Manyetik aktif hücre stratejileri yalıtmak ve Sinovyal sıvı elde edilen mezenkimal kök hücre bir tavşan modelinden arındırmak için sıralama

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Bu yazı basit yalıtım ve Yeni Zelanda beyaz tavşan synovial sıvı mezenkimal kök hücre arınma için basit ve ekonomik Protokolü sunar.

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mezenkimal kök hücre (MSCs) hücre tabanlı terapisi için ana hücre kaynaktır. MSCs eklem boşluğuna synovial sıvı üzerinden potansiyel olarak kıkırdak doku mühendisliği için kullanılabilir. MSCs sinovyal sıvının (SF-MSCs) üzerinden artiküler rejenerasyon için umut verici aday olarak kabul edilmiştir ve onların potansiyel terapötik yarar onları geç bir önemli araştırma konusu yaptı. SF-MSCs Yeni Zelanda beyaz tavşan diz boşluğuna üzerinden bir en iyi duruma getirilmiş translasyonel model olarak insan rejeneratif tıp değerlendirmek için istihdam edilebilir. (Mac) teknolojileri sıralama CD90 tabanlı manyetik aktif hücre, aracılığıyla bu iletişim kuralı başarıyla tavşan SF-MSCs (rbSF-MSCs) Bu tavşan modelinden elde eder ve daha fazla tam olarak MSC fenotip bu hücreler için ayırt etmek için onları ikna tarafından gösterir dokusunu, adipositler ve kondrosit. Bu nedenle, bu yaklaşım Biyoloji araştırma hücre ve doku mühendisliği basit ekipman ve yordamları kullanarak uygulanabilir.

Introduction

MSCs kıkırdak lezyonlar için özellikle rejeneratif tıp için değerli bir kaynak olarak önerilmiştir. MSCs, kondrosit, dokusunu, adipositler, iskelet miyositler ve visseral stromal hücreler, dahil olmak üzere geniş alanlar için kök hücre transplantasyonu onların yüksek genişleme hızı ve çoklu soy farklılaşma potansiyel1nedeniyle genişletin. MSCs iskelet kas, synovium, kemik iliği ve yağ dokusu2,3,4ayrılmış olabilir. Bulgular confirmed Sinovyal sıvı MSCs varlığında da mevcuttur ve önceki araştırma synovial sıvı kaynaklı MSCs (SF-MSCs) eklem rejenerasyon5,6için umut verici aday olarak belirlemiştir.

Ancak, araştırma ve insan örnekleri üzerinde preklinik deneme tabi birçok etik sorunlar vardır. Bunun yerine, tavşan olan ve en sık hayvan türlerinin nakli MSCs kıkırdak hasarı onarabiliriz göstermek için kullanılan olmaya devam. Son yıllarda vivo içindebu hücreler çoğu insan için benzer MSCs onların Hücresel biyoloji ve doku fizyolojisi ve araştırmacılar giderek artan sayıda tavşan mezenkimal kök hücre (rbMSCs) her iki vitro inceledik. Benzer şekilde, rbMSCs plastik yüzeyler, iğ-fibroblast morfoloji olduğu gibi insan MSCs görüntüleme kalarak yeteneğine sahiptirler. Ayrıca, tavşan mezenkimal örnekleri basit ve kolay7elde etmek vardır. Ayrıca, en önemli makas are rbMSCs yüzey işaretleyicileri, CD44, CD90 ve CD105, gibi hızlı ve potansiyel çoklu soy farklılaşma, MSC nüfus tanımlaması için ölçüt ile anlaşma olduğu korunur Hücresel tedavi8,9için uluslararası toplum tarafından tanımlanan. Özellikle, Sinovyal sıvı chondroprogenitors ne zaman TGF-β1, böylece onları phenotypically eklem kıkırdak rejenerasyon10,11için uygun hücre kaynakları hale tarafından indüklenen hipertrofik sigara chondrogenesis yeteneğine sahiptirler, 12.

Ancak, SF-MSCs yalıtım göbek kordonu, yağ dokusu, periferik kan ve kemik iliği de dahil olmak üzere diğer dokulardan büyük ölçüde farklıdır. Akış Sitometresi yöntemi belirli ortam ve son derece pahalı aletler13gerektirse de, arıtma ve SF-MSCs sıralama için en yaygın bir yaklaşım akış sitometresi ve immunomagnetic boncuk tabanlı sıralama, şu anda.

Bu makale, beyaz tavşan Yeni Zelanda'dan synovial sıvı örnekleri basit ve minimal invaziv topluluğu için bir yordam sunar. Yordamı, boyunca rbSF MSCs stabil genişletilmiş vitro ve CD90 olumlu manyetik boncuk tabanlı yordamlara ile izole. Son olarak, protokol MSCs yüksek saflıkta ve canlılığı hasat hücre kaynaklarından elde etmek nasıl gösterir.

Bu protokol için temel morfolojisi, belirli işaretleri ve pluripotent kök hücreler için ifade izole rbSF MSCs karakterizedir. CD45 ve CD34 ifade negatif ise akış sitometresi tabanlı immunophenotyping CD44 ve CD105, önemli bir pozitif ifade ortaya koymaktadır. Son olarak, bir vitro tahlil rbSF-MSCs için bu hücreleri osteojenik, Adipojenik ve chondrogenic farklılaşma göstermektedir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tüm hayvan deneyleri Yerel Etik Komitesi kılavuzlarınıza uygun olarak yapılmıştır ve tüm hayvan yordamları kurumsal hayvan bakım ve kullanım Komitesi, Shenzhen ikinci insanların hastane, Shenzhen Üniversitesi tarafından onaylanmıştır.

1. yalıtmak ve rbSF MSCs kültür

  1. Hayvan yordamı için hazırlıklar
    1. İskeleti Olgun kadın Yeni Zelanda beyaz tavşan rbSF koleksiyonu için hazırlamak-MSCs. gerçekleştir bir klinik muayene öncesinde anestezi ve Artrosentez yordamı bir gün tavşan.
      Not: fiziksel muayene ağırlık (2,0-2,5 kg), cinsiyet (kadın) ve vücut ısısı, solunum ve kalp hızı içermelidir. Klinik olarak sağlıklı tavşan için parametre aralıkları 30-50 dk solunum hızı için nabız 220-280 dk'ya ve vücut ısısı 38-39 ° C dir.
    2. Hayvanlar anestezi önce 6 h için hızlı.
  2. Ürünleri ve hayvan anestezi prosedürü
    1. Bir kafes ile tavşan dizginlemek (bkz. Tablo reçetesi) ve % 3 Fentobarbital sodyum bir doz 1 mL/kg genel anestezi için marjinal kulak damar içine enjekte etmek.
    2. Tavşan rahat bir yaslanmış dorsal konumda yerleştirin.
    3. Solunum, kalp hızı ve vücut ısısı tavşan anestezi sırasında izleyin.
    4. Oftalmolojik merhem gözleri üzerinde kuruluk anestezi sırasında engellemek için kullanın.
    5. Guedel'ın sınıflandırma14takip anestezi derinliği değerlendirmek.
  3. MSCs yalıtım ve ekimi için hazırlık
    1. RbSF-MSCs yetiştirmek için ticari kültür ortamının 500 mL hazırlamak ( Tablo malzemelerigörmek) ile takıma % 10 ticari ek (bakınız Tablo malzemeler), % 10 fetal Sığır serum (FBS) ve % 1 penisilin-streptomisin.
    2. Bir su banyosu içinde 37 ° C'de kültür orta kuluçkaya.
    3. Fosfat tampon salin (PBS) 500 mL hücre izolasyon ve hücre çamaşır için hazırlayın.
    4. 100 mL izotonik salin çözeltisi diz kavite Artrosentez yordamı için hazırlayın.
  4. Tavşan diz eklem sinovyal fl UID topluluğu
    1. Bir alan yaklaşık 5 x 5 cm boyutunda diz çevresi seçme ve bir emanet elektrikli tıraş makinesi kullanarak bu bölgeden tavşan saç tıraş.
    2. Alternatif olarak, dezenfekte yordamı sitesi 3 x povidone iyot çözüm ve % 75 etanol ile. Daha sonra bölgeyi iyice kuruduktan sonra steril örtüler uygulayın.
    3. 3-4 x 1-2 mL steril şırınga (2 mL), yanal artiküler boşluk diz eklem boşluğundan içine diz hareket kullanarak izotonik salin çözeltisi enjekte ve oda sıcaklığında sinovyal sıvının dışarı emmek.
    4. Sinovyal fluid 4 h içinde herhangi bir enkaz kaldırmak için bir 40 µm naylon hücre süzgeç aracılığıyla filtre.
  5. RbSF-MSCs kültürü
    1. Filtre uygulanmış fluid 50 mL santrifüj tüpleri ve oda sıcaklığında 10 dakika için 1500 rpm'de santrifüj toplamak.
    2. Süpernatant Santrifüjü sonra atmak, Pelet PBS ile yıkayın, Pelet tam kültür orta ile resuspend ve 100 mm yemekleri ortamda plakası.
    3. Bulaşıkları içeren % 5 CO2oksijen bir atmosferde 37 ° C'de kuluçkaya.
    4. 48 saat sonra bulaşıkları yapışık olmayan hücreler kaldırmak için taze orta ile doldurmak. Orta geçit 0 (P0) olarak 2 hafta boyunca haftada iki kez değiştirin.
      Not: 1 x 104 yapışık hücreleri olmalıdır. Geçerli hücre/ml SF yaklaşık 2 x 102/mL vardır.
    5. İlk kaplama sonraki 14 gün sonra kültür yemekleri birçok koloniler oluşturdular. 2 mm'den daha büyük koloniler çapı seçin. Seçili kolonileri onların çevresi çanak alt izini sürerek yerlerini mi Mark.
    6. Koloniler < 2 mm genişliğinde, hücre Kazıma aletleri kullanarak atmak. % 0.25 tripsin, klonlama bir silindir kullanarak yaklaşık 5 µL ile seçilen kolonileri sindirmek ve koloniler için yeni bir tabak geçiş 1 (P1) aktarmak.
  6. Ameliyat sonrası hayvan bakımı
    1. Ameliyat sonrası izleme ve anestezi kurtarma standart kurumsal çalışma yordamları izleyin.
    2. Bilinci yerine geldi kadar hayati tavşan her 10 min izlemek. Son olarak, bilinçli hayvan kafese aktarın. Tamamen iyileşmiş kadar bu şirketin diğer hayvanların için cerrahi uğramıştır bir tavşan döndürmüyor.
    3. Sonrası işlemi, % 0,1 povidone iyot, 2 x bir gün 3 gün boyunca sitesiyle dezenfekte edin.

2. CD90-pozitif manyetik aktif hücre sıralama (Mac) rbSF-MSCs ve birincil kültür

  1. Numune hazırlama
    1. Hücreleri çevresinde ulaştığınızda % 80 confluency, orta Aspire edin ve sonra 1-2 mL % 0.25 ekleyin tripsin-EDTA her yemeğin için.
    2. Bulaşıkları hücre dekolmanı izin vermek 2-3 dakika için kuluçkaya.
    3. Sonra hücreleri ayrılır, orta kültür tripsin devre dışı bırakabilirsiniz için eşit miktarda ekleyin.
    4. Hücre süspansiyon 40 µm hücre süzgeç aracılığıyla geçmek, filtrate 15 mL tüp içinde toplamak ve sonra spin 600 × g oda sıcaklığında 10 dakika için hücreleri aşağı.
    5. Hücre Pelet tampon çalıştıran Mac resuspend (PBS, pH 7.2, % 0.5 Sığır serum albümin ve 2 mM EDTA) ve ardından hücre saymak.
  2. Manyetik etiketleme
    Dikkat: rbSF-MSCs bir manyetik aktif hücre içeren sütunlar, bir stand ve ayırıcılar ( Tablo malzemelerigörmek) setini sıralama sıralama.
    1. Bir hemasitometre kullanarak cep numarasını belirleyin.
    2. Hücre süspansiyon vasıl 300 × g 4 ° C'de 10 dakika santrifüj kapasitesi Tamamen süpernatant Aspire edin.
    3. Resuspension arabellek 107 toplam hücre başına 80 µL ekleyin.
    4. 107 toplam değerleri için bir monoklonal Anti-tavşan CD90 antikor ile Birleşik lastikteki 20 µL ekleyin.
    5. Manyetik boncuklar ve tüpler eşit hücrelerde karıştırın, sonra onları karanlıkta 15 dakika 4 ° C'de kuluçkaya.
    6. 107 hücre başına arabellek 1 mL tüp ekleyin ve sonra vasıl 300 × g 4 ° C'de hücreler yıkamak için 10 dk santrifüj kapasitesi. Süpernatant Santrifüjü sonra atın.
    7. Pelet arabelleği 107 hücre başına 500 µL resuspend.
  3. Manyetik ayırma
    1. Sütun ön sütun kanatlı manyetik ayırıcı manyetik alana yerleştirin.
    2. Arabellek 500 µL ile manyetik ayırıcı (MS) sütun başına 107 hücre durulayın.
    3. Tek hücre süspansiyon sütuna aktarmak. Etiketlenmemiş bu hücreler atmak için manyetik alan geçmek negatif hücreleri izin.
    4. Sütun başına 107 hücreleri 1-2 x 500 µL arabelleği ile yıkayın ve akışı aracılığıyla atın.
    5. Sütun bir santrifüj tüpüne (15 mL) aktarın.
    6. 1 mL 107 hücre başına arabellek sütuna ekleyin ve daha sonra hemen pistonu manyetik olarak etiketli hücreleri temizlemek için sütun içine itin.
    7. CD90 saflığı artırmak için ikinci bir MS Column ile yukarıda belirtilen yordamı yineleyin+ hücreleri, eluted kesir zenginleştirebilirsiniz.
    8. Hücre süspansiyon vasıl 300 × g 10 dk santrifüj kapasitesi, süpernatant Aspire edin ve kültür ortamı ile resuspend.
  4. Kültür CD90+ rbSF-MSCs
    1. 100 mm yemekleri hücrelerde manyetik aktif hücre sıraladıktan sonra aşılamak.
    2. Bulaşıkları oksijen hücre kuluçka %5 CO237 ° C'de kuluçkaya.
    3. Ne zaman yaklaşık 7-10 gün, birincil kültür izdiham % 80-90 elde %0,25 tripsin-EDTA ve geçiş ile yapışık hücreleri sindirmek geçit 2 (P2) yapmak için bir 1:2 seyreltme, onları.
    4. Vitro deneyleri için kullanılan hücrelere passage 3 (P3), geçmek için aynı yöntemi kullanın.
      Not: alt-kültür ve arıtma sonra yaklaşık 1 x 107 rbSF-MSCs elde edilir.

3. rbSF-MSCs tanımlaması

  1. RbSF-MSCs akış sitometresi tarafından yüzey marker onayı
    1. MSCs % 80-90 birleşmesi, P3 olduğunuzda, PBS hücrelerle yıkayın ve % 0.25 ile 1 mL davranmasını tripsin-EDTA. Hücreleri müstakil kadar sonra 2-3 dk 37 ° C'de MSCs kuluçkaya.
    2. 10 mL PBS kullanarak hücre hasat, onları bir konik tüp (15 mL) içine aktarmak ve onları vasıl 300 × g oda sıcaklığında 5 dk santrifüj kapasitesi.
    3. Supernatants atın. Hücre Pelet PBS 500 µL içinde resuspend ve 1,5 mL tüp içine aktarın.
    4. 1: 100 seyreltme FITC Birleşik ve PE-Birleşik antikor (izotip, FITC-CD34/PE-CD45 FITC-CD105/PE-CD44) 4 ° C'de karanlıkta 1 h için kuluçkaya
    5. Bu karışımı oda sıcaklığında 5 min için 300 × g, santrifüj kapasitesi ve iki kez PBS içeren hücreleri tarafından Santrifüjü 300 × g 5 min için de her zaman yıkayın. Supernatants atın.
    6. PBS 500 µL hücrelerde resuspend, hücre süspansiyon bir yuvarlak alt tüp (5 mL) aktarmak ve akış sitometresi kullanarak analiz.
      Not: iki floresan kanalı ile donatılmış bir sitometresi verileri elde etmek: 533/30 ve 585/40. Her izotip floresan için izotip kontrol uygun lazer gerilimi ayarlamak için kullanın ve floresan histogramını tepe sol ve sağ kenarları görüntüler elde etmek için gereken en düşük yoğunluk ayarlayın. İstatistiksel analizler için 10,000 olayları en az toplamak.
  2. RbSF-MSCs multidifferentiation
    Not: Kullanım P3 rbSF-MSCs vitro multidifferentiation deneyleri için.
    1. Osteojenik farklılaşma
      1. Osteojenik indüksiyon orta hazırlamak: 50 mM L-askorbik asit-2-fosfat, α-gliserofosfat 10 mM ve 100 içeren DMEM basic (1 x) deksametazon nM.
      2. Hücreleri 103 hücreleri/cm2 6-iyi doku kültürü plaka'de tohum ve osteojenik indüksiyon ortamda kültür.
      3. İndüksiyon orta 3 günde 3 hafta için değiştirin.
      4. Farklılaşma tamamlandıktan sonra hücrelerin % 4 formaldehit, oda sıcaklığında 30 dakika ile düzeltmek, bağışıklık hücreleri ile % 1 Alizarin red 5 min ve o zaman yıkama onları 3 x ile PBS15.
    2. Adipojenik farklılaşma
      1. Adipojenik indüksiyon orta hazırlamak: indometazin 100 mM, 10 mg/mL rekombinant insan insülin, deksametazon 1 mM ve 3-izobütil-1-methylxanthine 0,5 mM DMEM temel (1 x).
      2. P3 rbSF-MSCs Adipojenik indüksiyon orta 3 hafta boyunca tedavi.
      3. 3 hafta sonra Adipojenik farklılaşma onaylamak için yağ kırmızı O kullanarak tarafsız lipid çarpıtmalardan leke. Oda sıcaklığında 30 dk için % 4 formaldehit çözüm hücrelerde düzeltmek ve sonra yıkayın PBS16ile 3 x.
    3. Chondrogenic farklılaşma
      1. Chondrogenic indüksiyon orta hazırlamak: 10 ng/mL TGFβ1, % 1'ek, 0.35 mM L-prolin, 100 deksametazon nM, sodyum pyruvate L-askorbik asit-2-fosfat ve 1 mm 50 mM ile oluşan DMEM basic (1 x).
      2. Pelet chondrogenic indüksiyon için kültür kullanın. 5 × 105 P3 rbSF-MSCs bir Pelet oluşturmak için polipropilen boru (15 mL) 10 min için 1500 rpm'de santrifüj kapasitesi.
      3. Granül chondrogenic indüksiyon orta ile 3 hafta boyunca kültür.
      4. Orta 3 günde 3 hafta için değiştirin.
      5. Sonra 3 hafta indüksiyon, parafin ile hücre Pelet katıştırmak, 4 mm dilimler halinde bölüm ve % 0.1 kullanarak leke toluidin blue oda sıcaklığında1730 dk için.
  3. Toplam RNA çıkarma ve nicel gerçek zamanlı polimeraz zincir tepkimesi (PCR qRT) göre analiz
    1. 3 hafta farklılaşma indüksiyon ticari RNA ayıklama kullanarak sonra hücrelerin toplam RNA kiti ( Tablo malzemelerigörmek) izole etmek.
      1. Kültür orta kültür tabakta kaldırın ve sonra yalıtım reaktif 1 mL ekleyin.
      2. Çözüm homojen olana tekrarlanan pipetting hücreleri parçalayıcı. 3 dakika oda sıcaklığında kuluçkaya.
      3. Hücre lysate 1.5 mL microcentrifuge tüp içine aktarın.
      4. Tarafından 15 x el salla ve 3 dakika oda sıcaklığında karışımı kuluçkaya kloroform 100 µL ekleyin.
      5. Tüp, 12.000 × g 4 ° C'de 15 dakika santrifüj kapasitesi Supernatants yeni bir 1.5 mL microcentrifuge tüp içine aktarın.
      6. İsopropanol 500 µL ekleyin ve 10 dakika oda sıcaklığında RNA çökelti.
      7. 10 minat için 12.000 × g, santrifüj 4 ° C. RNA Pelet tüp alt kısmında görünür olmalıdır.
      8. Süpernatant kaldırın ve sonra 500 µL % 75 etanol ekleyin. Kısaca RNA Pelet yıkamak birkaç saniye için tüp spin. 7.500 × g 4 ° C'de 5 min için de santrifüj kapasitesi
      9. Artık etanol kaldırın.
      10. DEPC su 10 µL RNA Pelet dağıtılması ve tüpler buza koyun.
    2. Ters cDNA DNA sentezi ile içine toplam RNA uyarlamak ( Tablo malzemelerigörmek) kit.
      Not: buz üzerinde aşağıdaki yordamları gerçekleştirin.
      1. Ters transkripsiyon ana karışımı hazırlayın.
      2. DNaz tedavi RNA'ın 25 µL her tüpün RNA'ın 1 µg ile ekleyin.
      3. Karışımı bir PCR termal cycler kullanarak aşağıdaki sıcaklıklarda kuluçkaya: 26 ° C (tavlamak rasgele hexamers izin vermek için) 10 dk, 42 ° C için 45 dk (Ters transkripsiyon) ve 75 ° C (ters transkriptaz devre dışı bırakma için) 10 dakika için.
      4. Hemen nicel gerçek zamanlı PCR tarafından elde edilen cDNA çözümlemek veya -20 ° C'de depolayın
    3. Nicel bir gerçek zamanlı PCR sistemi ile gen ifade analizi gerçekleştirin.
      1. QRT-PCR Master Mix kullanın (bakınız Tablo reçetesiPCR gerçekleştirmek için). PCR astar GAPDH, Runx2, Agg ve PPARγ için Tablo 1' de listelenmiştir.
      2. Gen ifadesinin 2ΔΔCT yöntemini kullanarak hesaplayın.
      3. Standart istatistiksel yazılım kullanarak bir istatistiksel analiz yapmak. Bir bağımsız örnek t-testi Grup anlamına gelir karşılaştırmak için kullanın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Yalıtım, arıtma ve kültür rbSF MSCs:
Bu protokol MAC'ler rbSF-MSCs, MSC yüzey işaret CD90 ifadeye dayalı izole etmek için kullanır. Süreç akış diyagramı rbSF MSCs yalıtım, arıtma ve karakterizasyonu ve vitro kültür Protokolü Şekil 1' de gösterilen.

Hücre morfolojisi (Mac) CD90 ile sıralama manyetik aktif hücre sonra:
İlk olarak, MAC'ler için immunolabel MSCs CD90 manyetik boncuklar ile. Santrifüjü sonra precooled bir sıralama arabellek 80 µL 107 hücrelerinin en resuspend ve CD90 manyetik boncuklar, ardından vortexing ve kuluçka 15dk için 4 ° C'de 20 µL ekleyin. Bundan sonra sıralama arabelleği 1 mL hücrelerle yıkama ve onları sıralama arabellek 500 µL içinde resuspend. Manyetik sıralama ile devam etmeden önce çamaşır adımı yineleyin. Önemli Bu yordam Şekil 2' de gösterilmiştir.

Sıralamadan önce farklı hücre tipleri ve boyutları (Şekil 3A-C) içeren heterojen morfoloji, yapisan tavşan synovial sıvı hücre popülasyonlarının görüntülenir. MAC'ler hücre popülasyonlarının homojen morfoloji sergiledi. Cep numarası ile alt-kültür (şekil 3D-F) yükseltilmiştir.

Yüzey özellikleri MAC'ler zenginleştirilmiş rbSF-MSCs:
Floresans aktif hücre sıralama (FACS) rbSF-MSCs zenginleştirme analiz etmek için MACS ile CD90 tarafından seslendirildi. MAC'ler önce hücre nüfusun yaklaşık % 40 MSCs (Şekil 4 cD; Şekil 4A,Bdenetimlerde izotip) oluşuyordu. MAC'ler, zenginleştirilmiş nüfus yaklaşık > %99 MSCs (Şekil 4E,F) içeriyordu. Hematopoetik lineage hücre veri işaretleyicilerini CD34 ve CD45 %0.318, her ikisi de nadiren MAC'ler sonra onların ilk ifadeden %25,9 bir düşüş olduğu ifade edildi. Seçimden önce vardı yaklaşık %28 CD90+ (Şekil 4 g) hücreleri; Arıtma, yaklaşık % 98 ' CD90+ sonra hücreleri (Şekil 4 H) elde.

Multilineage farklılaşma potansiyel rbSF-MSCs:
RbSF-MSCs kapasitesi çeşitli soy gibi ayırt etmek için karakterize etmek için osteojenik, Adipojenik ve chondrogenic hücreleri, MAC'ler tarafından zenginleştirilmiş rbSF MSCs aynı anda belirli farklılaşma orta ve buna kültürlü bir farklılaşma orta denetimleri hizmet etmek için sitokin olmadan. İndüksiyon tamamlandığında, lineage özgü işaretleri boyama tarafından analiz edildi ve RT-PCR. Alizarin kalsiyum bileşikleri boyama kırmızı nodüller mineralize osteojenik indüksiyon koşullar (5A rakam) altında 3 hafta sonra rbSF-MSCs içinde oluşmuş gösterdi. Adipojenik indüksiyon 3 hafta sonra lipid zengini çarpıtmalar bir birikimi hücre içi yağ kırmızı (Şekil 5B) boyama O tarafından tespit edilemedi. Chondrogenic indüksiyon 21 gün boyunca hücre Pelet histolojik olarak toluidin blue boyama ile denetlesinler. Hücreleri (proteoglikan) boyama için olumlu kondrosit benzeri hücreler (Şekil 5C) olarak kabul edildi. Benzer şekilde bu sonuç, farklılaşma potansiyeli gen ekspresyonu kantitatif analizini de bu hücreler ayırt etme yeteneğini kanıtladı. İfade düzeyde Agg (kondrosit marker), PPARγ (bir Adipojenik işaretleyici) ve Runx2 (bir osteoblast işaretleyici) indüklenen koşullar altında upregulated vardı. Bu veri rbSF-MSCs multipotent farklılaşma yeteneklilik içine trilineages (Şekil 5 d) kanıtladı.

Figure 1
Şekil 1: yalıtım, arıtma ve SF-MSCs Yeni Zelanda beyaz tavşan karakterizasyonu tam şematik. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2: manyetik aktif hücre (Mac) CD90 ile sıralama için protokolü. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: monolayer morfolojisi kültürlü rbSF-MSCs önce ve sonra sıradan altında incelendiğinde gibi MAC'ler ters mikroskobu. A-C) Sıralamadan önce yapisan tavşan synovial sıvı hücre popülasyonlarının heterojenite görüntüler. Bunlar farklı hücre tipleri ve boyutları, oval, uzun Milli, kısa Milli ve yildiz seklinde morfoloji gibi içerir. P2 ve P6 ana morfoloji iğ morfoloji olduğunu (A: P2, B: P3, C: P6). D-F) CD90 ile MAC'ler hücre popülasyonlarının homojen bir morfoloji sergi. Bir alt-kültür ile cep numarası artar (D: P2, E: P3, F: P6). Ölçek çubuğu 100 µm. = Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4: rbSF-MSC yüzey işaretleyicileri tanımlaması. Akış Sitometresi Analizi ile rbSF-MSCs CD44 ve CD105, MSC işaretçileri negatif endotel hücre işaretçisi CD34 ve CD45 hematopoietik hücre marker için süre için olumludur. MAC'ler önce bu hücreler olumluluk oranı düşük CD44 ve CD105 için var. Ancak, MAC'ler sonra pozitiflik oranı yüksek. A, B) Bu en iyi iki resim izotip kontrol verileri görüntüleyin. C, D) Bu sonuçlar gösterir MAC'ler daha önce rbSF-MSC nüfusun yaklaşık % 40 MSC hücrelerinin oluşmaktadır. E, F) Sonra MAC'ler, zenginleştirilmiş nüfus > %99 MSC hücreler içeriyor. G, H) Bu resimleri CD90 Akış Sitometresi Analizi göster+ işaretçisi, (G) önce ve sonra sıralama MAC'ler (H) . Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5: lineage özgü Marker boyama tarafından analiz ve RT-PCR. A) Alizarin kırmızı boyama gösterir mineralize nodüller osteojenik indüksiyon için 3 hafta altında oluşturur. B) Adipojenik indüksiyon 3 hafta sonra lipid zengini çarpıtmalardan birikimi tespit hücre içi yağ kırmızı O boyama tarafından. C) chondrogenic indüksiyon 3 hafta boyunca hücre Pelet histolojik olarak toluidin blue boyama ile denetlesinler. Hücreleri (proteoglikan) boyama için olumlu kondrosit benzeri hücreler olarak kabul edildi. Ölçek çubuğu 100 µm. = D) 3 hafta boyunca kültür sonra osteoblast işaretleri (Runx2), Adipojenik işaretleri (PPARγ) ve chondrogenic işaretleri (Agg) ifadesidir göreli mRNA tespit. Tüm analizler için p değerleri < 0,01 istatistiksel olarak önemli farklılıklar Kruskal-Wallis testi kullanılarak kabul edildi (olarak gösterilen **). Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Genler Astar (5'-3') ileri Astar (5'-3') ters
Runx2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
AGG GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARγ2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

Tablo 1: Listesi genler ve nicel gerçek zamanlı PCR Bu çalışmada kullanılan astar.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

MSCs vâr synovial sıvı hücre tabanlı terapi için bir alternatif sağlar. Önceki çalışmalar yaralanma siteleri mezenkimal kök hücre olumlu sonrası yaralanma dönem5ile ilişkili onların synovial sıvı daha yüksek miktarda içerir göstermiştir. MSCs synovial sıvı doku sonra bir yaralanma18,19spontan iyileşme arttırmak için yararlı olabilir. Esas olarak tanımlanmamış20SF-MSCs eklemlerde mekanizmaları kaldıkları için SF-MSCs klinik uygulama nadiren literatürde karşılanmıştır. Jones ve ark. 21 bildirdi hSF-MSC numaraları diz eklemleri içinde önemli ölçüde 7-fold artırmak Osteoartrit (OA) erken aşamalarında. Artan SF MSCs eklemlerin fizyolojik homeostazı korumak açısından katkıda bulunabileceğini düşündüler.

İdeal bir hayvan modeli rejeneratif ve çevirim ilaç kullanan therapeutics gelişmesinde vazgeçilmez bir araçtır. Geniş ölçüde bariz farklılıklar mevcut olmasına rağmen insanlar ve tavşan, tavşan doku rejenerasyonu7böylece bize SF-MSCs bizim çalışma için model olarak seçmenizi isteyen, incelenmesi için hayvan bir model olarak kullanılır. Bu çaba içinde daha zor engelleri SF-MSCs izolasyonu kez çeşitli başarı oranları ve düşük koloni frekanslar, sonuç olarak önceki araştırma5' te rapor biridir. Bu nedenle, çok sayıda araştırmacı başarı oranları ve MSCs SF dan yalıtım duruma getirilmesi üzerine yoğunlaşmıştır.

Bu studyeffectively bir MAC'ler yordam sıralama saf ve canlılığı CD90 için kullanılan+ MACSs tavşan synovial sıvı22. Bu MAC'ler Sistem Manyetik lastikteki bir belirli hücre yüzey antijeni için CD90 bu durumda birleştiğinde çok özel antikorlar Birleşik kullanır ve belirli hedef hücre tipi, yani CD90 ifade hücreleri seçim için izin verir. CD90 lastikteki ile arıtmadan önce genellikle 14 gün boyunca birincil rbSF MSCs kültür. Bu dönemde, kültür yemekleri birçok koloniler meydana gelir. Bu iletişim kuralı 2 mm'den daha büyük koloniler çapı seçerek öneriyor. Klonlama silindir koloni seçimi için kullanırken, biz dikkatle gözlemlemek bu mikroskop altında. Koloni arıtma için daha fazla yayılır.

Etiketlenmemiş hücreleri akışı ise ayırma ve saflaştırma işlemi sırasında manyetik olarak etiketli CD90 ifade hücreleri manyetik alan ayırıcı sütununda, çekilen. Yıkama işleminden sonra sütun ayırıcı manyetik alanından kaldırılır ve hedef hücre sütun eluted. Bu belirli MAC'ler microbead yaklaşım özellikle bu izole hücreleri hematopoetik hücrelerin23yerine mezenkimal kök hücre olduğunu gösteren kök hücre yüzey işaretleyicileri CD44 ve CD105, ifade rbSF MSCs yalıtım sağlar. Bu saf rbSF MSCs kültürlü vitro morfolojik özellikleri ve marker ifade herhangi bir önemli değişiklik olmaksızın uzun bir zaman içinde olabilir. Ayrıca, MAC'ler tarafından zenginleştirilmiş rbSF MSCs multipotent ayırt etme yeteneği chondrogenic, Adipojenik ve osteojenik hücreleri dahil olmak üzere çoklu soy hücreye sergi.

MAC'ler işlemi gerçekleştirmek kolay bir protokoldür ve tezgah23tarihinde yapılabilir. Ayrıca, ABD Gıda ve İlaç Dairesi (FDA) microbead-esaslı MACS teknoloji onaylanmış ve böylece klinik uygulamaları24için yapmak kolaydır. CD90 mezenkimal kök hücrelerin yüzey bir belirtecidir ve araştırmacılar CD90 olumlu MSCs bir daha iyi chondrogenic ayırt etme yeteneği25,26olduğunu ortaya koymuştur. MSCs pluripotency Morfoloji ve kök hücre27için belirli işaretleri ifade dayalı karakterize.

Bu çalışmada çeşitli kısıtlamalar bulunmaktadır. Bu protokolün ilk eksiklik biz incelendiğinde yüzey işaretleyicileri ilgilidir. Bir deyim üzerinde uluslararası toplum tarafından hücresel terapisi (ISCT) göre multipotent MSCs tanımlamak için en az bir ölçüt CD90, CD105, CD44 ve CD73 için pozitif ve negatif CD11b, CD14, CD34 veya CD45 ve CD79a veya HLA-DR28. Güç ve tüm panel test etmek için gerekli harcama azaltıcı amacı ile bu çalışmada araştırmacılar özenle seçilmiş iki negatif işaretleri ve iki önerilen olumlu işaretleri. İkinci olarak, daha fazla çalışma için seçilecektir koloniler oluştururlar uzun sürüyor. Buna ek olarak, hipertrofisi SF-MSCs vitrochondrogenic indüksiyon sırasında büyük bir sorun var. Sonraki aşamada, hipertrofik kondrosit her zaman hızlı tür X kollajen (COLX), matriks metalloproteinaz 13 (MMP13) 2 (Runx2)29alkalen fosfataz (ALP) ve cüce ile ilgili transkripsiyon faktörü. Araştırma gösteriyor üç boyutlu (3D) Pelet kültür, dinamik kültür sistemleri ve coculture kondrosit ile MSC yararına stabil olduğunu chondrogenic farklılaşma30,31. Bu çalışmada, Pelet kültür sistemi hipertrofisi önlemek için MSC chondrogenic indüksiyon için kullanıldı.

Sonuç olarak, yalıtım ve MSCs arıtma eklem boşluğuna reçeteye göre sarf sıvı üzerinden için basit bir yöntem kurulan ve orada elde MSCs ile karakterizedir. Bu iletişim kuralı bir platform keşif ve artiküler synovial sıvı kaynaklı MSCs potansiyel yarar roman ortak rejenerasyon stratejileri içinde incelenmesi için sağlamıştır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar onlar rakip hiçbir mali çıkarları var bildirin.

Acknowledgments

Bu çalışmada aşağıdaki hibe tarafından mali destek verdi: Çin doğal Bilim Vakfı (No. 81572198; No 81772394); Fon için yüksek düzey tıbbi disiplin inşaat Shenzhen Üniversitesi (No. 2016031638); Guangdong Eyaleti, Çin (No Tıbbi Araştırma Vakfı A2016314); ve Shenzhen bilim ve teknoloji projeleri (No. JCYJ20170306092215436; No JCYJ20170412150609690; No JCYJ20170413161800287; No SGLH20161209105517753; No JCYJ20160301111338144).

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics