.

Men er forskning og prekliniske eksperimentering på prøver fra mennesker underlagt mange etiske spørsmål. I stedet kanin har vært og fortsetter å være mest brukte dyrearter for å demonstrere at transplantasjon av MSCs kan reparere skader brusk. De siste årene, et økende antall forskere har studert kanin mesenchymal stamceller (rbMSCs) både i vitro og i vivo, disse cellene er ligner menneskelige MSCs i mobilnettet biologi og vev fysiologi. Tilsvarende er er rbMSCs i stand til å overholde plast overflater, vise spindel-fibroblast morfologi som menneskelige MSCs. Videre er kanin mesenchymal prøvene enkel og lett å få7. I tillegg er de viktigste punktene at rbMSCs express overflate markører, som CD44, CD90 og CD105, og at flere avstamning differensiering potensielle er bevart, som er i samsvar med kriteriene for identifikasjon av MSC populasjoner som definert av internasjonale samfunnet for mobilnettet terapi8,9. Spesielt er synovial væske chondroprogenitors i stand til ikke-hypertrofisk chondrogenesis når indusert av TGF-β1, dermed gjør dem egnet cellen kilder for svært articular brusk gjenfødelse10,11, 12.

Isolasjon av SF-MSCs er imidlertid svært forskjellig fra andre vev, inkludert navlestreng, fettvev, perifert blod og benmarg. Tiden, er de vanligste metodene for rensing og sortering av SF-MSCs flowcytometri og immunomagnetic perle-basert sortering, selv om flyt cytometri metoden krever et bestemt miljø og svært dyr instrumenter13.

Denne artikkelen presenterer en prosedyre for enkel og minimal invasiv innsamling av prøver av synovial væske fra New Zealand hvit kanin. Under inngrepet, rbSF-MSCs stabilt utvidet i vitro og deretter isolert CD90 positive magnetiske perle-baserte prosedyrer. Til slutt, protokollen viser hvordan å få MSCs med høy renhetsgrad og levedyktighet fra høstet celle kilder.

I denne protokollen kjennetegnes av isolerte rbSF-MSCs basert på deres morfologi, uttrykk for bestemte dataindikatorer og pluripotency for stamceller. Flow cytometri-baserte immunophenotyping avslører en betydelig positiv uttrykk for CD44 og CD105, mens uttrykk for CD45 og CD34 er negativt. Til slutt, i vitro analysen for rbSF-MSCs viser osteogenic, adipogenic og chondrogenic differensiering av disse cellene.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle dyreforsøk ble utført i henhold til regionale etikk veiledning, og alle dyr prosedyrer ble godkjent av institusjonelle Animal Care og bruk komiteen av Shenzhen andre folks Hospital, Shenzhen University.

1. Isoler og kultur av rbSF-MSCs

  1. Forberedelser for dyr prosedyren
    1. Forberede skjelettaktig eldre kvinnelige New Zealand white kaniner for innsamling av rbSF-MSCs. Utfør en klinisk undersøkelse av kaniner dagen før prosedyren anestesi og arthrocentesis.
      Merk: fysiske undersøkelser bør inkludere vekt (2.0-2.5 kg), kjønn (kvinne), og kroppstemperatur, pustefrekvens og hjertefrekvens. Parameteren intervaller for klinisk sunn kanin er 30-50 min for pustefrekvens, 220-280 min for hjertefrekvens og 38-39 ° C i kroppstemperatur.
    2. Rask dyr 6t før anestesi.
  2. Forberedelser og prosedyre for dyr anestesi
    1. Holde kaninen med en bur (se Tabell for materiale), og deretter injisere 3% pentobarbital natrium i marginale øret venen med ett dose av 1 mL/kg for generell anestesi.
    2. Sett kaninen i en komfortabel dorsal-recumbent stilling.
    3. Overvåke pustefrekvens, hjertefrekvens, og kroppstemperaturen av kaninen under anestesi.
    4. Bruk ophthalmologic salve på øynene for å hindre tørrhet under anestesi.
    5. Vurdere dybden av anestesi etter Guedels klassifisering14.
  3. Forberedelse til MSCs isolasjon og dyrking
    1. For å dyrke rbSF-MSCs, forberede 500 mL kommersielle kultur medium (se Tabell for materiale) supplert med 10% kommersielle supplement (se Tabell for materiale), 10% fosterets bovin serum (FBS), og 1% Penicillin-Streptomycin.
    2. Inkuber kultur middels på 37 ° C i et vannbad.
    3. Forberede 500 mL fosfat buffer saltvann (PBS) cellen aisolering og celle vask.
    4. Forberede 100 mL isotonisk saltvannsoppløsning kneet hulrom arthrocentesis prosedyren.
  4. Samling av articular synovial fl uid fra kneet til kaninen
    1. Merke et område ca 5 x 5 cm i størrelse rundt kneet og barbere håret kanin fra dette området bruker en sikkerhet barbermaskin.
    2. Eventuelt desinfisere prosedyren området 3 x med povidon joden løsning og 75% etanol. Bruk deretter sterilt gardiner etter at området er grundig tørket.
    3. Injisere 1-2 mL isotonisk saltvannsoppløsning, bruker en steril sprøyte sprøyte (2 mL), inn i kneet felles hulrommet fra laterale articular plass, flytte kneet 3-4 x, og deretter suge ut alle synovial væsken ved romtemperatur.
    4. Filtrere synovial fluid gjennom en 40 µm nylon celle sil for å fjerne alle partikler i 4 h.
  5. Kultur av rbSF-MSCs
    1. Samle den filtrerte fluid 50 mL sentrifuge rør og sentrifuge 1500 RPM for 10 min ved romtemperatur.
    2. Kaste nedbryting etter sentrifugering, vaske pellets med PBS, resuspend pellets med fullstendig kultur medium og deretter plate mediet i 100 mm retter.
    3. Inkuber retter på 37 ° C i en fuktet atmosfære som inneholder 5% CO2.
    4. Etter 48 timer, kan du fylle retter med fersk medium å fjerne ikke-tilhenger celler. Erstatt medium to ganger i uken i 2 uker som passasjen 0 (P0).
      Merk: Det bør være ca 1 x 104 tilhenger celler. Levedyktig celler/ml i SF er ca 2 x 102/mL.
    5. Etter 14 dager etter den første plating, bør mange koloniene har dannet i kultur retter. Velg koloniene større enn 2 mm i diameter. Merk hvor de valgte koloniene finnes ved å spore deres omkrets på parabolen bunnen.
    6. Kast koloniene < 2 mm bred, med cellen scrapers. Fordøye de valgte koloniene med ca 5 µL av 0,25% trypsin, ved hjelp av en kloning sylinder, og overføre koloniene til en ny rett som passering 1 (P1).
  6. Postoperativ dyr omsorg
    1. Følg standard institusjonelle operasjonelle prosedyrer for postoperativ overvåking og utvinning fra anestesi.
    2. Overvåke vitale av kaninen hvert 10 min før det har gjenvunnet bevissthet. Til slutt, overføre bevisst dyret til buret. Ikke returner en kanin som har gjennomgått kirurgi til selskapet av annet dyrene før det er helt gjenopprettet.
    3. Etter operasjon, rense området med 0,1% povidon jod, 2 x en dag for 3 dager.

2. CD90-positive magnetiske aktivert celle sortering (Mac) rbSF-MSCs og primære kultur

  1. Eksempel forberedelse
    1. Når cellene rundt 80% confluency, Sug opp mediet og legger 1-2 mL 0,25% Trypsin-EDTA til hver rett.
    2. Inkuber retter for 2-3 min å tillate celle løsrivelse.
    3. Når cellene er koblet fra, kan du legge til en lik mengde kultur medium å deaktivere trypsin.
    4. Cellen suspensjon passere en 40 µm celle sil, samle filtratet i en 15 mL tube, og deretter spinne ned cellene på 600 × g i 10 min ved romtemperatur.
    5. Resuspend celle pellet i Mac-maskiner med buffer (PBS, pH 7.2, 0,5% bovin serum albumin og 2 mM EDTA) og telle hvor cellen.
  2. Magnetisk merking
    Merk: Sortere rbSF-MSCs med en magnetisk-aktivert celle sortering kit som inneholder kolonner, en stand og skilletegn (se Tabell for materiale).
    1. Fastslå hvor cellen ved hjelp av en hemocytometer.
    2. Sentrifuge celle suspensjon 300 × g i 10 min på 4 ° C. Helt Sug opp nedbryting.
    3. Legge til 80 µL av rørets buffer per 107 totalt celler.
    4. For 107 totalt celler, legger du til 20 µL av microbeads konjugert med et monoklonalt anti-kanin CD90 antistoff.
    5. Bland de magnetiske perler og jevnt i rørene, deretter ruge dem på 4 ° C i 15 min i mørket.
    6. Legg 1 mL av buffer per 107 celler til røret, og deretter virvel det 300 × g i 10 min på 4 ° C å vaske cellene. Kaste nedbryting etter sentrifugering.
    7. Resuspend pellet i 500 µL av buffer per 107 celler.
  3. Magnetisk separasjon
    1. Plass kolonnen med kolonnen vingene foran i magnetfeltet av magnetiske separatoren.
    2. Skyll kolonnen magnetiske skilletegn (MS) med 500 µL av bufferen per 107 celler.
    3. Overføre enkeltcelle suspensjon i kolonnen. La negative cellene passere magnetfeltet forkaste disse umerkede cellene.
    4. Vask kolonnen 1-2 x med 500 µL av bufferen per 107 celler og kast gjennomflytsenhet.
    5. Overføre kolonnen til en sentrifuge tube (15 mL).
    6. Legg 1 mL av bufferen per 107 celler i kolonnen, og deretter umiddelbart skyve stempelet i kolonnen å skylle ut magnetisk merket cellene.
    7. Gjenta nevnte andre MS Column å øke renheten av CD90+ celler som kan berike eluted brøken.
    8. Sentrifuge celle suspensjon 300 × g i 10 min, Sug opp nedbryting og resuspend det med kultur medium.
  4. Kultur i CD90+ rbSF-MSCs
    1. Vaksinere cellene i 100 mm retter etter magnetiske aktivert celle sorteringen.
    2. Inkuber retter på 37 ° C i en fuktet celle inkubator med 5% CO2.
    3. Når 80-90% samløpet av primære kultur er oppnådd, ca 7-10 dager, fordøye tilhenger cellene med 0,25% Trypsin-EDTA og passasje dem på en 1:2 fortynning å passering 2 (P2).
    4. Bruke samme metode for å passere cellene til passering 3 (P3), som kan brukes i vitro analyser.
      Merk: Etter sub-kultur og rensing, ca 1 x 107 rbSF-MSCs er oppnådd.

3. identifisering av rbSF-MSCs

  1. Overflaten markør bekreftelse på rbSF-MSCs av flowcytometri
    1. Når MSCs er 80-90% confluent på P3, vask cellene med PBS og behandle dem med 1 mL av 0,25% Trypsin-EDTA. Deretter ruge MSCs ved 37 ° C i 2-3 minutter til cellene, kobles.
    2. Høste celler med 10 mL PBS, overføre dem til en konisk tube (15 mL) og sentrifuge dem 300 × g i 5 minutter ved romtemperatur.
    3. Kast supernatants. Resuspend celle pellet i 500 µL av PBS og overføre den til en 1,5 mL tube.
    4. Inkuber en 1: 100 fortynning av FITC-konjugerte og PE-konjugerte antistoffer (isotype, FITC-CD34/PE-CD45, FITC-CD105/PE-CD44) 1t i mørket på 4 ° C.
    5. Sentrifuge denne blandingen på 300 × g i 5 minutter ved romtemperatur og vask cellene to ganger med PBS med sentrifugering 300 × g i 5 min hver gang. Kast supernatants.
    6. Resuspend cellene i 500 µL av PBS, overføre celle suspensjon i en runde bunn tube (5 mL) og analysere den med en flyt cytometer.
      Merk: Hente data på en cytometer utstyrt med to fluorescens kanaler: 533/30 og 585/40. For hver isotype fluorescens, bruke kontrollen isotype justere riktige laser spenningen og angi minimum intensitet pålagt å skaffe et fluorescens histogram som viser både venstre og høyre kanter på toppen. Samle minst 10.000 hendelser for de statistiske analysene.
  2. Multidifferentiation av rbSF-MSCs
    Merk: Bruk P3 rbSF-MSCs for i vitro multidifferentiation analyser.
    1. Osteogenic differensiering
      1. Forberede osteogenic induksjon mediet: DMEM basic (1 x) som inneholder 50 mM L-ascorbic syre-2-fosfat, 10 mM α-glycerophosphate og 100 nM i deksametason.
      2. Frø cellene på 103 celler/cm2 i en 6-og vev kultur plate og kultur dem i osteogenic induksjon medium.
      3. Endre induksjon mediet hver 3 dager i 3 uker.
      4. Fastsette cellene med 4% formaldehyd i 30 min ved romtemperatur etter differensieringen er fullført, stain cellene med 1% Alizarin rød for 5 min og deretter vaske dem 3 x med PBS15.
    2. Adipogenic differensiering
      1. Forberede adipogenic induksjon mediet: DMEM basic (1 x) som består av 100 mM av indomethacin, 10 mg/mL av rekombinant menneskelige insulin, 1 mM av dexamethasone og 0,5 mM av 3-isobutyl-1-methylxanthine.
      2. Behandle P3 rbSF-MSCs i 3 uker i adipogenic induksjon medium.
      3. Etter 3 uker, beis nøytral lipid vacuoles bruker olje Red O for å bekrefte adipogenic differensiering. Fastsette cellene i en 4% formaldehyd løsning for 30 min ved romtemperatur, og deretter vaske dem 3 x med PBS16.
    3. Chondrogenic differensiering
      1. Forberede chondrogenic induksjon mediet: DMEM basic (1 x) som består av 10 ng/mL av TGFβ1, 1% sin supplement, 0,35 mM L-proline, 100 nM i deksametason, 50 mM L-ascorbic syre-2-fosfat, og 1 mm natrium pyruvate.
      2. Bruk pellet dyrking for chondrogenic induksjon. Sentrifuge 5 × 105 P3 rbSF-MSCs 1500 RPM for 10 min i et polypropylen rør (15 mL) å danne pellets.
      3. Kultur pellets for 3 uker med chondrogenic induksjon mediet.
      4. Endre mediet hver 3 dager i 3 uker.
      5. Etter 3 uker induksjon, legge celle pellets med parafin, delen det i 4 mm skiver og stain dem med 0,1% Toluidine blå for 30 min romtemperatur17.
  3. Totale RNA utvinning og analyse av kvantitative sanntids polymerasekjedereaksjons (qRT-PCR)
    1. Isolere den totale RNA cellene etter 3 uker differensiering induksjon bruke kommersielle RNA utvinning kit (se Tabell for materiale).
      1. Fjerne kultur medium i kultur parabol og legger 1 mL av isolasjon reagens.
      2. Lyse cellene av gjentatte pipettering til løsningen er homogen. Inkuber det ved romtemperatur for 3 min.
      3. Overføre cellen lysate til en 1,5 mL microcentrifuge tube.
      4. Legge 100 µL av kloroform, riste den av hånd 15 x og ruge blandingen ved romtemperatur for 3 min.
      5. Sentrifuge røret på 12.000 × g i 15 min på 4 ° C. Overføre til supernatants til en ny 1,5 mL microcentrifuge tube.
      6. Legg til 500 µL av isopropanol og utløse RNA i 10 min ved romtemperatur.
      7. Sentrifuge 12.000 × g for 10 minat 4 ° C. RNA pellet skal vises nederst i røret.
      8. Fjern nedbryting og deretter legge til 500 µL av 75% etanol. Kort spinne røret i flere sekunder å vaske RNA-pellets. Sentrifuge det 7500 × g i 5 min på 4 ° C.
      9. Fjern gjenværende etanol.
      10. Oppløse RNA pellet i 10 µL DEPC vann og plassere rør på is.
    2. Omvendt transkribere totale RNA i cDNA med en DNA-syntese kit (se Tabell for materiale).
      Merk: Utføre alle følgende på is.
      1. Klargjør omvendt transkripsjon master blandingen.
      2. Legg til 25 µL av DNase-behandlet hver tube med 1 µg av.
      3. Inkuber blandingen på følgende temperaturene ved hjelp av en PCR termisk cycler: 26 ° C i 10 min (for å tillate den tilfeldige hexamers å anneal), 42 ° C for 45 min (omvendt transkripsjon) og 75 ° C i 10 min (å deaktivere revers transkriptase).
      4. Umiddelbart analysere den resulterende cDNA av kvantitative sanntid PCR, eller lagre den på 20 ° C.
    3. Utføre gene expression analysen med en kvantitativ sanntids PCR-system.
      1. Bruke qRT PCR Master Mix (se Tabell of Materials) til å utføre PCR. PCR primere for GAPDH, Runx2, Agg og PPARγ vises i tabell 1.
      2. Beregne genuttrykk med metoden 2ΔΔCT .
      3. Utføre en statistisk analyse ved hjelp av standard statistisk programvare. Bruke en uavhengig eksempel t-testen til å sammenligne gruppe betyr.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Isolasjon, rensing og kultur av rbSF-MSCs:
Denne protokollen bruker Mac for å isolere rbSF-MSCs, basert på uttrykket av MSC overflaten merket CD90. Et prosessflytdiagram rbSF-MSCs' isolasjon, rensing, og karakterisering og i vitro kultur protokollen er vist i figur 1.

Celle morfologi etter magnetiske aktivert celle sortering (Mac) med CD90:
For det første for Mac, immunolabel MSCs med CD90 magnetiske perler. Etter sentrifugering, resuspend maksimalt 107 celler i 80 µL av en forkjøles sortering buffer, og deretter legge til 20 µL av CD90 magnetiske perler, etterfulgt av vortexing og inkubasjon på 4 ° C i 15 min. Etter vask cellene med 1 mL av sortering bufferen og resuspend dem i 500 µL av sortering bufferen. Før du fortsetter med den magnetiske sorteringsrekkefølgen, gjenta vask trinn. Denne viktige fremgangsmåten er vist i figur 2.

Før du sorterer vises tilhenger kanin synovial fluid celle populasjoner heterogene morfologi, som inneholder forskjellige celletyper og størrelser (figur 3A-C). Etter Mac utstilt celle populasjoner homogen morfologi. Cellen ble økt med sub-kultur (figur 3D-F).

Overflate egenskaper av Mac-beriket rbSF-MSCs:
Fluorescens-aktivert celle sortering (FACS) ble utført for å analysere anriking av rbSF-MSCs av Mac med CD90. Før Mac bestod befolkningen celle av ca 40% MSCs (figur 4CD, isotype kontroller i figur 4A,B). Etter Mac inneholdt beriket befolkningen ca > 99% MSCs (figur 4E,F). Blodkreft avstamning celle markørene CD34 og CD45 var, på 0.318%, begge sjelden uttrykk etter Mac, som er en nedgang fra deres første uttrykk 25,9%. Før valget, var det om 28% CD90+ celler (figur 4G); etter rensing, ca 98% CD90+ celler ble innhentet (Figur 4 H).

Multilineage differensiering potensialet til rbSF-MSCs:
For å karakterisere kapasiteten til rbSF-MSCs til å skille ut de forskjellige linjene som osteogenic, adipogenic og chondrogenic celler, rbSF-MSCs beriket av Mac var samtidig kultivert i en bestemt differensiering medium og en differensiering medium uten cytokin som kontroller. Når induksjon ble fullført, slektslinje kundespesifikk markører ble analysert av flekker og RT PCR. Alizarin røde flekker av kalsium forbindelser har vist at mineralholdig knuter hadde dannet i rbSF-MSCs etter 3 uker under osteogenic induksjon forhold (figur 5A). Etter 3 uker med adipogenic induksjon, kan en opphopning av lipid-rik vacuoles oppdages av intracellulær olje Red O flekker (figur 5B). For 21 dager av chondrogenic induksjon, var celle pellet histologisk assayed med toluidine blå flekker. Celler positivt for flekker (til proteoglycan) ble betraktet som chondrocyte-lignende celler (figur 5C). Ligner dette resultatet, en kvantitativ analyse av genuttrykk av differensiering potensielle også bevist differensiering kapasiteten til disse cellene. Uttrykket nivåene Agg (merketråd chondrocyte), PPARγ (en adipogenic markør) og Runx2 (en osteoblast markør) ble upregulated under indusert forhold. Disse dataene viste multipotent differensiering evnen til rbSF-MSCs til trilineages (figur 5 d).

Figure 1
Figur 1: Full skjematisk isolasjon, rensing og karakterisering av SF-MSCs av New Zealand hvit kanin. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: protokollen for magnetisk aktivert celle sortering (Mac) med CD90. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: morfologi av monolayer kultivert rbSF-MSCs før og etter Mac som undersøkte under vanlige invertert mikroskopi. A-C) Før du sorterer vise tilhenger kanin synovial fluid celle populasjoner heterogenitet. De inneholder ulike celletyper og størrelser, som ovale, lang-spindel, kort-spindel og stellate morfologi. Viktigste morfologi av P2 og P6 er en spindel morfologi (A: P2, B: P3, C: P6). D-F) Etter Mac med CD90 forevise celle populasjoner en homogen morfologi. Med en sub-kultur, celle nummer øker (D: P2, E: P3, F: P6). Skala bar = 100 µm. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: Identifikasjon av rbSF-MSC overflate markører. Bruke flyt cytometri analyse, er rbSF-MSCs positivt for MSC markørene CD44 og CD105, mens negativ for endothelial celle markøren CD34 og blodkreft celle markøren CD45. Før Mac har disse cellene en lav rate av positivitet for CD44 og CD105. Men etter Mac var frekvensen av positivitet høy. A, B) Disse topp to bilder viser isotype kontrolldata. C, D) Disse resultatene viser at før Mac rbSF-MSC befolkningen består av ca 40% MSC celler. E, F) Etter Mac inneholder befolkningen beriket > 99% MSC celler. G, H) Disse bildene viser flyt cytometri analyse av CD90+ markør, (G) før og (H) etter Mac sortering. Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: analyse av slektslinje kundespesifikk markører av flekker og RT PCR. A) Alizarin røde flekker viser at mineralholdig knuter danne under osteogenic induksjon i 3 uker. B) etter 3 uker med adipogenic induksjon, akkumulering av lipid-rik vacuoles oppdages av intracellulær olje Red O flekker. C) For 3 uker med chondrogenic induksjon, celle pellet var histologisk assayed med toluidine blå flekker. Celler positivt for flekker (til proteoglycan) ble betraktet som chondrocyte-lignende celler. Skala bar = 100 µm. D) etter dyrking i 3 uker, den relative mRNA uttrykket osteoblast markører (Runx2), adipogenic markører (PPARγ) og chondrogenic markører (Agg) er oppdaget. For alle analyser, p verdiene < 0,01 ble ansett som statistisk signifikante forskjeller ved hjelp av Kruskal-Wallis-testen (vist som **). Klikk her for å se en større versjon av dette tallet.

Gener Videresende primer (5-3') Omvendt primer (5-3')
Runx2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
AGG GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARΓ2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

Tabell 1: Liste over gener og primere brukt i denne studien for kvantitative sanntid PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Eksistensen av MSCs i synovial væsken gir et alternativ for cellen-basert terapi. Tidligere studier har vist at skade områder inneholder større mengder mesenchymal stamceller i deres synovial væske, som kan være positivt korrelert med etter skade perioden5. MSCs i synovial væske kan være gunstig for vev for å øke spontan helbredelse etter en skade18,19. Klinisk anvendelse av SF-MSCs har sjelden blitt dekket i litteraturen, hovedsakelig fordi mekanismer for SF-MSCs i leddene er fortsatt udefinert20. Jones et al. 21 rapporterte at hSF-MSC tallene i kneledd betydelig øke 7-fold under de tidlige stadiene av artrose (OA). De mente at de økte SF-MSCs kan bidra til å opprettholde den fysiologiske homeostase for leddene.

En ideell dyremodell er et uunnværlig verktøy i utviklingen av therapeutics utnytte regenererende og translasjonsforskning medisin. Selv om åpenbare forskjeller mellom mennesker og kaniner, kaninen er mye brukt som en dyr modell for studiet av vev gjenfødelse7, derfor bedt oss å velge den som modell for vår studie av SF-MSCs. En av de mer skremmende hindringene i dette arbeidet er at isolering av SF-MSCs ofte resulterer i variert suksess priser og lav kolonien frekvenser, som rapportert i tidligere forskning5. Derfor, mange forskere har fokusert på suksess priser og optimalisering av isolering av MSCs fra SF.

Denne studyeffectively brukes en Mac prosedyre for høy sortering renhet og levedyktigheten til CD90+ MACSs kanin synovial fluid22. Dette Mac systemet benytter magnetiske microbeads konjugert til svært spesifikke antistoffer kombinert til en bestemt celle-overflate antigen, CD90 i dette tilfellet, og tillater valg av bestemt celle måltypen, nemlig CD90 uttrykke celler. Før rensing med CD90 microbeads kultur vi vanligvis av primære rbSF-MSCs i 14 dager. I denne perioden, er mange koloniene dannet i kultur retter. Denne protokollen foreslår å velge koloniene større enn 2 mm i diameter. Når du bruker kloning sylinderen for kolonien valg, observere vi nøye under mikroskopet. Enkelt kolonien overføres videre for rensing.

Under prosessen med separasjon og rensing, er CD90 uttrykke cellene som ble merket magnetisk tiltrukket av det magnetiske feltet i skilletegnet i kolonnen mens umerkede cellene strømme gjennom. Etter vaskeprosessen, fjernes kolonnen fra det magnetiske feltet i skillet og målcellene er elut fra kolonnen. Dette bestemte Mac microbead tilnærming kan isolering av rbSF-MSCs som spesielt uttrykt stilk cellen overflaten markørene CD44 og CD105, viser at disse isolerte cellene er mesenchymal stamceller i stedet for blodkreft cellene23. Disse renset rbSF-MSCs kan være kulturperler i vitro over lang tid uten noen betydelig endring av morfologiske funksjoner og markør uttrykk. Videre forevise rbSF-MSCs beriket av Mac en multipotent differensiering evnen til flere avstamning cellene, inkludert i chondrogenic, adipogenic og osteogenic celler.

Driften av MACS er en lett-å-utføre protokoll og kan gjøres på benken23. I tillegg til US Food and Drug Administration (FDA) har godkjent Mac microbead-basert teknologi, og dermed er det lett å utføre for klinisk bruk24. CD90 er en overflate av mesenchymal stamceller, og forskere har vist at CD90 positive MSCs har en bedre chondrogenic differensiering muligheten til25,26. Pluripotency av MSCs har vært preget basert på morfologi og uttrykk for spesifikke indikatorer for stamceller27.

Denne studien har flere begrensninger. Den første brist i denne protokollen gjelder overflate markører vi undersøkt. Basert på en uttalelse av International Society for mobilnettet terapi (ISCT), minimal kriteriene for å definere multipotent MSCs er positivt for CD90, CD105, CD44 og CD73, og negativ for CD11b, CD14, CD34 eller CD45, og CD79a eller HLA-DR28. Med mål om begrensende innsats og utgifter er nødvendig å teste hele panelet, utvalgt forskere i denne studien nøye to av de negative markørene og to av de positive markørene anbefales. For det andre, det tar lang tid å danne kolonier som velges for videre studier. I tillegg er hypertrofi et stort problem under chondrogenic induksjon av SF-MSCs i vitro. På senere stadium, hypertrofisk chondrocytes alltid uttrykke type X kollagen (COLX), matrise metalloproteinase 13 (MMP13) faktor alkalisk fosfatase (ALP) og runt-relaterte transkripsjon 2 (Runx2)29. Forskning tyder på at tredimensjonale (3D) pellet kultur og dynamiske systemer coculture med chondrocytes er fordel for MSC stabilt chondrogenic differensiering30,31. I denne studien, ble en pellet kultur-systemet brukt for chondrogenic induksjon av MSC for å unngå hypertrofi.

I konklusjonen, har vi etablert en enkel metode for isolasjon og rensing av MSCs fra articular hulrom rødme væske og preget av MSCs fikk der. Denne protokollen har gitt en plattform for utforskning og undersøkelse av articular synovial fluid-avledet MSCs' potensielle verktøyet i romanen felles gjenfødelse strategier.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer at de har ingen konkurrerende økonomiske interesser.

Acknowledgments

Denne studien ble økonomisk støttet av følgende tilskudd: Natural Science Foundation i Kina (nr. 81572198; Nei 81772394); Fondet for høyt nivå medisinsk disiplin byggingen av Shenzhen University (nr. 2016031638); Medisinsk forskning grunnvoll Guangdong provinsen, Kina (nr. A2016314); og Shenzhen vitenskap og teknologi-prosjekter (nr. JCYJ20170306092215436; nei. JCYJ20170412150609690; nei. JCYJ20170413161800287; nei. SGLH20161209105517753; nei. JCYJ20160301111338144).

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics