Injeções de lipopolissacarídeo em camundongos para imitar a entrada de produtos de origem microbiana após a quebra da barreira Intestinal

Immunology and Infection
 

ERRATUM NOTICE

Summary

Aqui apresenta-se um protocolo para imitar a entrada de compostos derivados de bactérias após a quebra da barreira intestinal. Um baixas doses subletais de lipopolissacarídeo foi injetado sistemicamente em ratos, que foram monitorados por injeção de pós 24h. Determinou-se a expressão de citocinas pró-inflamatórias em vários pontos de tempo no cólon, fígado e baço.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A barreira epitelial intestinal separa o anfitrião da microbiota que normalmente é tolerada ou ignorada. A brecha desta barreira resulta na entrada de bactérias ou produtos derivados de bactérias no hospedeiro, acessando a circulação do hospedeiro e órgãos internos, levando à inflamação descontrolada, como observado em pacientes com doença inflamatória intestinal (IBD), que caracterizam-se por um aumento da permeabilidade epitelial intestinal.

Para simular a entrada de compostos derivados de bactérias para o host, um modelo de endotoxemia tem sido adotado em qual lipopolissacarídeo (LPS), um componente da parede celular externa de bactérias Gram-negativas, foram injetadas em ratos. Neste estudo, uma dose subletais de LPS intraperitonealmente foi injectada e os ratos foram monitorizados subsequentemente para 8 h, usando uma pontuação de doença. Além disso, a expressão de níveis das citocinas inflamatórias, Il6, Il1b e Tnfa foram analisados no baço, fígado e cólon por qPCR em pontos diferentes do tempo pós injeção de LPS. Este modelo pode ser útil para os estudos que envolvem a investigação de respostas imunes após a invasão de microorganismos ou produtos derivados de bacteriana causados por uma quebra de barreira de superfícies corporais.

Introduction

O intestino humano é colonizado com um grande consórcio de microorganismos que formam a microbiota, que desenvolveu um relacionamento mutuamente benéfico com o host durante a evolução. Nesta relação, o host fornece um nicho seguro para a microbiota, Considerando que a microbiota fornece vitaminas, digestão de nutrientes e proteção contra agentes patogénicos para o host, a microbiota reside1. Quando este relacionamento benéfico entre o host e a microbiota é perturbado, podem desenvolver doenças, tais como a doença inflamatória intestinal (IBD). IBD é uma doença inflamatória crônica multifatorial do intestino causada por fatores genéticos e ambientais que ocorrem em duas formas principais, (CD) de doença de Crohn e colite ulcerativa (UC). Apesar das semelhanças entre as duas formas de DII, caracterizam-se por certas diferenças na localização e natureza das modificações inflamatórias. CD é uma desordem inflamatória recidivante de transmural que potencialmente pode se estender a qualquer parte do tracto gastrointestinal, enquanto UC é não-transmural e é restrito para o cólon. Além disso, mutações no nucleotídeo oligomerização domínio-contendo proteína de ligação 2 (NOD2), um receptor de reconhecimento de padrão (PRR) que reconhece muramyl dipeptídeo (MDP), um componente da parede celular de bactérias gram-positivas mais - negativas, é associados ao CD2. Além disso, seus produtos, Listeria e estreptococos e Escherichia coli (e. coli)foram todos encontrados dentro de macrófagos em pacientes de CD que digitou o host depois que uma barreira romper3. Quando as bactérias ou seus produtos entram o hospedeiro durante o desenvolvimento do CD, o sistema imunológico desenvolve uma resposta levando à produção de anticorpos antibacteriano4de circulação. Talvez, a prova mais convincente para o papel da microbiota na patogênese da IBD decorre em modelos do rato. Quando os animais são tratados com antibióticos, ou quando os ratos são mantidos em condições de (GF) livre de germes, a severidade da doença é reduzida na maioria dos modelos de colite, tais como IL-10-/-ratos que não desenvolvem colite em GF instalações5,6. Além disso, a colite também perturba a composição da microbiota, que é caracterizado por uma composição desequilibrada e reduziu a riqueza chamada disbiose7. A consequência do IBD pode ser um aumento da permeabilidade intestinal que pode levar a entrada de micróbios e produtos derivados microbiana no hospedeiro.

Em animais, a aplicação de dextrano sulfato de sódio (DSS) induz uma violação epitelial intestinal, levando a um aumento da permeabilidade da barreira epitelial8. Concentrações de LPS portal são elevadas em animais com DSS colite9. Curiosamente, animais faltando o C tipo lectina receptor específico adesão intracelular molécula 3 agarrando nonintegrin relacionados ao homólogo 1 (sinal-R1) são protegidos de colite DSS e endotoxemia induzida por LPS10. Para mais divulgação no hospedeiro, bactérias ou produtos derivados de bactérias têm de passar a barreira vascular11, a cavidade peritoneal, onde se situam o intestino pequeno e grande porte, os linfonodos mesentéricos e/ou o fígado12. Para reduzir a complexidade deste sistema, utilizou-se um composto derivado de bacteriano definido. LPS, que faz com que a endotoxemia depois intraperitoneal (i.p.) ou intravenosa (i.v.) injeção13 foi injetado em ratos, para estudar a expressão das interleucinas Il6 e IIB e as citocinas Tnfa em resposta a LPS.

LPS é um patógeno associado molecular padrão (PAMP) expresso como um componente da parede celular de bactérias Gram-negativas, que consiste de lipídios A (a principal PAMP na estrutura dos LPS), um oligossacarídeo de núcleo e um O lado da cadeia14. Receptor tipo toll 4 (TLR4) expressado por células dendríticas, macrófagos e células epiteliais reconhece LPS15, que requer co-receptores para ligação apropriada. A fase aguda da proteína LPS-proteína (LBP) vincula LPS para formar um complexo que transfere LPS para o cluster de diferenciação 14 (CD14), uma proteína de membrana glicosilfostidilinosiol-ancorado. CD14 mais shuttles LPS de antígeno de linfócitos 96 ou também conhecido como MD-2, que está associada com o domínio extracelular de TLR4. A vinculação dos LPS para MD-2 facilita a dimerização do TLR4/MD-2 para induzir mudanças conformacionais moléculas intracelulares adaptador para ativar a jusante sinalização via14, que inclui a diferenciação mieloide primária de recrutar gene de resposta 88 (MyD88) - via dependente e a TIR domínio-contendo adaptador de indução interferon-β (TRIF) - dependente da via16. O reconhecimento de LPS por TLR4 então ativa da via do NF-κB e induz a expressão de cytokines proinflammatory, como TNFa, IL-6 e IL-1 β17.

Em particular, quando LPS é injetado em animais, a concentração de LPS dado aos animais, o fundo genético do animal e a dieta tem de ser considerada. Altas concentrações de LPS leva a um choque séptico, caracterizado por hipotensão e várias falhas do órgão e finalmente a morte18. Ratos são menos sensíveis à LPS em comparação com os humanos, onde as concentrações de LPS entre 2-4 ng/kg de peso corporal (BW) são capazes de induzir uma tempestade de citocinas19. Para os ratos, a dose letal (DL50), que induz a morte em metade do varia de 10-25 mg/kg BW20 dependendo da estirpe de rato usado ratos. Para as cepas de rato comumente usados, C57Bl/6 e BALB/c, a dose letal 50% (DL50) é de 10 mg/kg BW. Em contraste, as estirpes C3H/HeJ e C57BL/10ScCr são protegidas de endotoxemia LPS induzidos, que é devido a mutações no Tlr421. Consequentemente, ratos Tlr4-deficientes são hiporeactividade para injeções com LPS22. Outras linhas de rato geneticamente modificado, como PARP1-/-ratos23 são resistentes ao choque tóxico induzida por LPS.

O modelo do mouse descrito aqui usa uma dose subletais de LPS administrado sistemicamente para imitar as consequências da divulgação de LPS, após uma quebra de barreira das superfícies do corpo. A concentração de LPS escolhida (2 mg/kg BW) não induzir a mortalidade em ratos C56Bl/6, mas a liberação induzida de citocinas pró-inflamatórias.

Protocol

Os ratos foram criados e mantidos sob isentos de agentes patogénicos (SPF) condições específicas na instalação de animal do departamento de Biomedicina, Universidade de Basileia (Basileia, Suíça). Todos os experimentos de rato foram realizados em conformidade com o suíço Federal e regulamentos cantonais (número de protocolo animal 2816 [Cantão de Basileia-cidade]).

1. preparação da solução de LPS

  1. Abra o estoque de LPS purificados de Escherichia coli 0111:B4 sob condições estéreis e reconstitui-lo em água na concentração de 5 mg/mL.
  2. Dilua o estoque de LPS com a solução salina estéril tamponada de fosfato (PBS) para a concentração de trabalho de 0,2 µ g / µ l.

2. intraperitoneal injeção de LPS para ratos

  1. Aspire as solução de trabalho em uma seringa de 0,5 mL com agulha 30 G em um fluxo de ar laminar LPS.
  2. Pesar de camundongos C57Bl/6 fêmeas (seis a 10 semanas de idade) e calcular a quantidade de LPS que será injetado: 10 µ l (2 µ g) / g de peso corporal.
    Nota: por exemplo, se um rato pesa 20 g e, em seguida, 20 g x 10 µ l = 200 µ l LPS, trabalhando a solução precisa ser injetado.
  3. Manipular o mouse suavemente mas com firmeza e conter o animal em uma mão. Certifique-se de que o animal é capaz de respirar normalmente, mas não torcer e virar durante a contenção.
  4. Incline o rato nariz ligeiramente para o assoalho para expor o abdome para injeção. Localize a linha média do abdômen e o local de injeção no baixo abdômen esquerda ou direita da linha média. Injete i.p. PBS em vez de LPS em ratos controle.
  5. Com a mão livre, injetar o volume apropriado (o volume calculado no passo 2.2) dos LPS solução de trabalho. Certifique-se que a agulha entrou na cavidade peritoneal em contrário, mis injeções na camada muscular abdominal podem ocorrer. Ainda, não vá muito fundo com a agulha na cavidade peritoneal para evitar ferir os órgãos internos localizados nessa área.
  6. Retorne cuidadosamente o animal da gaiola com até 5 ratos por gaiola.

3. monitorar os ratos

  1. Monitore os animais no momento da injeção e a cada 2 h após a injeção de 8 h para a ocorrência e severidade de endotoxemia. Portanto, use uma folha de Pontuação (tabela 1), que foi adaptada de um manuscrito publicado anteriormente 24.
  2. Marcar os ratos injetados LPS para os seguintes parâmetros listados na tabela 1
    1. Verifique a aparência da pele que é normalmente liso. Se a pele parece pele babado, espetado ou inchado que indica desconforto e/ou dor, marca-lhes como 1, 2 ou 3.
    2. Verifique se a atividade do mouse.
      Nota: Os ratos normalmente mover-se livremente ao redor da gaiola toda comendo, bebendo, escalada, mas atividade suprimida ou restrita pode ser um sinal de dor.
    3. Verifique o nível de consciência.
      Nota: Os ratos são muito curiosos, e movem-se normalmente ao redor da gaiola, investigando os arredores. Falta de ou movimento reduzido pode sugerir dor e desconforto.
    4. Verifica os olhos.
      Nota: Os olhos totalmente abertos são esperados em ratos saudáveis, mas os olhos total ou parcialmente fechados, possivelmente com secreção, podem ser uma indicação de dor.
    5. Verifique a taxa de respiração.
      Nota: Os ratos saudáveis geralmente têm uma taxa de respiração normal e rápida, uma taxa de respiração reduzida poderia ser uma indicação de desconforto).
    6. Verifique a qualidade da respiração.
      Nota: Respiração difícil, com ou sem ofegar é um sinal de dor.

4. tecido amostragem para extração de ácido ribonucleico (RNA) e homogeneização

  1. Preparar os tubos de coleta/homogeneização: reagente de isolamento de RNA adicionar 1 mL passo a passo para tubos de 2 mL preenchido com esferas de cerâmica de 1,4 mm.
  2. Nos pontos de tempo apropriado (antes (0 h) e 2 h, 4 h e 8 h após a injeção de LPS) eutanásia o mouse com overdose de anestésico (isoflurano) seguido de sangria e proceder com a dissecação.
  3. Corte a pele e a camada muscular, expondo a cavidade abdominal com os órgãos internos com uma tesoura.
  4. Dissecar o baço, fígado e cólon, limpe cuidadosamente os órgãos da gordura e mantê-los em PBS no gelo.
  5. Corte um pedaço pequeno (cerca de 0,5 cm de comprimento) de cada órgão usando tesoura ou bisturi.
    Nota: É importante ter sempre a peça de aproximadamente a mesma parte do órgão em cada rato (mesmo lóbulo do fígado, proximal ou distal parte do cólon).
  6. Em breve secar o tecido em um pedaço de tecido de papel e coloque-o no tubo de coleta/homogeneização, certificando-se de que ele está completamente imerso no reagente de isolamento de RNA.
  7. Homogeneizar o tecido em um homogeneizador de bancada de alta velocidade. Para tecidos moles, como baço, fígado e cólon usam 1 ciclo de homogeneização a velocidade 6,00 por 30 s.
  8. Incube as amostras por 5 min à temperatura ambiente.
  9. Cuidadosamente coloque o tubo no nitrogênio líquido para congelar o tecido lisado. Armazene o snap congelado lisado a-80 ° C até o isolamento de RNA.

5. RNA extraído de tecido

Nota: RNA reagentes de isolamento, clorofórmio e álcoois são considerados como material perigoso. Realize a extração do RNA sob uma capa de química. Use o certificado livre de RNase reagentes e equipamentos para manter um ambiente livre de RNase.

  1. Separação de fases
    1. Descongele o lisado de tecido congelado no gelo.
    2. Centrifugar a amostra em 1.000 x g por 5 min a 4 ° C para as restantes partículas de tecido que podem ser deixadas de Pelotas.
    3. Transferi o sobrenadante para um novo tubo isento de nuclease 1,5 mL.
    4. Adicionar clorofórmio gelada da 200 µ l por isolamento 1ml RNA reagente e agitar vigorosamente à mão para 10-15 s.
    5. Incube durante 2-3 min à temperatura ambiente.
    6. Centrífuga em 12, 000 x g durante 15 minutos a 4 ° C.
      Nota: A amostra conterá agora 3 fases: diminuir a fase de vermelho de fenol-clorofórmio, a interfase e a fase aquosa incolor superior. O RNA está presente na fase aquosa superior.
    7. Recolha a fase aquosa superior (50% do volume total) e a transferência em um novo tubo isento de nuclease 1,5 mL.
  2. Precipitação do RNA
    1. Adicionar 0,5 mL isopropanol gelado por 1 mL de reagente de isolamento do RNA e misture suavemente por inversão do tubo 5 - 6 vezes.
    2. Incube durante 10-15 min à temperatura ambiente.
    3. Centrifugar a 12.000 x g por 10 min a 4 ° C.
      Nota: Pelota do RNA deve ser visível nesta fase.
  3. Lavagem de pelota do RNA
    1. Remova completamente o sobrenadante contendo o isopropanol sem perturbar o sedimento.
    2. Lave o sedimento com 1 mL gelada de 75% de etanol, por 1 mL reagente de isolamento de RNA usado para a Lise inicial.
    3. Vórtice da amostra brevemente.
    4. Centrifugar a amostra a 7.500 (ou 12.000) x g por 5 min a 4 ° C.
  4. Dissolução do RNA
    1. Remova completamente o etanol no sobrenadante sem perturbar o sedimento.
    2. Deixar o tubo aberto sob o capô químico para 3-5 min secar ao ar livre a pelota do RNA em temperatura ambiente (não demasiado seco como nesse caso será difícil de dissolver o RNA).
    3. Dissolva a pelota do RNA em água livre de nuclease do 20-50 µ l pipetando cuidadosamente acima e para baixo.
    4. Incube a amostra a 55 ° C, durante 10-15 min melhorar ainda mais a solução do RNA.
      Nota: Nesta fase, RNA pode ser armazenado a-80 ° C até posterior análise.

6. digestão de DNA restante

  1. Medir a concentração de RNA com um espectrofotômetro pipetando igualmente uma alíquota (2 µ l) para o espectrofotômetro e ajustar-se a concentração recomendada.
  2. Inicie a digestão de contaminar o DNA com o max. 10 µ g RNA em água de nuclease livre 50 µ l.
  3. Adicione 0,1 volume de 10 x DNase eu Buffer e 1 µ l rDNase eu por amostra e misture suavemente pipetando cima e para baixo.
  4. Incube a 37 ° C por 20-30 min.
  5. Reagente de inactivação do vórtice DNase e adicionar volume 0,1 à amostra misturando bem com a pipeta.
  6. Incube durante 5 min à temperatura ambiente misturando ocasionalmente pela mão.
  7. Centrifugar a 10.000 x g, durante 1,5 min.
  8. Transferi o sobrenadante contendo RNA DNA livre no tubo nuclease-livre de novo.
  9. Medir a concentração de RNA e qualidade por Espectrofotômetro.

7. reversa transcrição

  1. Use um kit de transcrição reversa (RT) comercialmente disponíveis ácido desoxirribonucleico cDNA por transcrição reversa.
    Nota: Aqui, até 2 µ g de RNA pode ser revertido transcrito.
  2. Calcule o volume, que contém 2 µ g de RNA. Pipete 2 µ g do RNA em um novo tubo PCR.
  3. Adicione água nuclease-livre para a amostra no tubo para o volume final de 10 µ l de PCR.
  4. Prepare 2 x Master Mix, misturando os seguintes componentes listado na tabela 2
  5. Adicione 10 µ l 2 x Master Mix de 10 µ l de RNA para obter 1 x Master Mix no volume total de 20 µ l.
  6. Feche o tubo de reação em cadeia (PCR) de polimerase e spin-down a amostra brevemente.
  7. Colocar as amostras em uma PCR Thermocycler e definir as configurações listadas na tabela 3.
  8. Armazene o cDNA gerado a-20 ° C para posterior análise.

8. quantitativo PCR (qPCR)

  1. Realize a reação de qPCR com um kit disponível comercialmente.
  2. Autoprojete e testar os primers intrão-abrangendo, antes do uso, com diferentes concentrações de cDNA de modelo. Analisar a eficácia da primeira demão, criando uma curva padrão e usar os primers com eficácia elevada e as curvas de fusão corretas.
    Nota: As sequências dos primers utilizados neste experimento estão listadas na tabela 2.
  3. Prepare o quantitativo polimerase de reação em cadeia (qPCR) em 384 a placa com a configuração de reação descrita na tabela 4.
  4. Mantenha todas as soluções e a placa no gelo usando papel alumínio para evitar que a placa ficar molhada quando a mistura reacional é preparada.
  5. Execute todas as reações em triplica.
  6. Realize a reação de PCR em um thermocycler usando a configuração listada na tabela 5.
  7. Calcule o valor médio do Ct para todas as reações do triplica. Normalizar todos os genes-alvo para o nível de expressão de glycerinealdehyde-3-fosfato-desidrogenase (Gapdh) gene das tarefas domésticas, calculando-se 2^(-ΔCt).
    Nota: Todos os genes-alvo com o Ct médio > 35 eram consideradas sob o limite de detecção.

Representative Results

Para imitar as consequências para o host após a entrada de bactérias ou produtos derivados de bactérias, que ocorre após a quebra da barreira intestinal, LPS foi injetado em camundongos C57Bl/6, em doses subletais (2 µ g/g de massa corporal). Cada único rato foi monitorado e marcou para a ocorrência de endotoxemia com parâmetros listados na folha de pontuação que inclui, a aparência dos ratos, a atividade dos animais, a condição dos olhos e a taxa de respiração e qualidade (tabela 1) . Os animais apresentaram sinais clínicos de doença que atingiu o pico de 6 a 10 h após a injeção de LPS e recuperado dentro de 24 h (Figura 1). Individuais camundongos foram sacrificado 2h, 4h e 8h após a injeção de LPS. Pedaços de tecido foram coletados de cólon, fígado e baço. RNA foi isolado por estes órgãos e reverso transcrito de cDNA. O cDNA foi usado como um modelo para qPCR para determinar os níveis de expressão de Il6 (Figura 2A), Il1b (Figura 2B), TNFa (Figura 2) e Il10 (Figura 2D) com primers utilizados para o qPCR descritas na tabela 6. A expressão de Il6 atingiu 2 h após a injeção no baço e cólon e 4h após a injeção no fígado. A expressão de Il1b, TNFa e Il10 pico 4h após a injeção no baço, fígado e cólon. Dentro de 8 h após a injeção, a expressão de Il6, Il1b, TNFa e Il10 retornado aos níveis de base.

Figure 1
Figura 1: injeção de LPS (2 µ g/g de massa corporal) induzida por sinais clínicos de endotoxemia em C57Bl/6mice. Após a injeção de 2 µ g/g de massa corporal de LPS, ratos individuais foram monitorados com o placar de doença apresentado na tabela 1 que inclui a aparência e a atividade dos animais, abrindo seus olhos e sua taxa de respiração e qualidade cada 2h para 12h e 24h na popa er injeção de LPS. O resultado de doença (eixo y) foi eliminado para o respectivo tempo (eixo x). Média ± SD para 4-5 ratos por cada ponto de tempo é apresentado. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: injeção de LPS (2 µ g/g de massa corporal) induz a expressão de citocinas pró-inflamatórias em camundongos C57Bl/6. Os ratos foram injetados com 2 µ g/g de massa corporal de LPS e os níveis de expressão de Il6 (A), Il1b (B), Tnfa (C) e Il10 (D) foram analisados por qPCR no baço, fígado e cólon na hora indicada pontos após a injeção. Níveis de expressão de citocinas foram todos normalizados para a expressão de Gapdh. Média ± SD para 4-5 ratos por cada ponto de tempo é mostrado. Clique aqui para ver uma versão maior desta figura.

Tabela 1: folha de Pontuação doença para monitorar camundongos C57Bl/6 após injeção de LPS. Parâmetros monitorados após a injeção de LPS. Animais foram monitorados a cada 2 h após a injeção, por um período de 12 h, e pontuações foram dadas para cada parâmetro individual listado na tabela. O resultado final para cada animal representa a soma de todas as pontuações individuais. Isto é uma adaptação de referência24. Clique aqui para baixar este arquivo.

Quantidade Reagente
2 µ l da amostra / 10x Buffer RT
0.8 / µ l da amostra 25 x deoxynucleotide (dNTP) Mix (100 mM)
1 amostra / µ l RT Primers aleatórios
4.2 amostra / µ l água livre de nuclease

Tabela 2: Reagentes utilizados para preparar a mistura de mestre a transcrição reversa.

Temperatura Tempo
25 ° C 10 min
37 ° C 120 min
37 ° C 5 min
4 ° C Segure

Tabela 3: Thermocycler configurações usadas para a transcrição reversa.

Quantidade Reagente
5 µ l/poço 2 x Master Mix
0,05 µ l/poço Tintura de referência
final de 500 nM/poço cartilha para a frente
final de 500 nM/poço reverter a primeira demão
entre 10 e 100 ng/bem, usamos 40 ng/poço modelo cDNA diluído em um modelo de tampão de diluição (diluição 1/100 desta reserva foi feita em água livre de nuclease e utilizada para diluir o cDNA do modelo). Diluir o modelo nesse buffer permite a visualização dos poços onde modelo é adicionado como as mudanças de cor de reação do azul ao verde
água livre de nuclease para volume final de 10 µ l/poço água livre de nuclease

Tabela 4: Descrição da reação de PCR.

Temperatura Tempo
95 ° C 2 min
95 ° C 5 s 40 ciclos
60 ° C 20 s
95 ° C 15 s analaysis curva de fusão
60 ° C 1 min
95 ° C 15 s

Tabela 5: Thermocycler configurações usadas para PCR.

Primeira demão Sequência de Temperatura de fusão Comprimento do produto
Il6-F TCG MORDAÇA GCT TAA TTA CAC ATG TTC T 60.3 94 bp
Il6-R GCATCATCGTTGTTCATACAATCA 58,2
Il1b-F TGTGAAATGCCACCTTTTGA 56,1 94 bp
Il1b-R GTCAAAGGTTTGGAAGCAG 57,2
Il10-F ATCGATTTCTCCCCTGTGAA 56,2 108 bp
Il10-R TGTCAAATTCATTCATGGCCT 56,1
TNFa-F CCACCACGCTCTTCTGTCTAC 60,4 103 bp
TNFa-R AGGGTCTGGGCCATAGAACT 60
GAPDH-F CATCAAGAAGGTGGTGAAGC 56,7 199 bp
GAPDH-R CCTGTTGCTGTAGCCGTATT 58

Tabela 6: Primers usados na reação de qPCR. A sequência de primers utilizados para qPCR para detectar rato citocinas e gene de limpeza Gapdh.

Discussion

Este protocolo imita processos imunológicos que ocorrem após a invasão por produtos derivados microbiana. Passos críticos dentro do protocolo são a seleção de linha de rato, o estado de higiene dos ratos, a dose de LPS, o monitoramento dos animais para a ocorrência de endotoxemia e ponto de terminação de experimento de tempo. Mais importante ainda, o fundo genético da estirpe do mouse tem que ser considerado. Estirpes de mouse diferente têm diferente susceptibilidade à LPS. Por exemplo, o C3H/HeJ e camundongos C57BL/10ScCr são resistentes a LPS induziram endotoxemia21,25. Além disso, o estado de higiene dos animais pode influenciar o curso da endotoxemia em LPS. Animais de (SPF) isentos de agentes patogénicos específicos são mais comumente usados. Estes ratos estão livres de uma lista definida de patógenos, mas a composição da microbiota completa destes animais não é conhecida a26,,27. Estéril animais germ-free ou axénica (que não abriga uma microbiota) são distintos dos de ratos SPF26. Provavelmente, a colonização dos animais axénica com um microorganismo, ou com um consórcio de microorganismos (gnotobiotic animais) pode influenciar a expressão dos genes, tais como IL-19, após a injeção de LPS em comparação com animais de FPS8. Além disso, uma folha de Pontuação tem sido sugerida que foi usado como uma folha de Pontuação para um modelo de sepse induzido por injectar a solução fecal da cavidade peritoneal24. Este sheetcan ser discutido com o comitê local de bem-estar animal e pode ser adaptado às necessidades locais. Em particular, os critérios para a sua rescisão precisa de ser discutido com o comitê local de bem-estar animal. Esta experiência teve que ser interrompido quando um escore > 12 é alcançado ou quando a pontuação máxima para um parâmetro individual é alcançada. Neste experimento, nenhum animal de oito animais excedido um placar de doença de 12 após a injeção de LPS (peso corporal de 2 µ g/g). Neste estudo, mostrando a expressão de citocinas Il6, Il1b, TNFa e Il10 no fígado, baço e cólon após injeção de LPS apresentam resultados. A expressão de Il1b, TNFa e Il10 pico 4h após a injeção de LPS no baço, fígado e cólon, Considerando que, na expressão de Il6 chegou 2 h após a injeção de LPS no baço e cólon e 4h após a injeção de LPS no fígado. Dentro de 8 h a expressão Il6, Il1b, TNFa e Il10 retornaram aos níveis de base no baço, fígado e cólon. Severidade da doença atingiu entre 6h e 10h após injeção de LPS, quando a expressão de Il6, Il1b, TNFa e Il10 retornaram já aos níveis de base indicando que aumentou a expressão da Il6, Il1b, TNFa e Il10 ocorre rapidamente após a injeção de LPS, mas que a cinética de outros genes pode mostrar um padrão diferente após a injeção de LPS. A expressão dessas citocinas também poderia ser analisada a nível de proteína no sangue dos animais por ELISA, que pode ser considerada além de qPCR.

Modificações e solução de problemas da técnica são necessárias em casos quando uma doença Pontuação > 12 é alcançado. Portanto, a dose de LPS tem de ser reduzido e melhor ajustado à linha do mouse utilizado e das condições locais para evitar o encerramento prematuro do experimento. A manipulação de genes por exclusão de uma determinada região genômica ou superexpressão de um gene pode influenciar a susceptibilidade dos ratos de LPS. Em experimentos preliminares, a dose de LPS pode ser titulada para a dose adequada para evitar danos desnecessários e morte para os animais neste experimento. De nota, contaminação dos LPS com outros produtos derivados de bactérias e injeções de mis tem que ser evitado. Além disso, a cinética da expressão de genes de interesse após a injeção de LPS precisa ser determinado.

Limitações são que esta técnica fornece informações sobre as consequências da divulgação de produtos microbianos no hospedeiro após uma falha de barreira intestinal, mas não vai dar informações sobre eventos que levam a quebra da barreira intestinal e a causas esse gatilho, IBD. Claro, este modelo não é um modelo de colite como o modelo de colite DSS, mas pode ser útil, além de modelos de colite para estudar as consequências da entrada dos produtos microbianos no hospedeiro. Além disso, a injeção i.p. de LPS vai interromper a cavidade peritoneal, em que o pequeno e o intestino estão localizado. Isto pode facilitar a translocação intestinal-produtos de origem bacterianas da cavidade peritoneal para o host.

O significado deste modelo é o fato que ele usa um PAMP definido. Em outros modelos, incluindo a injeção i.p. de toda bactéria, a injeção i.p. de soluções fecal24 ou os modelos de peritonite séptica, em que a peritonite é induzida pela cecal ligadura e perfuração28, uma vasta gama de micróbios ou seus produtos induz a doença. Além disso, a injeção de LPS em camundongos é uma abordagem simples e não requer cirurgia como peritonite séptica induzida por punção e ligadura cecal.

Aplicação deste modelo são estudos que visam investigar endotoxemia ou septicemia de LPS induzidas em quaisquer contextos caracterizado pela translocação de produtos derivados de bactérias no hospedeiro, tais como a quebra da barreira de pele ou violados do trato urogenital. Em conclusão, este é um modelo simples que pode ser usado em cada configuração de laboratório. Dependendo das condições locais, pode haver adaptações ao necessário às necessidades locais. Em particular, a folha de Pontuação tem de ser discutido com as autoridades locais antes que a experiência é realizada. Esta abordagem foi utilizada para imitar as consequências para o host quando bactérias ou produtos derivados de bactérias entram o hospedeiro após uma quebra de barreira ocorreu. Isto pode ser especialmente relevante em estudos examinando a base do IBD, onde a ocorrência de uma falha na barreira intestinal é um evento comum na patologia da doença.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Douglas é apoiada pela Fundação Nacional Suíço (SNSF 310030_146290).

Materials

Name Company Catalog Number Comments
DreamTaq Green PCR Master Mix (2x) Thermo Fisher Scientific, Waltham, MA, USA K1081
High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA 4368813
RNase-Free DNase Set, Qiagen, Hilden, Germany 79254
LPS Escherichia coli O111:B4 Invivogen, San Diego, CA, USA. tlrl-eblps
Omnican 50 Single-use insulin syringe B. Braun Melsungen, Melsungen, Germany 9151125
Bioanalyzer 2100 Agilent Technologie, Santa Clara, USA not applicable
Centrifuge 5430 Eppendorf, Hamburg, Germany not applicable
Centrifuge Mikro 220R Hettich, Kirchlengern, Germany not applicable
Dissection tools Aesculap, Tuttlingen, Germany not applicable
Fast-Prep-24 5G Sample Preparation System M.P. Biomedicals, Santa Ana, CA, USA not applicable
NanoDrop ND-1000 NanoDrop Products, Wilmington, DE, USA not applicable
TRI Reagent Zymo Research, Irvine, CA, USA R2050-1

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Abreu, M. T., et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 123, 679-688 (2002).
  3. Liu, Y., et al. Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease. Gastroenterology. 108, 1396-1404 (1995).
  4. Schaffer, T., et al. Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans. Inflamm Bowel Dis. 13, 1339-1346 (2007).
  5. Sellon, R. K., et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 66, 5224-5231 (1998).
  6. Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. The gut microbiota in mouse models of inflammatory bowel disease. Front Cell Infect Microbiol. 4, 28 (2014).
  7. Schaubeck, M., et al. Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence. Gut. 65, 225-237 (2016).
  8. Steinert, A., et al. The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models. J Immunol. 199, 2570-2584 (2017).
  9. Gabele, E., et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH. J Hepatol. 55, 1391-1399 (2011).
  10. Saunders, S. P., et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol. 184, 2627-2637 (2010).
  11. Spadoni, I., et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science. 350, 830-834 (2015).
  12. Balmer, M. L., et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci Transl Med. 6, 237ra266 (2014).
  13. Maier, R. V., Mathison, J. C., Ulevitch, R. J. Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins. Prog Clin Biol Res. 62, 133-155 (1981).
  14. Lu, Y. C., Yeh, W. C., Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine. 42, 145-151 (2008).
  15. Deng, M., et al. Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis. J Immunol. 190, 5152-5160 (2013).
  16. Kagan, J. C., et al. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 9, 361-368 (2008).
  17. Akira, S., Uematsu, S., Takeuchi, O. Pathogen recognition and innate immunity. Cell. 124, 783-801 (2006).
  18. Cohen, J. The immunopathogenesis of sepsis. Nature. 420, 885-891 (2002).
  19. Suffredini, A. F., et al. Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration. J Immunol. 155, 5038-5045 (1995).
  20. Fink, M. P. Animal models of sepsis. Virulence. 5, 143-153 (2014).
  21. Poltorak, A., et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 282, 2085-2088 (1998).
  22. Hoshino, K., et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 162, 3749-3752 (1999).
  23. Corral, J., et al. Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models. Am J Pathol. 166, 1089-1098 (2005).
  24. Shrum, B., et al. A robust scoring system to evaluate sepsis severity in an animal model. BMC Res Notes. 7, 233 (2014).
  25. Brandwein, S. L., et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol. 159, 44-52 (1997).
  26. Macpherson, A. J., McCoy, K. D. Standardised animal models of host microbial mutualism. Mucosal Immunol. 8, 476-486 (2015).
  27. Masopust, D., Sivula, C. P., Jameson, S. C. Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology. J Immunol. 199, 383-388 (2017).
  28. Wirtz, S., et al. Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27. J Exp Med. 203, 1875-1881 (2006).

Erratum

Formal Correction: Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach
Posted by JoVE Editors on 08/04/2018. Citeable Link.

An erratum was issued for: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

One of the authors' names was corrected from:

Katarina Raduolovic

to:

Katarina Radulovic

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics