Injeksjoner av lipopolysakkarid i mus å etterligne av mikrobielle avledede produkter etter Intestinal barriere brudd

Immunology and Infection
 

ERRATUM NOTICE

Summary

Her vises en protokoll å etterligne av bakteriell-avledet forbindelser etter intestinal barriere brudd. En lav sublethal dose av lipopolysakkarid ble injisert systemisk i mus, som var overvåket for 24 timer etter injeksjon. Uttrykk for pro-inflammatoriske cytokiner var fast bestemt på flere tidspunkt i milten og leveren kolon.

Cite this Article

Copy Citation | Download Citations

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Intestinal epithelial barrieren skiller verten fra microbiota som normalt tolerert eller ignorert. Brudd på denne barrieren gir av bakterier eller bakterier avledede produkter inn i vert, tilgang til verten sirkulasjon og indre organer som fører til ukontrollert betennelse som observert hos pasienter med inflammatorisk tarmsykdom (IBD), som kjennetegnes av en økt tarm epithelial permeabilitet.

For å etterligne av bakteriell-avledet forbindelser til verten, en endotoxemia modell har iverksatt som lipopolysakkarid (LPS), en komponent i ytre cellen vegg av Gram-negative bakterier, ble injisert i mus. I denne studien, en sublethal dose LPS ble intraperitoneally injisert og mus ble senere overvåket 8 h bruker en sykdom score. Videre legge uttrykket nivåer av inflammatoriske cytokiner Il6, Il1b, og Tnfa ble analysert i milten, lever og kolon av qPCR på ulike tidspunkt LPS injeksjon. Denne modellen kan være nyttig for studiene som involverer undersøkelse av immunreaksjoner etter invasjonen av mikroorganismer eller bakteriell avledede produkter skyldes barriere brudd på karosseriet.

Introduction

Menneskelige tarmen er ferdig kolonisert med et stort konsortium av mikroorganismer som danner bakterieflora, som har utviklet en gjensidig fordelaktig forhold med verten under utviklingen. I dette forholdet gir verten en sikker nisje for bakterieflora, mens bakterieflora gir vitaminer, Nærings fordøyelsen og beskyttelse mot patogener til verten der bakterieflora ligger1. Når dette gunstig forholdet mellom verten og bakterieflora er forstyrret, kan sykdommer utvikle, som inflammatorisk tarmsykdom (IBD). IBD er en multifaktoriell kronisk inflammatorisk sykdom i tarmen forårsaket av genetiske og miljømessige faktorer som forekommer i to store former, Crohns sykdom (CD) og ulcerøs kolitt (UC). Til tross for likheter mellom de to IBD formene, er de preget av visse forskjeller i plasseringen og arten av inflammatoriske endringer. CD er en relapsing transmuralt inflammatorisk lidelse som potensielt kan utvide til alle deler av mage-tarmkanalen, mens UC er ikke-transmuralt og er begrenset til tykktarmen. I tillegg mutasjoner i Nucleotide bindende oligomerization domenet inneholder protein 2 (NOD2), en mønster anerkjennelse reseptor (PRR) som gjenkjenner muramyl dipeptide (MDP), en komponent i cellen vegg av mest Gram-positive og -negative bakterier, er knyttet til CD2. Videre ble Escherichia coli (E. coli), Listeria og Streptococci og deres produkter alle funnet i makrofager i CD pasienter har angitt verten når en barriere bryter3. Når bakterier eller deres produkter Angir verten under utviklingen av CD, utvikler immunsystemet et svar som fører til produksjon av sirkulerende antibakterielt antistoffer4. Kanskje stammer det mest overbevisende beviset for rollen bakterieflora i patogenesen av IBD fra musen modeller. Når dyrene er behandlet med antibiotika, eller mus holdes i bakterie-fri (GF) forhold, reduseres det alvorlighetsgraden av sykdommen i de fleste kolitt modeller, som i IL-10-/-mus som ikke utvikle kolitt i GF fasiliteter5,6. Videre forstyrrer kolitt også sammensetningen av bakterieflora, som er preget av en ubalanse komposisjon og redusert rikdom kalt dysbiosis7. Konsekvensen av IBD kan være en økt tarm permeabilitet som kan føre til inngangen mikrober og mikrobiell avledede produkter til verten.

I dyr induserer programmet av dekstran Sodium Sulfate (DSS) en intestinal epithelial brudd fører til en økt permeabilitet av epitelial barriere8. Portalen LPS konsentrasjoner er opphøyet i dyr med DSS kolitt9. Interessant, er dyr mangler C type Lektiner reseptor spesifikke intracellulær vedheft molekyl-3 fanget nonintegrin homolog-relaterte 1 (tegn-R1) beskyttet fra DSS kolitt og LPS-indusert endotoxemia10. Du videre spre til verten, må bakterier eller bakterier avledet produkter passere vaskulær barriere11, bukhulen, små og store tarmen er plassert i, hvem lymfeknuter og/eller de lever12. For å redusere kompleksiteten i systemet, ble en definert bakteriell-avledet sammensatt brukt. LP-plater, som forårsaker endotoxemia etter intraperitoneal (IP) eller intravenøs (IV) injeksjon13 ble injisert i mus, uttrykk for interleukins Il6 og Ilb og cytokin Tnfa svar på LPS.

LPS er en patogen-forbundet molekylær mønster (PAMP) uttrykt som en celle-vegg komponent av Gram-negative bakterier, som består av lipid A (den viktigste PAMP i strukturen i LPS), en kjerne oligosaccharide og en O side kjede14. Toll-like reseptor 4 (TLR4) uttrykt av dendrittiske celler og makrofager epitelceller gjenkjenner LPS15, som krever co reseptorer for aktuelle bindingen. Akutt fase protein LPS-bindende protein (LBP) binder LPS danner et kompleks som overfører LPS til cluster for differensiering 14 (CD14), en glycosylphosphatidylinositol-forankret membran protein. CD14 videre transport LPS lymfocytt antigen 96 eller også MD-2, som er forbundet med den ekstracellulære domenet av TLR4. Binding av LPS til MD-2 muliggjør dimerization av TLR4/MD-2 for å skape conformational å rekruttere intracellulær adapter molekyler for å aktivere den nedstrøms signalnettverk veien14, som inkluderer den myelogen differensiering primært Response gene 88 (MyD88) - avhengige pathway og den TIR domenet inneholder adapter-inducing interferon-β (TRIF) - avhengige veien16. Anerkjennelse av LPS av TLR4 deretter aktiverer NF-κB veien og induserer uttrykk for proinflammatory cytokiner, slik som TNFα, IL-6 og IL-1β17.

Spesielt når LPS injiseres i dyr, konsentrasjonen av LPS gitt til dyrene, har genetisk bakgrunn av dyret og kosthold vurderes. Høye konsentrasjoner av LPS fører til en septisk sjokk, preget av hypotensjon og flere organ svikt, og til slutt til død18. Mus er mindre følsomme til LPS forhold til mennesker, hvor LPS foretakssammenslutninger mellom 2-4 ng/kg kroppsvekt (BW) er i stand til å indusere en cytokin storm19. For mus, dødelig dose (LD50), som induserer død i halvparten av mus varierer fra 10-25 mg/kg BW20 avhengig av musen påkjenningen brukes. De brukte mus stammene, C57Bl/6 og BALB/c, er dødelig dose 50% (LD50) 10 mg/kg BW. Derimot er stammer C3H/HeJ og C57BL/10ScCr beskyttet mot LPS indusert endotoxemia, som skyldes mutasjoner i Tlr421. Følgelig er Tlr4 dårlig mus hyporesponsive til injeksjoner med LPS22. Andre genmodifiserte musen linjer, for eksempel PARP1/mus23 er motstandsdyktig mot LPS-indusert toksisk sjokk.

Mus-modell som er beskrevet bruker her en sublethal dose LPS administrert systemisk for å etterligne konsekvensene av LPS formidling etter en barriere brudd av kroppens overflater. Valgte LPS konsentrasjonen (2 mg/kg BW) ikke få dødelighet i C56Bl/6 mus, men indusert utgivelsen av pro-inflammatoriske cytokiner.

Protocol

Mus ble avlet og holdt under bestemte patogen-fri (SPF) forhold i dyr anlegget av Institutt for biomedisin, Universitetet i Basel (Basel, Sveits). Alle mus eksperimentene ble utført i henhold til sveitsiske føderale og Cantonal forskrifter (dyr Protokollnummer 2816 [Canton av Basel-Stadt]).

1. forberedelse LPS løsning

  1. Åpne beholdningen av LPS renset fra Escherichia coli 0111:B4 under sterile forhold og gjeninnføre det i vann til konsentrasjonen av 5 mg/mL.
  2. Fortynne LPS aksjen med sterilt fosfat bufret saltvann (PBS) å arbeide konsentrasjonen av 0,2 µg/µL.

2. intraperitoneal injeksjon til LPS å mus

  1. Sug opp LPS arbeider løsning i en 0,5 mL sprøyte med en 30 G nål i en laminær luftstrøm.
  2. Veie kvinnelige C57Bl/6 mus (seks til 10 uker gamle) og beregne mengden LPS som injiseres: 10 µL (2 µg) /g kroppsvekt.
    Merk: For eksempel hvis en mus veier 20 g og 20 g x 10 µL = 200 µL LPS arbeider løsning må injiseres.
  3. Håndtere musen forsiktig men bestemt og holde dyr i en hånd. Kontroller at dyret er i stand til puste normalt, men ikke til å vri og slå under tilbakeholdenhet.
  4. Vipp musen nesen litt mot gulvet å avsløre magen for injeksjon. Finn midtlinjen av magen og injeksjonsstedet sted i lav magen venstre eller høyre fra midtlinjen. Injisere IP PBS i stedet for LPS i kontroll mus.
  5. Med den ledige hånden, injisere det riktige volumet (volumet beregnes i trinn 2.2) til LPS arbeider løsning. Kontroller at nålen har angitt bukhulen som ellers mis injeksjoner i bukmuskel laget kan oppstå. Likevel, ikke gå for dypt med nålen i bukhulen å unngå å skade indre organer i dette området.
  6. Tilbake dyret nøye til buret med opptil 5 mus per bur.

3. skjermen mus

  1. Overvåke dyrene ved injeksjon og hver 2t etter injeksjon 8 h for forekomsten og alvorlighetsgraden av endotoxemia. Bruk derfor en poengsummen ark (tabell 1) som er tilpasset fra en tidligere publiserte manuskriptet 24.
  2. Score LPS injisert mus for følgende parametere i tabell 1
    1. Kontroller for utseendet av pelsen som er normalt glatt. Hvis pelsen vises ruffled, bustete og puffy pels som indikerer ubehag og/eller smerter, score dem som 1, 2 eller 3.
    2. Kontroller om aktiviteten til musen.
      Merk: Mus flytte normalt fritt rundt hele buret spise, drikke, klatring, men undertrykt eller begrenset aktivitet kan være et tegn på smerte.
    3. Sjekk for bevissthet.
      Merk: Mus er veldig nysgjerrig, og de beveger vanligvis seg buret gransker rundt. Mangel på eller redusert bevegelse kan foreslå smerte og ubehag.
    4. Sjekk øynene.
      Merk: Fullt åpne øynene forventes i sunne mus, men helt eller delvis lukket øynene, muligens med sekresjon, kan være en indikasjon på smerte.
    5. Se etter pustefrekvens.
      Merk: Sunn mus har vanligvis en normal og rask pustefrekvens, en redusert pustefrekvens kan være en indikasjon på ubehag).
    6. Sjekk for åndedrett kvaliteten.
      Merk: Arbeidet puste med eller uten gisper er et tegn på smerte.

4. vev prøvetaking for ribonukleinsyre (RNA) utvinning og homogenisering

  1. Forberede innsamling/homogenisering rør: legge til 1 mL enkeltsteg RNA isolasjon reagens til 2 mL rør forhåndsutfylt med 1,4 mm keramisk kuler.
  2. På de aktuelle tidspunkt (før (0 h) og 2 h, 4 h og 8 timer etter LPS injeksjon) euthanize musen med bedøvende overdose (isoflurane) etterfulgt av exsanguination og fortsette med dissection.
  3. Kuttet hud og muskel laget utsette bukhulen med indre organer med en saks.
  4. Nøye analysere milt, leveren, og kolon, rene organer fra fett og holde dem i PBS på is.
  5. Klipp ut et lite stykke (ca 0,5 cm lang) fra hvert organ med saks eller skalpell.
    Merk: Det er viktig å alltid ta del fra omtrent samme del av orgelet i hver mus (samme flik av leveren, proksimale eller distale del av kolon).
  6. Snart tørke vev på et stykke papir vev og plasser den i samlingen/homogenisering røret sørge for at det er helt nedsenket i RNA isolasjon reagens.
  7. Homogenize vevet i et høyhastighets Borstemmaskin homogenizer. For myke vev som milten og leveren kolon bruker 1 syklus av homogenisering hastigheten 6.00 for 30 s.
  8. Inkuber prøvene i 5 minutter ved romtemperatur.
  9. Nøye sted røret i flytende nitrogen å knipse fryse vev lysate. Lagre snap frosset lysate ved-80 ° C til RNA isolasjon.

5. RNA utvinning fra vev

Merk: RNA isolasjon reagenser kloroform og alkoholer betraktes som farlig materiale. Utføre RNA utvinning under kjemiske hette. Bruk sertifiserte RNase-fri reagenser og utstyr for å opprettholde et RNase miljø.

  1. Fase separasjon
    1. Tine frossen vevet lysate på is.
    2. Sentrifuge prøven på 1000 x g i 5 min på 4 ° C pellets gjenværende vev partikler som kan være venstre.
    3. Overføre nedbryting til en ny nuclease uten 1,5 mL tube.
    4. Legg til 200 µL iskald kloroform per 1 mL RNA isolasjon reagens og rist kraftig hånd for 10-15 s.
    5. Inkuber i 2-3 min i romtemperatur.
    6. Sentrifuger på 12, 000 x g i 15 min på 4 ° C.
      Merk: Utvalget nå inneholder 3 faser: lavere røde fenol-kloroform fasen, interphase og den øvre Fargeløse vandige fasen. RNA finnes i den øvre vandige fasen.
    7. Samle øvre vandige fasen (50% av totalt volum) og overføring til en ny nuclease uten 1,5 mL tube.
  2. RNA nedbør
    1. Legg 0,5 mL iskald isopropanol per 1 mL RNA isolasjon reagens og bland forsiktig ved å snu røret 5 - 6 ganger.
    2. Inkuber i 10-15 min ved romtemperatur.
    3. Sentrifuger 12.000 x g i 10 min på 4 ° C.
      Merk: RNA pellet skal være synlig på dette stadiet.
  3. Vask av RNA pellet
    1. Fjerne nedbryting som inneholder isopropanol uten å forstyrre pellet.
    2. Vask pellets med 1 mL iskald 75% etanol per 1 mL RNA isolasjon reagens som brukes for den første lysis.
    3. Vortex prøven kort.
    4. Sentrifuger prøven 7500 (eller 12.000) x g i 5 min på 4 ° C.
  4. Oppløsende RNA
    1. Fjerne etanol i nedbryting uten å forstyrre pellet.
    2. La åpnet røret under kjemiske panseret for 3-5 minutter å air-dry RNA pellet ved romtemperatur (ikke over tørr som i dette tilfellet vil det være oppløse RNA).
    3. Oppløse RNA pellet i 20-50 µL nuclease-fritt vann av pipettering forsiktig opp og ned.
    4. Inkuber prøven ved 55 ° C i 10-15 minutter å forbedre løsningen av den.
      Merk: På dette stadiet, RNA kan lagres ved-80 ° C til videre analyse.

6. fordøyelsen av gjenværende DNA

  1. Måle RNA konsentrasjonen med et spektrofotometer ved pipettering en aliquot (2 µl) i spektrofotometeret og Juster anbefalte konsentrasjonen.
  2. Starte fordøyelsen av forurensende DNA med maks. 10 µg RNA i 50 µL nuclease-fritt vann.
  3. Legge til 0,1 volumet av 10 x DNase jeg Buffer og 1 µL rDNase jeg per eksempel og bland forsiktig av pipettering opp og ned.
  4. Ruge på 37 ° C i 20-30 min.
  5. Vortex DNase inaktivering reagens og legge til 0,1 volumet til prøven blander godt med pipette.
  6. Inkuber i 5 minutter ved romtemperatur blanding innimellom for hånd.
  7. Sentrifuge 10.000 x g for 1,5 min.
  8. Overføre nedbryting som inneholder DNA-fri RNA i det nye nuclease-fri røret.
  9. Måle RNA konsentrasjonen og kvaliteten av spektrofotometeret.

7. omvendt transkripsjon

  1. Bruk en kommersielt tilgjengelig deoksyribonukleinsyre cDNA omvendt transkripsjon (RT) kit for omvendt transkripsjon.
    Merk: Her, opptil 2 µg av RNA kan tilbakeføres transkribert.
  2. Beregne volumet, som inneholder 2 µg RNA. Pipetter 2 µg RNA i et nytt PCR-rør.
  3. Legge til nuclease-fritt vann utvalget i PCR røret til det endelige volumet av 10 µL.
  4. Forberede 2 x Master Mix ved å blande følgende komponenter vises i tabell 2
  5. Legge til 10 µL 2 x Master Mix 10 µl RNA å få 1 x Master Mix i det totale volumet av 20 µL.
  6. Lukke polymerase kjedereaksjon (PCR) rør og rotere ned prøven kort.
  7. Sett prøvene i et PCR-Thermocycler og angir innstillingene i tabell 3.
  8. Lagre det genererte cDNA på 20 ° C for videre analyse.

8. kvantitativ PCR (qPCR)

  1. Utføre qPCR reaksjon med en kommersielt tilgjengelig kit.
  2. Selv utforme og teste intron-spenner primerne, før bruk, med ulike konsentrasjoner av malen cDNA. Analysere effekten av primer ved å opprette en standard kurve og bruk primerne med høy effekt og riktig smeltende kurver.
    Merk: Sekvenser av primere brukt i dette eksperimentet er oppført i tabell 2.
  3. Forberede kvantitative polymerase kjedereaksjon (qPCR) reaksjonen i 384-vel platen med reaksjon oppsett beskrevet i Tabell 4.
  4. Hold alle løsninger og plate is bruke aluminiumsfolie for å hindre platen får våt når reaksjonsblandingen er forberedt.
  5. Utføre alle reaksjonene triplicates.
  6. Utføre PCR reaksjonen på en thermocycler ved å bruke innstillingen oppført i tabell 5.
  7. Beregne gjennomsnittsverdien Ct for alle reaksjoner fra triplicates. Normalisere alle mål gener uttrykk nivået på glycerinealdehyde-3-fosfat-dehydrogenase (Gapdh) housekeeping genet ved å beregne 2^(-ΔCt).
    Merk: Alle mål gener av gjennomsnittlig CT > 35 ble ansett å være under gjenkjenning grensen.

Representative Results

For å etterligne konsekvensene for verten etter inngangen bakterier eller bakteriell avledede produkter som oppstår etter intestinal barriere brudd, LPer ble injisert i C57Bl/6 mus i en sublethal dose (2 µg/g kroppsvekt). Hver enkelt museklikk var overvåket og scoret for forekomsten av endotoxemia med parameterne listet i poengsummen ark som inneholder, utseendet på mus, aktiviteten til dyrene, tilstanden til øyne, og åndedrett hastighet og kvalitet (tabell 1) . Dyrene viste klinisk underskriver av sykdom som nådde 6 til 10 h etter injeksjon av LPS og gjenopprettet innen 24 timer (figur 1). Individuelle mus ble ofret 2t 4 h og 8 timer etter injeksjon av LPS. Vev stykker ble samlet fra milt og lever kolon. RNA var isolert fra disse organene og omvendt transkribert til cDNA. CDNA ble brukt som en mal for qPCR for å finne uttrykk nivåene av Il6 (figur 2A) Il1b (figur 2B), TNFa (figur 2C) og Il10 (figur 2D) med primere brukt for qPCR oppført i tabell 6. Uttrykk for Il6 toppet 2t etter injeksjon i milten og kolon 4T etter injeksjon i leveren. Uttrykk for Il1b, TNFa, og Il10 toppet 4T etter injeksjon i milten og leveren kolon. Innen 8 timer etter injeksjon tilbake uttrykk for Il6, Il1b, TNFa, og Il10 til den opprinnelige nivået.

Figure 1
Figur 1: LPS injeksjon (2 µg/g kroppsvekt) indusert klinisk underskriver av endotoxemia i C57Bl/6mice. Etter injeksjon av 2 µg/g kroppsvekten til LPS, personlige mus ble overvåket med sykdom score presentert i tabell 1 som inkluderer utseendet og aktiviteten til dyrene, åpne øynene og åndedrett hastighet og kvalitet hver 2t 12t og 24 h akter eh LPS injeksjon. Sykdom score (y-aksen) ble strøket respektive tidspunktet (x-aksen). Mener ± SD for 4-5 mus per hvert tidspunkt er presentert. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: LPS injeksjon (2 µg/g kroppsvekt) induserer uttrykk for pro-inflammatoriske cytokiner i C57Bl/6 mus. Musene ble injisert med 2 µg/g kroppsvekt av LPS og uttrykk nivåene av Il6 (A), Il1b (B), Tnfa (C) og Il10 (D) ble analysert av qPCR i milten og leveren kolon på angitt tidspunkt poeng etter injeksjon. Cytokin uttrykk nivåer var alle normalisert til uttrykk for Gapdh. Mener ± SD for 4-5 mus per hvert punkt vises. Klikk her for å se en større versjon av dette tallet.

Tabell 1: sykdom poengsummen ark til å overvåke C57Bl/6 mus etter LPS injeksjon. Parametere som overvåkes etter LPS injeksjon. Dyrene ble overvåket hver 2t etter injeksjon for en periode på 12 h, og score gitt for hver enkelt parameter som er oppført i tabellen. Sluttresultatet for hvert dyr representerer summen av alle individuelle scorer. Dette er tilpasset fra referanse24. Klikk her for å laste ned denne filen.

Beløp Reagens
2 µL/sample 10 x RT Buffer
0,8 µL/sample 25 x deoxynucleotide (dNTP) blanding (100 mM)
1 µL/sample RT tilfeldig primere
4.2 µL/sample nuclease-fritt vann

Tabell 2: Reagenser brukes til å forberede master mix omvendt transkripsjon.

Temperatur Tid
25 ° C 10 min
37 ° C 120 min
37 ° C 5 min
4 ° C Hold

Tabell 3: Thermocycler innstillinger som brukes for omvendt transkripsjon.

Beløp Reagens
5 µL/godt 2 x Master Mix
0,05 µL/godt Referanse Dye
500 nM-finalen/godt fremover primer
500 nM-finalen/godt omvendt primer
mellom 10 og 100 brukte ng/Vel, vi 40 ng/godt mal cDNA fortynnet i en mal fortynning Buffer (1/100 fortynning av denne bufferen ble gjort i nuclease-fritt vann og brukes å fortynne mal cDNA). Fortynne malen i denne bufferen kan effekten av der malen er lagt som reaksjon fargeendringer fra blå til grønn
nuclease-fritt vann til siste volumet av 10 µL/godt nuclease-fritt vann

Tabell 4: Beskrivelse av PCR reaksjonen.

Temperatur Tid
95 ° C 2 min
95 ° C 5 s 40 sykluser
60 ° C 20 s
95 ° C 15 s smeltende kurven analaysis
60 ° C 1 min
95 ° C 15 s

Tabell 5: Thermocycler innstillinger som brukes for PCR.

Primer Sekvens Smeltetemperaturen Produktet lengde
Il6-F TCG GAG GCT TAA TTA CAC ATG TTC T 60.3 94 bp
Il6-R GCATCATCGTTGTTCATACAATCA 58,2
Il1b-F TGTGAAATGCCACCTTTTGA 56,1 94 bp
Il1b-R GTCAAAGGTTTGGAAGCAG 57,2
Il10-F ATCGATTTCTCCCCTGTGAA 56.2 108 bp
Il10-R TGTCAAATTCATTCATGGCCT 56,1
Tnfa-F CCACCACGCTCTTCTGTCTAC 60.4 103 bp
Tnfa-R AGGGTCTGGGCCATAGAACT 60
Gapdh-F CATCAAGAAGGTGGTGAAGC 56,7 199 bp
Gapdh-R CCTGTTGCTGTAGCCGTATT 58

Tabell 6: primere brukt i qPCR reaksjonen. Sekvensen av primere brukt for qPCR å merker musen cytokiner og housekeeping genet Gapdh.

Discussion

Denne protokollen etterligner immunologiske prosesser som oppstår etter invasjonen av mikrobielle avledede produkter. Avgjørende skritt i protokollen er valget av musen linjen, statusen hygiene for mus, dosen av LPS, overvåking av dyrene for forekomsten av endotoxemia og tidspunktet eksperiment avslutning. Viktigst, må genetisk bakgrunn av musen belastning vurderes. Annen mus stammer ha annerledes mottagelighet å LPS. For eksempel indusert C3H/HeJ og C57BL/10ScCr mus er resistente mot LPS endotoxemia21,25. Videre kan hygiene status dyrene påvirke løpet av endotoxemia i LPS. Spesifikke-patogen-fri (SPF) dyr brukes oftest. Disse musene er fri fra en definert liste av patogener, men fullstendig bakterieflora sammensetningen av disse dyrene er ikke kjent26,27. Sterilt bakterie-fri eller axenic dyr (som ikke havn en bakterieflora) er atskilt fra SPF mus26. Sannsynlig kan koloniseringen av axenic dyr med en microorganism eller et konsortium av mikroorganismer (gnotobiotic dyr) påvirke uttrykket av gener som IL-19 etter LPS injeksjon sammenlignet med SPF dyr8. Videre har en poengsummen ark blitt foreslått som ble brukt som poengsummen ark for en sepsis modell av injisere fecal løsningen i bukhulen24. Denne sheetcan diskuteres med lokale dyrevelferd komiteen og kan tilpasses de lokale behov. Spesielt kriteriene for avslutning må diskuteres med lokale dyrevelferd komiteen. Dette eksperimentet måtte stoppes når en poengsum > 12 oppnås eller maksimum poengsum for en enkelt parameter er nådd. I dette eksperimentet overskredet ingen dyr av åtte dyr sykdom poengsummen 12 etter injeksjon av LPS (2 µg/g kroppsvekt). I denne studien presenteres resultater viser uttrykket av cytokiner Il6, Il1b, TNFa og Il10 i leveren, milt og kolon etter injeksjon av LPS. Uttrykk for Il1b, TNFa og Il10 toppet 4T etter LPS injeksjon i milten og leveren kolon, mens Il6 uttrykk nådde 2t etter LPS injeksjon i milten og kolon og 4 h etter LPS injeksjon i leveren. Innen 8 h uttrykket Il6tilbake Il1b, TNFa og Il10 til opprinnelige nivåer i milten og leveren kolon. Sykdommens alvorlighetsgrad toppet mellom 6 h og 10 h etter LPS injeksjon når uttrykk for Il6, Il1b, TNFa og Il10 har allerede returnert til den opprinnelige nivået som viser at økt uttrykk for Il6, Il1b, TNFa og Il10 oppstår raskt etter LPS injeksjon, men at the kinetics av andre gener kan vise et annet mønster etter LPS injeksjon. Uttrykket av disse cytokiner kan også analyseres på protein nivå i blod dyrene med ELISA, som kan anses i tillegg til qPCR.

Endringer og feilsøking av teknikken er nødvendig i tilfeller når en sykdom score > 12 er nådd. Derfor har dosen av LPS redusert og bedre tilpasset brukte musen linjen og lokal betingelser å unngå tidlig avslutning av eksperimentet. Manipulering av gener ved å slette et genomisk område eller overexpressing et gen kan påvirke mottakelighet av mus til LPS. Foreløpig eksperimenter, kan dosen av LPS være titreres til passende dose å unngå unødvendig skade og død til dyrene i dette eksperimentet. Av notatet, forurensning av plater med andre bakterielle avledede produkter og MIS injeksjoner må unngås. Videre må the kinetics av uttrykket av gener rundt etter LPS injeksjon bestemmes.

Begrensninger er at denne teknikken gir informasjon om konsekvensene av formidling av mikrobielle produkter til verten etter en intestinal barriere brudd, men vil ikke gi informasjon om hendelsene som fører til intestinal barriere brudd og årsaker den utløseren IBD. Selvfølgelig, denne modellen er ikke en kolitt modell som DSS kolitt modell, men det kan være nyttig i tillegg til kolitt modeller å studere konsekvensen av inngangen mikrobiell produkter til verten. Videre vil IP injeksjon av LPS forstyrre bukhulen, der små og det store tarmen er plassert. Dette kan forenkle translokasjon av avledede intestinal bakteriell produkter fra bukhulen til verten.

Betydningen av denne modellen er at den bruker en definert PAMP. I andre modeller inkludert IP injeksjon av hele bakterier, IP injeksjon av fecal løsninger24 eller septisk peritonitis modeller som peritonitis er indusert av cecal hemorroider og punktering28, et stort utvalg av mikrober eller deres produkter induserer sykdom. Videre injeksjon av LPS i mus er en ukomplisert og krever ikke kirurgi i septisk peritonitis indusert av cecal hemorroider og punktering.

Ytterligere anvendelse av denne modellen er studier som mål å undersøke endotoxemia eller LPS indusert septicemia i noen sammenhenger preget av translokasjon av bakterier avledede produkter inn i vert, brudd på huden barriere eller brutt av den urogenital skrift. I konklusjonen, er dette en enkel modell som kan brukes i alle laboratorium innstillingen. Avhengig av de lokale forholdene, kan det være tilpasninger til nødvendig for lokale behov. Spesielt må poengsummen ark diskuteres med lokale myndigheter før eksperimentet utføres. Denne tilnærmingen ble brukt til å etterligne konsekvenser for verten når bakterier eller bakteriell avledede produkter inn verten etter barriere brudd har oppstått. Dette kan være spesielt relevant i studier undersøke grunnlaget for IBD der forekomsten av en intestinal barriere brudd er en vanlig hendelse i patologi av sykdommen.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

JHN støttes av Swiss National Foundation (SNSF 310030_146290).

Materials

Name Company Catalog Number Comments
DreamTaq Green PCR Master Mix (2x) Thermo Fisher Scientific, Waltham, MA, USA K1081
High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA 4368813
RNase-Free DNase Set, Qiagen, Hilden, Germany 79254
LPS Escherichia coli O111:B4 Invivogen, San Diego, CA, USA. tlrl-eblps
Omnican 50 Single-use insulin syringe B. Braun Melsungen, Melsungen, Germany 9151125
Bioanalyzer 2100 Agilent Technologie, Santa Clara, USA not applicable
Centrifuge 5430 Eppendorf, Hamburg, Germany not applicable
Centrifuge Mikro 220R Hettich, Kirchlengern, Germany not applicable
Dissection tools Aesculap, Tuttlingen, Germany not applicable
Fast-Prep-24 5G Sample Preparation System M.P. Biomedicals, Santa Ana, CA, USA not applicable
NanoDrop ND-1000 NanoDrop Products, Wilmington, DE, USA not applicable
TRI Reagent Zymo Research, Irvine, CA, USA R2050-1

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Abreu, M. T., et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 123, 679-688 (2002).
  3. Liu, Y., et al. Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease. Gastroenterology. 108, 1396-1404 (1995).
  4. Schaffer, T., et al. Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans. Inflamm Bowel Dis. 13, 1339-1346 (2007).
  5. Sellon, R. K., et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 66, 5224-5231 (1998).
  6. Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. The gut microbiota in mouse models of inflammatory bowel disease. Front Cell Infect Microbiol. 4, 28 (2014).
  7. Schaubeck, M., et al. Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence. Gut. 65, 225-237 (2016).
  8. Steinert, A., et al. The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models. J Immunol. 199, 2570-2584 (2017).
  9. Gabele, E., et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH. J Hepatol. 55, 1391-1399 (2011).
  10. Saunders, S. P., et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol. 184, 2627-2637 (2010).
  11. Spadoni, I., et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science. 350, 830-834 (2015).
  12. Balmer, M. L., et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci Transl Med. 6, 237ra266 (2014).
  13. Maier, R. V., Mathison, J. C., Ulevitch, R. J. Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins. Prog Clin Biol Res. 62, 133-155 (1981).
  14. Lu, Y. C., Yeh, W. C., Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine. 42, 145-151 (2008).
  15. Deng, M., et al. Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis. J Immunol. 190, 5152-5160 (2013).
  16. Kagan, J. C., et al. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 9, 361-368 (2008).
  17. Akira, S., Uematsu, S., Takeuchi, O. Pathogen recognition and innate immunity. Cell. 124, 783-801 (2006).
  18. Cohen, J. The immunopathogenesis of sepsis. Nature. 420, 885-891 (2002).
  19. Suffredini, A. F., et al. Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration. J Immunol. 155, 5038-5045 (1995).
  20. Fink, M. P. Animal models of sepsis. Virulence. 5, 143-153 (2014).
  21. Poltorak, A., et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 282, 2085-2088 (1998).
  22. Hoshino, K., et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 162, 3749-3752 (1999).
  23. Corral, J., et al. Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models. Am J Pathol. 166, 1089-1098 (2005).
  24. Shrum, B., et al. A robust scoring system to evaluate sepsis severity in an animal model. BMC Res Notes. 7, 233 (2014).
  25. Brandwein, S. L., et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol. 159, 44-52 (1997).
  26. Macpherson, A. J., McCoy, K. D. Standardised animal models of host microbial mutualism. Mucosal Immunol. 8, 476-486 (2015).
  27. Masopust, D., Sivula, C. P., Jameson, S. C. Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology. J Immunol. 199, 383-388 (2017).
  28. Wirtz, S., et al. Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27. J Exp Med. 203, 1875-1881 (2006).

Erratum

Formal Correction: Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach
Posted by JoVE Editors on 08/04/2018. Citeable Link.

An erratum was issued for: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

One of the authors' names was corrected from:

Katarina Raduolovic

to:

Katarina Radulovic

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics