Iniezioni di Lipopolysaccharide in topi per simulare l'ingresso di prodotti microbici derivati dopo la violazione della barriera intestinale

Immunology and Infection
 

ERRATUM NOTICE

Summary

Qui è presentato un protocollo per simulare l'ingresso di composti derivati batterici dopo la violazione della barriera intestinale. Una bassa dose subletale di lipopolisaccaride è stata iniettata sistemica in topi, che sono stati monitorati per 24 h post-iniezione. L'espressione delle citochine pro-infiammatorie è stata determinata a parecchi punti di tempo nella milza, nel fegato e del colon.

Cite this Article

Copy Citation | Download Citations

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La barriera epiteliale intestinale separa l'host dal microbiota che è normalmente tollerato o ignorato. La violazione di questo ostacolo provoca l'ingresso di batteri o di prodotti derivati da batteri nell'ospite, l'accesso alla circolazione di host e gli organi interni che conducono all'infiammazione incontrollata come osservato nei pazienti con malattia infiammatoria intestinale (IBD), che sono caratterizzati da una maggiore permeabilità epiteliale intestinale.

Per simulare l'ingresso di composti derivati batterici nell'ospite, un modello di endotoxemia è stato adottato in quali lipopolisaccaride (LPS), un componente della parete cellulare esterna dei batteri gram-negativi, sono state iniettate in topi. In questo studio, una dose subletale di LPS è stata iniettata intraperitonealmente ed i topi sono stati successivamente controllati per 8 h, utilizzando un punteggio di malattia. Inoltre, l'espressione i livelli delle citochine infiammatorie Il6, Il1b e Tnfa sono stati analizzati nella milza, fegato e colon di qPCR in diversi momenti dopo l'iniezione di LPS. Questo modello potrebbe essere utile per gli studi che coinvolgono la ricerca della risposta immunitaria dopo l'invasione di microrganismi o di prodotti derivati dal batterico causati da una violazione di barriera delle superfici del corpo.

Introduction

L'intestino umano è colonizzato con un grande consorzio di microrganismi che forma il microbiota, che ha sviluppato un rapporto di reciproco beneficio con l'host durante l'evoluzione. In questo rapporto, l'host fornisce una nicchia sicura per il microbiota, considerando che il microbiota fornisce vitamine, digestione dei nutrienti e protezione dagli agenti patogeni per l'host, dove il microbiota si trova1. Quando questo rapporto vantaggioso tra l'host e il microbiota è disturbato, possono sviluppare malattie, come la malattia infiammatoria intestinale (IBD). IBD è una malattia infiammatoria cronica multifattoriale dell'intestino causata da fattori genetici e ambientali che si presentano in due forme principali, (CD) la malattia di Crohn e colite ulcerosa (UC). Nonostante le similitudini tra le due forme IBD, sono caratterizzati da alcune differenze nella posizione e nella natura delle modificazioni infiammatorie. CD è un disordine infiammatorio di ricaduta transmurale che potenzialmente possa estendere a qualsiasi parte del tratto gastrointestinale, mentre UC è non transmurale ed è limitato ai due punti. Inoltre, mutazioni in proteine Nucleotide-binding dominio contenenti oligomerizzazione 2 (NOD2), un recettore di riconoscimento di pattern (PRR) che riconosce muramil dipeptide (MDP), un componente della parete cellulare dei batteri Gram-positivi più e - negativi, è associata al CD2. Inoltre, Escherichia coli (Escherichia coli), Listeria e streptococchi e i loro prodotti sono stati tutti trovati all'interno dei macrofagi nei pazienti del CD che sono entrati nell'host dopo una barriera violazione3. Quando i batteri o loro prodotti immettono l'host durante lo sviluppo del CD, il sistema immunitario sviluppa una risposta che porta alla produzione di anticorpi anti-batterica4di circolazione. Forse, la prova più convincente per il ruolo del microbiota nella patogenesi delle IBD deriva da modelli murini. Quando gli animali sono trattati con antibiotici, o topi siano tenuti in germe-free (GF), la gravità della malattia è ridotta nella maggior parte dei modelli di colite, come in IL-10-/-topi che non sviluppano colite in GF strutture5,6. Inoltre, colite disturba anche la composizione del microbiota, che è caratterizzata da una composizione squilibrata e ridotto ricchezza chiamato disbiosi7. La conseguenza di IBD può essere un aumento della permeabilità intestinale che può portare all'ingresso di microbi e di prodotti derivati dal microbica nell'ospite.

Negli animali, l'applicazione di Destrano solfato di sodio (DSS) induce una violazione epiteliale intestinale che conduce a un aumento della permeabilità della barriera epiteliale8. Portale LPS le concentrazioni sono elevate in animali con DSS colite9. Interessante, gli animali carenti C tipo lectina recettore adesione intracellulare specifica molecola-3 afferrando nonintegrin 1 omologo-correlate (segno-R1) sono protetti da colite DSS e LPS indotta endotossiemia10. Per diffondere ulteriormente nell'ospite, batteri o batteri derivati prodotti devono superare la barriera vascolare11, cavità peritoneale, in cui si trova il piccolo e grande intestino, linfonodi mesenterici e/o il fegato12. Per ridurre la complessità di questo sistema, è stato usato un composto derivato batterico definito. LPS, che provoca endotossiemia dopo intraperitoneale (i.p.) o endovenosa (i.v.) iniezione13 è stato iniettato in topi, per studiare l'espressione delle interleuchine Il6 e Ilb e la citochina Tnfa in risposta ai LPS.

LPS è un pattern molecolare associati (PAMP) espresso come un componente della parete cellulare dei batteri gram-negativi, che consiste del lipide A (i PAMP principale nella struttura di LPS), un oligosaccaride di core e un O lato catena14. Recettore Toll-like 4 (TLR4) espresse da cellule dendritiche, macrofagi e cellule epiteliali riconosce LPS15, che richiede Co-recettori per associazione appropriata. La fase acuta LPS-proteina (LBP) si lega LPS per formare un complesso che trasferisce LPS al cluster di differenziazione 14 (CD14), una proteina di membrana ancorate glicosilfosfatidilinositolo. CD14 ulteriormente navette LPS per l'antigene del linfocita 96 o anche conosciuto come MD-2, che è associato con il dominio extracellulare di TLR4. L'associazione del LPS a MD-2 facilita la dimerizzazione di TLR4/MD-2 per indurre cambiamenti conformazionali di reclutare molecole intracellulari adattatore per attivare l'a valle segnalazione sentiero14, che comprende il primario di differenziazione mieloide gene di risposta 88 (MyD88) - via del dipendente e il TIR dominio contenenti adattatore-induzione dell'interferone-β (TRIF) - via dipendente16. Il riconoscimento dei LPS di TLR4 quindi attiva il pathway di NF-κB e induce l'espressione di citochine proinfiammatorie, come TNFα, IL-6 e IL-1 β17.

In particolare, quando LPS è iniettato in animali, la concentrazione di LPS dato agli animali, il background genetico dell'animale e la dieta deve essere considerato. Alte concentrazioni di LPS conduce ad uno shock settico, caratterizzato da ipotensione e guasti multipli dell'organo e infine a morte18. I topi sono meno sensibili ai LPS rispetto agli esseri umani, dove le concentrazioni di LPS tra 2-4 ng/kg di peso corporeo (BW) sono in grado di indurre una tempesta di citochina19. Per topi, la dose letale (LD50), che induce la morte in metà dei campi di topi da 10-25 mg/kg BW20 a seconda del ceppo del mouse utilizzato. Per i ceppi comunemente usati del mouse, C57Bl/6 e BALB/c, la dose letale 50% (LD50) è di 10 mg/kg di peso corporeo. Al contrario, i ceppi C3H/HeJ e C57BL/10ScCr sono protetti da LPS indotto endotossiemia, che è dovuta a mutazioni di Tlr421. Di conseguenza, topi carenti di Tlr4 sono iporeattivo per iniezioni con LPS22. Altre linee di topi geneticamente modificati per, ad esempio topi PARP1-/-23 sono resistenti a scossa tossica indotta da LPS.

Il modello del mouse descritto qui utilizza una dose subletale di LPS somministrato per via sistemica per simulare le conseguenze della diffusione di LPS dopo la violazione della barriera delle superfici del corpo. La concentrazione di LPS selezionata (2 mg/kg BW) non ha indotto mortalità in topi C56Bl/6, ma il rilascio indotto delle citochine pro-infiammatorie.

Protocol

Topi sono stati allevati e tenuti sotto specifiche condizioni (SPF) esenti da patogeni che nella struttura animale del dipartimento di biomedicina, Università di Basilea (Basilea, Svizzera). Tutti gli esperimenti del mouse sono stati effettuati conformemente alle prescrizioni cantonali (numero di protocollo animale 2816 [Cantone di Basilea-città]) e federale svizzero.

1. preparazione della soluzione di LPS

  1. Aprire lo stock di LPS purificato da Escherichia coli 0111:B4 in condizioni sterili e ricostituirlo in acqua alla concentrazione di 5 mg/mL.
  2. Diluire lo stock di LPS con la soluzione fisiologica sterile tamponata (PBS) alla concentrazione di lavoro di 0,2 µ g / µ l.

2. intraperitoneale di LPS ai topi

  1. Aspirare il LPS soluzione di lavoro in una siringa da 0,5 mL con ago 30 G in un flusso d'aria laminare.
  2. Pesare i topi femminili C57Bl/6 (6-10 settimane di età) e calcolare la quantità di LPS che verrà iniettato: peso corporeo di 10 µ l (2 µ g) / g.
    Nota: ad esempio, se un mouse pesa 20 g, quindi µ l 20g x 10 = 200 µ l LPS soluzione deve essere iniettato per di lavoro.
  3. Gestire il mouse delicatamente ma con fermezza e trattenere l'animale in una mano. Assicurarsi che l'animale è in grado di respirare normalmente, ma non per girare e girare durante il sistema di ritenuta.
  4. Inclinazione del mouse naso leggermente verso terra per esporre l'addome per iniezione. Individuare la linea mediana dell'addome e il luogo di iniezione nella parte bassa dell'addome verso sinistra o destra dalla linea mediana. Iniettare PBS i.p. anziché LPS in topi di controllo.
  5. Con la mano libera, iniettare il volume appropriato (il volume calcolato al passaggio 2.2) dei LPS soluzione di lavoro. Assicurarsi che l'ago è entrato nella cavità peritoneale come altrimenti, mis-iniezioni nello strato del muscolo addominale possono verificarsi. Ancora, non andare troppo in profondità con l'ago nella cavità peritoneale per evitare di ferire gli organi interni che trovano in quella zona.
  6. Restituire l'animale con attenzione alla gabbia con fino a 5 topi per gabbia.

3. monitorare i topi

  1. Monitorare gli animali al momento dell'iniezione e ogni 2 h dopo l'iniezione per 8 h per l'avvenimento e la severità di endotossiemia. Pertanto, utilizzare un foglio di Punteggio (tabella 1) che è stato adattato da un manoscritto precedentemente pubblicati 24.
  2. Segnare i topi iniettati LPS per i seguenti parametri elencati nella tabella 1
    1. Controllare l'aspetto della pelliccia che è normalmente liscia. Se il pelo appare pelo arruffato, appuntito o gonfio che indica il disagio e/o dolore, Punteggio loro come 1, 2 o 3.
    2. Controllare l'attività del mouse.
      Nota: Topi normalmente muovono liberamente intorno alla gabbia tutta mangiare, bere, arrampicata, ma soppressa o limitata attività potrebbe essere un segno di dolore.
    3. Controllare il livello di coscienza.
      Nota: I topi sono molto curiosi, e normalmente si muovono intorno alla gabbia indagando la zona circostante. Mancanza o ridotto movimento suggerire dolore e disagio.
    4. Controllare gli occhi.
      Nota: Gli occhi completamente aperti sono attesi in topi sani, ma gli occhi parzialmente o completamente chiusi, possibilmente con secrezione, possono essere un'indicazione di dolore.
    5. Controllare il tasso di respirazione.
      Nota: Topi sani hanno solitamente un tasso di respirazione normale e rapido, un tasso di respirazione ridotta potrebbe essere un'indicazione di disagio).
    6. Controllare la qualità della respirazione.
      Nota: Respiro affannoso con o senza affaticare il è un segno di dolore.

4. tessuto campionamento per acido ribonucleico (RNA) estrazione e omogeneizzazione

  1. Preparare le provette di raccolta/omogeneizzazione: aggiungere 1 mL Reagente di isolamento di RNA di passo singolo per provette 2 mL preriempita con sfere in ceramica 1,4 mm.
  2. Presso i punti di tempo appropriato (prima (0h) e 2h, 4h e 8h dopo iniezione dei LPS) eutanasia il mouse con la dose eccessiva di anestetico (isoflurano) seguito da dissanguamento e procedere con la dissezione.
  3. Tagliare la pelle e lo strato di muscolo esponendo la cavità addominale con organi interni con un paio di forbici.
  4. Accuratamente sezionare la milza, fegato e colon, pulire gli organi da grasso e tenerli in PBS sul ghiaccio.
  5. Tagliare un piccolo pezzo (circa 0,5 cm di lunghezza) da ogni organo utilizzando forbici o bisturi.
    Nota: È importante prendere sempre il pezzo da approssimativamente la stessa parte dell'organo in ogni mouse (stesso lobo del fegato, prossimale o distale parte del colon).
  6. Poco asciugare il tessuto su un pezzo di carta velina e inserirlo nel tubo di raccolta/omogeneizzazione assicurandosi che è completamente immerso nel reattivo di isolamento del RNA.
  7. Omogeneizzare il tessuto in un omogeneizzatore benchtop ad alta velocità. Per tessuti molli come milza, fegato e colon USA 1 ciclo di omogeneizzazione a velocità 6.00 per 30 s.
  8. Incubare i campioni per 5 min a temperatura ambiente.
  9. Posizionare con attenzione il tubo nell'azoto liquido per congelare a scatto il tessuto lisato. Memorizzare lo snap congelato lisato a-80 ° C fino all'isolamento di RNA.

5. RNA estrazione dal tessuto

Nota: I reagenti di isolamento del RNA, cloroformio ed alcoli sono considerati come materiale pericoloso. Eseguire l'estrazione di RNA sotto una cappa chimica. Utilizzare certificati RNAsi-libera reagenti ed apparecchiature per mantenere un ambiente RNAsi-libera.

  1. Separazione di fase
    1. Scongelare il lisato di tessuto congelato sul ghiaccio.
    2. Centrifugare il campione su 1.000 x g per 5 min a 4 ° C per appallottolare le rimanenti particelle di tessuto che potrebbero essere lasciate.
    3. Trasferire il surnatante in una provetta di nucleasi-free 1,5 mL nuovo.
    4. Aggiungere 200 cloroformio ghiacciata µ l per isolamento di RNA da 1 mL Reagente e agitare vigorosamente per 10-15 s.
    5. Incubare per 2-3 min a temperatura ambiente.
    6. Centrifugare a 12, 000 x g per 15 min a 4 ° C.
      Nota: Il campione ora conterrà 3 fasi: abbassare la fase di rosso fenolo-cloroformio, l'interfase e la fase acquosa incolore superiore. il RNA è presente nella fase acquosa superiore.
    7. Raccogliere la fase acquosa superiore (50% del volume totale) e il trasferimento in un nuovo tubo privo di nucleasi 1,5 mL.
  2. Precipitazione di RNA
    1. Aggiungere 0,5 mL isopropanolo ghiacciata per reagente di isolamento del RNA 1 mL e mescolare delicatamente capovolgendo la provetta 5 - 6 volte.
    2. Incubare per 10-15 min a temperatura ambiente.
    3. Centrifugare a 12.000 x g per 10 min a 4 ° C.
      Nota: La pallina del RNA deve essere visibile in questa fase.
  3. Lavaggio della pallina del RNA
    1. Rimuovere completamente il supernatante contenente l'isopropanolo senza disturbare il pellet.
    2. Lavare la pallina con 1 mL di etanolo al 75% ghiacciata per 1 mL Reagente di isolamento del RNA utilizzato per la lisi iniziale.
    3. Vortexare il campione brevemente.
    4. Centrifugare il campione a 7.500 (o 12.000) x g per 5 min a 4 ° C.
  4. RNA di dissoluzione
    1. Rimuovere completamente l'etanolo nel surnatante senza disturbare il pellet.
    2. Lasciare il tubo aperto sotto la cappa chimica per 3-5 min asciugare il pellet di RNA a temperatura ambiente (non asciugare troppo come in questo caso sarà difficile da sciogliere RNA).
    3. Dissolva la pallina del RNA in acqua priva di nucleasi di 20-50 µ l pipettando attentamente su e giù.
    4. Incubare il campione a 55 ° C per 10-15 min migliorare ulteriormente la soluzione del RNA.
      Nota: In questa fase, RNA può essere conservato a-80 ° C fino a ulteriori analisi.

6. la digestione del DNA rimanente

  1. Misurare la concentrazione di RNA con uno spettrofotometro pipettando lo spettrofotometro un'aliquota (2 µ l) e regolare la concentrazione consigliata.
  2. Avviare la digestione di contaminazione del DNA con max. 10 µ g RNA in acqua priva di nucleasi di 50 µ l.
  3. Aggiungere volume 0.1 di 10x dnasi Buffer e 1 µ l rDNase io per esempio e mescolare dolcemente pipettando su e giù.
  4. Incubare a 37 ° C per 20-30 min.
  5. Vortice della dnasi inattivazione reagente e aggiungere volume 0.1 al campione mescolando bene con la pipetta.
  6. Incubare per 5 min a temperatura ambiente mescolando occasionalmente a mano.
  7. Centrifugare a 10.000 x g per 1,5 min.
  8. Trasferire il surnatante contenente RNA DNA-free nel nuovo tubo privo di nucleasi.
  9. Misurare la concentrazione di RNA e la qualità mediante lo spettrofotometro.

7. trascrizione inversa

  1. Utilizzare un kit di trascrizione inversa (RT) del cDNA acido deossiribonucleico commercialmente disponibili per trascrizione inversa.
    Nota: Qui, fino a 2 µ g di RNA può essere invertito trascritto.
  2. Calcolare il volume, che contiene 2 µ g di RNA. Pipettare 2 µ g di RNA in una nuova provetta PCR.
  3. Aggiungere acqua priva di nucleasi al campione nella provetta PCR al volume finale di 10 µ l.
  4. Preparare 2 x Master Mix mescolando i seguenti componenti elencati nella tabella 2
  5. Aggiungere 10 µ l 2 x Master Mix a 10 µ l RNA ottenere 1 x Master Mix nel volume totale di 20 µ l.
  6. Chiudere il tubo di reazione a catena (PCR) polimerasi e centrifugare il campione brevemente.
  7. Posizionare i campioni in un termociclatore PCR e impostare le impostazioni elencate nella tabella 3.
  8. Memorizzare il cDNA generato a-20 ° C per ulteriori analisi.

8. quantitative PCR (qPCR)

  1. Eseguire la reazione di qPCR con un kit disponibile in commercio.
  2. Self-progettare e testare gli iniettori introne-spanning, prima dell'uso, con differenti concentrazioni di cDNA di modello. Analizzare l'efficacia del primer creando una curva standard e utilizzare il primer con elevata efficacia e la corrette fusione curve.
    Nota: Le sequenze dei primer utilizzati in questo esperimento sono elencate nella tabella 2.
  3. Preparare la reazione (qPCR) reazione a catena della polimerasi quantitativa nella piastra 384 pozzetti con l'installazione di reazione designata nella tabella 4.
  4. Tenere tutte le soluzioni e la piastra sul ghiaccio con foglio di alluminio per evitare che la piastra di bagnarsi quando la miscela di reazione è preparata.
  5. Eseguire tutte le reazioni in triplici copie.
  6. Eseguire la reazione di PCR su un termociclatore usando l'impostazione riportata nella tabella 5.
  7. Calcolare il valore medio di Ct per tutte le reazioni dalle triplici copie. Normalizzare tutti i geni bersaglio per il livello di espressione di glycerinealdehyde-3-fosfato-deidrogenasi (Gapdh) gene housekeeping calcolando 2^(-ΔCt).
    Nota: Tutti i geni bersaglio con il Ct medio > 35 sono stati considerati sotto il limite di rilevazione.

Representative Results

Per simulare le conseguenze per l'host dopo l'ingresso di batteri o di prodotti derivati batterici che si verifica dopo la violazione della barriera intestinale, LPS è stato iniettato in topi C57Bl/6 in una dose subletale (2 µ g/g del peso corporeo). Ogni singolo mouse è stato monitorato e segnato con l'avvenimento di endotossiemia con parametri elencati nella scheda dei punteggi che include, l'aspetto dei topi, l'attività degli animali, la condizione degli occhi e il tasso di respirazione e qualità (tabella 1) . Gli animali hanno mostrato segni clinici di malattia che ha alzato da 6 a 10 h dopo l'iniezione di LPS e recuperato entro 24 h (Figura 1). Individuali topi sono stati sacrificati in 2h, 4h e 8h dopo l'iniezione dei LPS. Pezzi di tessuto sono stati raccolti da milza, fegato e colon. RNA è stato isolato da questi organi e inverso trascritto a cDNA. Il cDNA è stato utilizzato come modello per qPCR per determinare i livelli di espressione di Il6 (Figura 2A) Il1b (Figura 2B), TNFa (Figura 2) e Il10 (Figura 2D) con primer usati per la qPCR elencati nella tabella 6. L'espressione di Il6 ha raggiunto la posizione 2 h dopo l'iniezione in milza e colon e 4 h dopo l'iniezione nel fegato. L'espressione di Il1b, TNFa e Il10 ha raggiunto la posizione 4 h dopo l'iniezione nella milza, nel fegato e del colon. Entro 8 h dopo l'iniezione, l'espressione di Il1b, Il6, TNFa e Il10 tornati ai livelli basali.

Figure 1
Figura 1: iniezione dei LPS (peso corporeo di 2 µ g/g) indotto da segni clinici di endotossiemia in C57Bl/6mice. Dopo iniezione di 2 µ g/g peso di LPS, topi individuali sono stati controllati con il Punteggio di malattia presentato nella tabella 1 che include l'aspetto e l'attività degli animali, apertura degli occhi e loro tasso respiratorio e qualità ogni 2 h per 12h e 24h a poppa er iniezione dei LPS. Il Punteggio di malattia (asse y) è stato cancellato l'ora rispettiva (asse x). Media ± SD per topi di 4-5 per ogni punto di tempo è presentato. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: iniezione dei LPS (peso corporeo di 2 µ g/g) induce l'espressione delle citochine pro-infiammatorie in topi C57Bl/6. I topi sono stati iniettati con peso corporeo di 2 µ g/g di LPS e livelli di espressione di Il6 (A), (B)di Il1b , Tnfa (C) e Il10 (D) sono stati analizzati da qPCR in milza, fegato e colon al tempo indicato punti dopo l'iniezione. Tutti i livelli di espressione di citochina sono stati normalizzati all'espressione di Gapdh. Media ± SD per topi di 4-5 per ogni punto di tempo è indicato. Clicca qui per visualizzare una versione più grande di questa figura.

Tabella 1: foglio di Punteggio di malattia per monitorare i topi C57Bl/6 dopo iniezione dei LPS. Parametri che vengono monitorati dopo iniezione dei LPS. Gli animali sono stati controllati ogni 2 h dopo l'iniezione per un periodo di 12 h, e punteggi sono stati dati per ogni singolo parametro elencato nella tabella. Il Punteggio finale per ogni animale rappresenta la somma di tutti i punteggi individuali. Questo è adattato da riferimento24. Per favore clicca qui per scaricare questo file.

Importo Reagente
2 µ l di campione 10 x RT Buffer
0,8 µ l di campione 25 x deossinucleotidi (dNTP) Mix (100 mM)
1 µ l di campione Primer casuale RT
4.2 µ l di campione acqua priva di nucleasi

Tabella 2: I reagenti utilizzati per preparare il mix master per trascrizione inversa.

Temperatura Tempo
25 ° C 10 min
37 ° C 120 min
37 ° C 5 min
4 ° C tenere premuto

Tabella 3: Thermocycler impostazioni utilizzate per trascrizione inversa.

Importo Reagente
5 µ l/pozzetto 2 x Master Mix
0,05 µ l/pozzetto Tintura di riferimento
500 nM finale/pozzetto Forward primer
500 nM finale/pozzetto Reverse primer
tra 10 e 100 ng/pozzetto, abbiamo usato 40 ng/pozzetto modello cDNA diluito in un tampone di diluizione di modello (diluizione 1/100 di questo buffer è stato fatto in acqua priva di nucleasi e usato per diluire il cDNA di modello). Diluendo il modello in questo Buffer permette la visualizzazione dei pozzi dove modello viene aggiunto come i cambiamenti di colore di reazione dal blu al verde
acqua priva di nucleasi a volume finale di 10 µ l/pozzetto acqua priva di nucleasi

Tabella 4: Descrizione della reazione PCR.

Temperatura Tempo
95 ° C 2 min
95 ° C 5 s 40 cicli
60 ° C 20 s
95 ° C 15 s analaysis curva di fusione
60 ° C 1 min
95 ° C 15 s

Tabella 5: Thermocycler impostazioni utilizzate per la PCR.

Primer Sequenza Temperatura di fusione Lunghezza del prodotto
Il6-F TCG GAG GCT TAA TTA CAC ATG TTC T 60,3 94 bp
Il6-R GCATCATCGTTGTTCATACAATCA 58,2
Il1b-F TGTGAAATGCCACCTTTTGA 56,1 94 bp
Il1b-R GTCAAAGGTTTGGAAGCAG 57,2
IL10-F ATCGATTTCTCCCCTGTGAA 56,2 108 bp
IL10-R TGTCAAATTCATTCATGGCCT 56,1
TNFa-F CCACCACGCTCTTCTGTCTAC 60,4 103 bp
TNFa-R AGGGTCTGGGCCATAGAACT 60
GAPDH-F CATCAAGAAGGTGGTGAAGC 56,7 199 bp
GAPDH-R CCTGTTGCTGTAGCCGTATT 58

Tabella 6: primer usati nella reazione qPCR. La sequenza dei primer utilizzati per qPCR per il rilevamento del mouse citochine e gene housekeeping Gapdh.

Discussion

Questo protocollo imita i processi immunologici che si verificano dopo l'invasione di prodotti microbici derivati. Fasi critiche all'interno del protocollo sono la selezione della riga del mouse, lo stato di igiene dei topi, la dose di LPS, il monitoraggio degli animali per l'avvenimento di endotossiemia e il punto di tempo dell'esperimento terminazione. La cosa più importante, il background genetico del ceppo del mouse deve essere considerato. Del mouse differenti ceppi hanno diversa suscettibilità ai LPS. Ad esempio, i topi C57BL/10ScCr sono resistenti a LPS e C3H/HeJ indussero endotossiemia21,25. Inoltre, lo stato di igiene degli animali può influenzare il corso di endotossiemia in LPS. Esenti da patogeni specifici (SPF) animali sono più comunemente utilizzati. Questi topi sono liberi da un elenco definito di agenti patogeni, ma la composizione del microbiota completa di questi animali non è noto il26,27. Sterili privo di germi o axeniche animali (che non porto un microbiota) sono distinti dai topi di SPF26. Probabilmente, la colonizzazione degli animali axeniche con un microrganismo o con un consorzio di microrganismi (animali gnotobiotici) può influenzare l'espressione dei geni, quali IL-19, dopo iniezione dei LPS rispetto a SPF animali8. Inoltre, un foglio di punteggio è stato suggerito che è stato utilizzato come un foglio di punteggio per un modello di sepsi indotta iniettando la soluzione fecale nella cavità peritoneale24. Questo sheetcan essere discusso con il comitato locale benessere degli animali e possono essere adattate alle esigenze locali. In particolare, i criteri per la terminazione deve essere discusso con il comitato locale benessere degli animali. Questo esperimento ha dovuto essere interrotta quando viene raggiunto un punteggio > 12 o quando viene raggiunto il punteggio massimo per un singolo parametro. In questo esperimento, nessun animale fuori otto animali ha superato una ventina di malattia di 12 dopo l'iniezione dei LPS (peso corporeo di 2 µ g/g). In questo studio, vengono presentati risultati mostrano l'espressione delle citochine Il6, Il1b, TNFa e Il10 nel fegato, milza e colon dopo iniezione dei LPS. L'espressione di Il1b, TNFa e Il10 ha raggiunto la posizione 4 h dopo l'iniezione di LPS in milza, fegato e colon, considerando che, espressione di Il6 ha raggiunto la posizione 2 h dopo l'iniezione di LPS in milza e colon e 4 h dopo l'iniezione di LPS nel fegato. Entro 8 h l'espressione Il6, Il1b, TNFa e Il10 tornati ai livelli basali in milza, fegato e colon. La gravità della malattia raggiunse l'apice tra 6 e 10 h dopo l'iniezione di LPS quando l'espressione di Il1b, Il6, TNFa e Il10 sono già tornati ai livelli della linea di base che indica che ha aumentato l'espressione di Il6, Il1b, TNFa e Il10 avviene rapidamente dopo l'iniezione di LPS, ma che la cinetica di altri geni può mostrare un modello diverso dopo iniezione dei LPS. L'espressione di queste citochine potrebbe anche essere analizzato il livello della proteina nel sangue degli animali da ELISA, che può essere considerata oltre qPCR.

Le modifiche e la risoluzione dei problemi della tecnica sono necessari nei casi quando viene raggiunto un punteggio di malattia > 12. Pertanto, la dose di LPS deve essere ridotto e meglio regolata per la linea di mouse utilizzato e delle condizioni locali per evitare la cessazione anticipata dell'esperimento. La manipolazione dei geni eliminando una determinata regione genomica o che overexpressing un gene può influenzare la suscettibilità dei topi ai LPS. In esperimenti preliminari, la dose di LPS può essere elevata alla dose appropriata per evitare danni inutili e morte per gli animali in questo esperimento. Della nota, contaminazione dei LPS con altri prodotti di origine batterica e mis-iniezioni devono essere evitate. Inoltre, la cinetica dell'espressione di geni di interesse dopo iniezione dei LPS deve essere determinata.

Sono limiti che questa tecnica fornisce informazioni sulle conseguenze della diffusione di prodotti microbici nell'ospite dopo una violazione della barriera intestinale ma non darà informazioni sugli eventi che portano alla violazione di barriera intestinale e a cause quel grilletto IBD. Naturalmente, questo modello non è un modello di colite come il modello di colite DSS, ma può essere utile oltre ai modelli di colite per studiare la conseguenza dell'ingresso di prodotti microbici nell'ospite. Inoltre, l'iniezione i.p. di LPS altererà la cavità peritoneale, in cui si trovano i piccoli e grandi intestini. Questo può facilitare la traslocazione di prodotti batterici intestinali derivata dalla cavità peritoneale nell'ospite.

Il significato di questo modello è il fatto che utilizza un PAMP definiti. In altri modelli, tra cui l'iniezione i.p. di batteri intero, l'iniezione i.p. di soluzioni fecale24 o i modelli di peritonite settica, in cui peritonite è indotta da cecal legatura e puntura28, una vasta gamma di microbi o loro prodotti induce la malattia. Inoltre, iniezione dei LPS in topi è un approccio semplice e non richiede intervento chirurgico come in peritonite settica indotto dalla puntura e legatura cecal.

Ulteriore applicazione di questo modello sono gli studi che mirano a indagare endotossiemia o setticemia LPS indotta in qualsiasi contesto caratterizzato dallo spostamento di prodotti derivati da batteri nell'ospite, come violazione della barriera cutanea o violato della tratto urogenitale. In conclusione, questo è un modello semplice che può essere utilizzato in ogni ambiente di laboratorio. A seconda delle condizioni locali, potrebbero esserci adattamenti per le necessarie esigenze locali. In particolare, scheda dei punteggi deve essere discusso con le autorità locali prima di eseguita l'esperimento. Questo metodo è stato usato per simulare le conseguenze per l'host quando batteri o prodotti derivati batterici immettere l'host dopo che si sia verificata una violazione di barriera. Questo può essere in particolare rilevanti in studi che esaminano la base delle IBD in cui la presenza di una violazione di barriera intestinale è un evento comune nella patologia della malattia.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

JHN è supportata dalla Fondazione nazionale svizzero (FNS 310030_146290).

Materials

Name Company Catalog Number Comments
DreamTaq Green PCR Master Mix (2x) Thermo Fisher Scientific, Waltham, MA, USA K1081
High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA 4368813
RNase-Free DNase Set, Qiagen, Hilden, Germany 79254
LPS Escherichia coli O111:B4 Invivogen, San Diego, CA, USA. tlrl-eblps
Omnican 50 Single-use insulin syringe B. Braun Melsungen, Melsungen, Germany 9151125
Bioanalyzer 2100 Agilent Technologie, Santa Clara, USA not applicable
Centrifuge 5430 Eppendorf, Hamburg, Germany not applicable
Centrifuge Mikro 220R Hettich, Kirchlengern, Germany not applicable
Dissection tools Aesculap, Tuttlingen, Germany not applicable
Fast-Prep-24 5G Sample Preparation System M.P. Biomedicals, Santa Ana, CA, USA not applicable
NanoDrop ND-1000 NanoDrop Products, Wilmington, DE, USA not applicable
TRI Reagent Zymo Research, Irvine, CA, USA R2050-1

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Abreu, M. T., et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 123, 679-688 (2002).
  3. Liu, Y., et al. Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease. Gastroenterology. 108, 1396-1404 (1995).
  4. Schaffer, T., et al. Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans. Inflamm Bowel Dis. 13, 1339-1346 (2007).
  5. Sellon, R. K., et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 66, 5224-5231 (1998).
  6. Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. The gut microbiota in mouse models of inflammatory bowel disease. Front Cell Infect Microbiol. 4, 28 (2014).
  7. Schaubeck, M., et al. Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence. Gut. 65, 225-237 (2016).
  8. Steinert, A., et al. The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models. J Immunol. 199, 2570-2584 (2017).
  9. Gabele, E., et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH. J Hepatol. 55, 1391-1399 (2011).
  10. Saunders, S. P., et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol. 184, 2627-2637 (2010).
  11. Spadoni, I., et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science. 350, 830-834 (2015).
  12. Balmer, M. L., et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci Transl Med. 6, 237ra266 (2014).
  13. Maier, R. V., Mathison, J. C., Ulevitch, R. J. Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins. Prog Clin Biol Res. 62, 133-155 (1981).
  14. Lu, Y. C., Yeh, W. C., Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine. 42, 145-151 (2008).
  15. Deng, M., et al. Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis. J Immunol. 190, 5152-5160 (2013).
  16. Kagan, J. C., et al. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 9, 361-368 (2008).
  17. Akira, S., Uematsu, S., Takeuchi, O. Pathogen recognition and innate immunity. Cell. 124, 783-801 (2006).
  18. Cohen, J. The immunopathogenesis of sepsis. Nature. 420, 885-891 (2002).
  19. Suffredini, A. F., et al. Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration. J Immunol. 155, 5038-5045 (1995).
  20. Fink, M. P. Animal models of sepsis. Virulence. 5, 143-153 (2014).
  21. Poltorak, A., et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 282, 2085-2088 (1998).
  22. Hoshino, K., et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 162, 3749-3752 (1999).
  23. Corral, J., et al. Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models. Am J Pathol. 166, 1089-1098 (2005).
  24. Shrum, B., et al. A robust scoring system to evaluate sepsis severity in an animal model. BMC Res Notes. 7, 233 (2014).
  25. Brandwein, S. L., et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol. 159, 44-52 (1997).
  26. Macpherson, A. J., McCoy, K. D. Standardised animal models of host microbial mutualism. Mucosal Immunol. 8, 476-486 (2015).
  27. Masopust, D., Sivula, C. P., Jameson, S. C. Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology. J Immunol. 199, 383-388 (2017).
  28. Wirtz, S., et al. Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27. J Exp Med. 203, 1875-1881 (2006).

Erratum

Formal Correction: Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach
Posted by JoVE Editors on 08/04/2018. Citeable Link.

An erratum was issued for: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

One of the authors' names was corrected from:

Katarina Raduolovic

to:

Katarina Radulovic

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics