Injektionen von Lipopolysaccharid in Mäuse, Eingang des mikrobiellen gewonnenen Erzeugnisse nach Darmbarriere Verletzung zu imitieren

Immunology and Infection
 

ERRATUM NOTICE

Summary

Hier präsentiert sich ein Protokoll zum Eingang des bakteriellen abgeleitete Verbindungen nach Darmbarriere Verletzung zu imitieren. Eine niedrige subletale Dosis von Lipopolysaccharid injiziert wurde systemisch in Mäuse, die 24 h nach der Injektion beobachtet wurden. Der Ausdruck von Pro-inflammatorischen Zytokinen wurde zu verschiedenen Zeitpunkten in Milz, Leber und Darm bestimmt.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Die intestinale epitheliale Barriere trennt den Host von der Mikrobiota, die normalerweise toleriert oder ignoriert wird. Der Verstoß gegen diese Barriere führt im Eingangsbereich der Bakterien oder Bakterien gewonnenen Erzeugnisse in die Host-Zugriff auf die Host-Zirkulation und inneren Organe führt zu einer unkontrollierten Entzündung wie bei Patienten mit chronisch entzündlichen Darmerkrankungen (IBD) beobachtet, die zeichnen sich durch eine erhöhte intestinale epitheliale Durchlässigkeit.

Um den Eingang des bakteriellen abgeleitete Verbindungen in die Host-zu imitieren, ein endotoxämie Modell in welcher Lipopolysaccharid (LPS), eine Komponente der äußeren Zellwand von gramnegativen Bakterien übernommen wurde, wurden in Mäuse injiziert. In dieser Studie eine subletale Dosis von LPS intraperitoneal injiziert wurde und die Mäuse wurden anschließend für 8 h über eine Krankheit Punktzahl überwacht. Darüber hinaus der Ausdruck, den Ebenen von inflammatorischen Zytokinen Il6, Il1b, und Tnfa qPCR zu unterschiedlichen Zeitpunkten in der Milz, Leber und Darm analysiert wurden Posten LPS Injektion. Dieses Modell könnte für die Studien, die Untersuchung der Immunantwort nach der Invasion von Mikroorganismen oder Bakterien stammenden Produkte verursacht durch eine Barriere Verletzung von Körperoberfläche nützlich sein.

Introduction

Der menschliche Darm ist mit ein großes Konsortium von Mikroorganismen besiedelt, die die Mikrobiota bildet, die eine für beide Seiten vorteilhafte Beziehung mit dem Host während der Evolution entwickelt hat. In dieser Beziehung stellt der Host eine sichere Nische für die Mikrobiota, während die Mikrobiota liefert Vitamine, Nährstoffe Verdauung und Schutz vor Krankheitserregern, Host, wo die Mikrobiota1befindet. Wenn diese vorteilhafte Beziehung zwischen dem Host und dem Mikrobiota gestört ist, können Krankheiten entstehen, wie chronisch entzündliche Darmerkrankungen (IBD). IBD ist eine multifaktorielle chronisch-entzündliche Erkrankung des Darms verursacht durch genetische Faktoren und Umweltfaktoren, die in zwei Hauptformen, Morbus Crohn (CD) und Colitis ulcerosa (UC) auftreten. Trotz Ähnlichkeiten zwischen den beiden Formen der IBD zeichnen sie sich durch gewisse Unterschiede in der Lage und Art der entzündlichen Veränderungen. CD ist eine rezidivierende Transmural entzündliche Erkrankung, die potenziell zu, zu jedem Teil des Magen-Darm-Trakt, verlängern kann während UC nicht Transmural ist und ist auf den Dickdarm beschränkt. Darüber hinaus ist Mutationen im Nukleotid-Bindung Oligomerisierung Domäne-haltige Protein 2 (NOD2), einen Muster-Anerkennung-Rezeptor (PRR), die einer Dipeptid (MDP), eine Komponente der Zellwand der meisten gram-positiven und -negativen Bakterien, erkennt CD2zugeordnet. Darüber hinaus wurden Listerien und Streptokokken , Escherichia coli (E. Coli)und ihre Produkte Alle innerhalb von Makrophagen in Patienten mit Zervikaler gefunden, die den Host eingegeben haben, nachdem eine Barriere gegen3. Wenn Bakterien oder deren Produkte die Gastgeber bei der Entwicklung der CD eingeben, entwickelt das Immunsystem eine Reaktion führt zu die Produktion von zirkulierenden Antikörper Anti-bakterielle4. Vielleicht rührt der überzeugendste Beweis für die Rolle der Mikrobiota in der Pathogenese der IBD Mausmodellen. Wenn Tiere mit Antibiotika behandelt werden, oder wenn Mäuse in steriler (GF) gehalten werden, wird die Schwere der Erkrankung bei den meisten Modellen der Kolitis, wie IL-10-/-Mäusen reduziert, die nicht Kolitis in GF Einrichtungen5,6 entwickeln. Ulcerosa stört darüber hinaus auch die Zusammensetzung der Mikrobiota, zeichnet sich durch eine unausgewogene Zusammensetzung und reduzierte Reichtum Dysbiose7genannt. Die Folge der IBD kann eine erhöhte intestinale Permeabilität, die bis zum Eingang der Mikroben und mikrobielle gewonnenen Erzeugnisse in die Host-führen können.

Bei Tieren induziert die Anwendung von Dextran Natriumsulfat (DSS) eine intestinale epitheliale Verletzung führt zu einer erhöhten Durchlässigkeit der die epitheliale Barriere-8. Portal-LPS-Konzentrationen sind bei Tieren mit DSS ulcerosa9erhöht. Interessanterweise sind Tiere fehlt die C Typ Lektin-Rezeptor spezifischen intrazellulären Adhäsion Molekül-3 greifen Nonintegrin Homolog-bezogene 1 (Zeichen-R1) von DSS Kolitis und LPS-induzierte endotoxämie10geschützt. Weiter in die Host-zu verbreiten, müssen Bakterien und Bakterienprodukte abgeleitet die vaskuläre Barriere11, der Bauchhöhle, in dem die dünn- und Dickdarm befindet, die mesenterialen Lymphknoten und/oder der Leber12. Um die Komplexität dieses Systems zu verringern, wurde eine definierte bakterielle abgeleitete Verbindung verwendet. LPS, wodurch endotoxämie nach intraperitoneal (i.p.) oder intravenös (i.v.) Injektion13 in Mäuse, der Ausdruck der Interleukine Il6 und Ilb und Zytokin Tnfa als Reaktion auf LPS studieren injiziert wurde.

LPS ist ein Pathogen-assoziierte molekulare Muster (PAMP) ausgedrückt als Zellwand Bestandteil von Gram-negativen Bakterien, die aus Lipid A besteht (die wichtigsten PAMP in der Struktur der LPS), eine Core-Oligosaccharid und ein O Seite Kette14. Abgabe-wie Empfänger 4 (TLR4) zum Ausdruck gebracht durch Dendritische Zellen, Makrophagen und Epithelzellen erkennt LPS15, das Co-Rezeptoren für entsprechende Bindung erfordert. Die akute Phase Protein LPS-bindendes Protein (LBP) bindet LPS zu einem Komplex, der LPS mit dem Cluster der Differenzierung 14 (CD14), eine glycosylphosphatidylinositole verankert Membranprotein überträgt. CD14 weitere shuttles LPS auf Lymphozyten Antigen 96 oder auch bekannt als MD-2, die die extrazelluläre Domäne des TLR4 zugeordnet ist. Die Bindung des LPS an MD-2 erleichtert die Dimerisierung von TLR4/MD-2 induzieren Konformationsänderungen intrazellulären Adapter Moleküle Aktivieren der nachgeschalteten Signal Weg14, umfasst die primäre myeloische Differenzierung zu rekrutieren Antwort gen 88 (MyD88) - abhängigen Signalweg und die TIR-Domain-haltigen Adapter-induzierende Interferon-β (SIMPE) - abhängigen Weg16. Die Anerkennung der LPS von TLR4 dann die NF-κB-Signalweg aktiviert und induziert die Expression von proinflammatorischen Zytokinen, wie TNF, IL-6 und IL-1β17.

Insbesondere wenn LPS in Tiere, die Konzentration von LPS gegeben zu den Tieren injiziert ist der genetische Hintergrund des Tieres und der Ernährung zu berücksichtigen. Hohe Konzentrationen von LPS führt zu einem septischen Schock, Hypotonie und mehrere Orgel Ausfälle geprägt und schließlich zum Tod18. Mäuse sind unempfindlicher gegen LPS im Vergleich zu Menschen, wo LPS Konzentrationen zwischen 2-4 ng/kg Körpergewicht (BW) in der Lage, ein Cytokine Sturm19zu induzieren. Bei Mäusen, die letale Dosis (LD50), die Tod in der Hälfte der Mäuse reicht von 10-25 mg/kg BW20 abhängig von der Maus-Sorte verwendet induziert. Für die gängigen Mausstämme C57Bl/6 und BALB/c, ist die letale Dosis 50 % (LD50) 10 mg/kg kg. Im Gegensatz dazu sind die Stämme C3H/HeJ und C57BL/10ScCr von LPS induzierte endotoxämie, geschützt, die durch Mutationen im Tlr4-21. Infolgedessen sind Tlr4-defizienten Mäusen Hyporesponsive Injektionen mit LPS22. Anderen gentechnisch veränderten Mauslinien, z. B. PARP1/Mäuse23 sind resistent gegen LPS-induzierten toxischen Schock.

Die Maus-Modell beschrieben verwendet hier eine subletale Dosis von LPS systemisch verabreicht, um die Folgen der LPS Verbreitung nach einer Verletzung der Barriere von der Körperoberfläche zu imitieren. Die gewählte LPS-Konzentration (2 mg/kg kg) nicht Mortalität bei C56Bl/6-Mäusen, aber die induzierte Freisetzung von Pro-inflammatorischen Zytokinen induzieren.

Protocol

Mäuse wurden gezüchtet und gehalten unter spezifischen Pathogen-freies (SPF) in der Tierstation Abteilung Biomedizin, Universität Basel (Basel, Schweiz). Alle Maus-Experimente wurden in Übereinstimmung mit den Eidgenössischen und kantonalen Vorschriften (tierische Protokollnummer 2816 [Kanton Basel-Stadt]) durchgeführt.

1. Vorbereitung des LPS-Lösung

  1. Öffnen Sie den Bestand an LPS von Escherichia coli 0111:B4 unter sterilen Bedingungen gereinigt und rekonstruieren Sie es in Wasser, um die Konzentration von 5 mg/mL.
  2. Verdünnen Sie die LPS-Aktie mit sterilen Phosphat gepufferte Kochsalzlösung (PBS) zur Arbeit Konzentration von 0,2 µg/µL.

(2) intraperitoneale Injektion von LPS auf Mäuse

  1. Aspirieren Sie der LPS arbeiten Lösung in einer 0,5 mL Spritze mit einer 30 G-Nadel in eine laminare Luftströmung.
  2. Weibliche C57Bl/6 Mäusen (sechs bis 10 Wochen alt) wiegen und berechnen die Höhe der LPS, die injiziert werden: 10 µL (2 µg) / g Körpergewicht.
    Hinweis: zum Beispiel, wenn eine Maus 20 g und 20 g x 10 µL wiegt = 200 µL LPS Arbeitsanforderungen Lösung injiziert werden.
  3. Behandeln Sie die Maus zu, sanft, aber bestimmt und zurückhalten Sie das Tier in der einen Hand. Stellen Sie sicher, dass das Tier in der Lage ist, normal zu atmen, aber nicht zu drehen und wenden, während die Zurückhaltung.
  4. Kippen Sie die Maus Nase leicht auf den Boden, den Bauch Injektionslösung verfügbar zu machen. Suchen Sie nach der Mittellinie des Bauches und der Ort der Injektion in den niedrigen Bauch nach links oder rechts von der Mittellinie. Injizieren Sie i.p. PBS statt LPS in kontrollmäusen.
  5. Mit der freien Hand Spritzen das entsprechende Volumen (das Volumen berechnet im Schritt 2.2) der LPS Lösung arbeiten. Stellen Sie sicher, dass die Nadel der Bauchhöhle MIS Injektionen in die Bauchmuskel-Schicht können auftreten, da sonst eingetreten ist. Dennoch gehen Sie nicht zu tief mit der Nadel in die Bauchhöhle, nicht zu verletzen, innere Organe, die in diesem Bereich.
  6. Das Tier sorgfältig an den Käfig mit bis zu 5 Mäusen pro Käfig zurück.

3. überwachen Sie die Mäuse

  1. Überwachen Sie die Tiere zum Zeitpunkt der Einspritzung und alle 2 Std. nach der Injektion für 8 h für die Häufigkeit und schwere von endotoxämie. Verwenden Sie daher ein Notenblatt (Tabelle 1), die aus einer zuvor veröffentlichten Manuskript 24angepasst wurde.
  2. Punkten Sie die LPS injizierte Mäuse für die folgenden Parameter, die in Tabelle 1 aufgeführten
    1. Überprüfen Sie das Aussehen des Fells, die normalerweise glatt ist. Wenn das Fell zerzauste, stachelig oder aufgedunsen Fell der Beschwerden und/oder Schmerzen angibt erscheint, erzielen sie als 1, 2 oder 3.
    2. Überprüfen Sie die Aktivität der Maus.
      Hinweis: Mäuse normalerweise frei bewegen den ganzen Käfig, Essen, trinken, Klettern könnte, aber unterdrückt oder eingeschränkte Aktivität ein Zeichen für Schmerzen.
    3. Überprüfen Sie auf der Ebene des Bewusstseins.
      Hinweis: Mäuse sind sehr neugierig und normal bewegen sie den Käfig untersucht die Umgebung. Fehlende oder reduzierte Bewegung kann vorschlagen, Schmerzen und Beschwerden.
    4. Überprüfen Sie die Augen.
      Hinweis: Vollständig geöffnete Augen dürften bei gesunden Mäusen, aber ganz oder teilweise geschlossene Augen, eventuell mit Sekretion, können ein Hinweis auf Schmerzen sein.
    5. Überprüfen Sie die Atemfrequenz.
      Hinweis: Gesunde Mäuse haben in der Regel eine normale und schnelle Atemfrequenz, eine reduzierte Atemfrequenz könnte ein Hinweis auf Beschwerden).
    6. Überprüfen Sie die Qualität der Atmung.
      Hinweis: Erschwerte Atmung mit oder ohne nach Luft schnappen ist ein Zeichen des Schmerzes.

(4) Gewebe Sampling für Ribonukleinsäure (RNA) Extraktion und Homogenisierung

  1. Bereiten Sie die Sammlung/Homogenisierung Röhren: Fügen Sie 1 mL Einzelschritt RNA Isolierung Reagenz 2 mL Röhrchen vorausgefüllt mit 1,4 mm Keramik Kugeln.
  2. Zu den entsprechenden Zeitpunkten (vor (0 h) und 2 h, 4 h und 8 h nach LPS-Injektion) einschläfern die Maus mit Narkose Überdosierung (Isofluran) gefolgt von Entbluten und fahren Sie mit der Dissektion.
  3. Schneiden Sie die Haut und die Muskelschicht, die Freilegung der Bauchhöhle mit den inneren Organen mit der Schere.
  4. Sorgfältig sezieren Sie die Milz, Leber und Darm zu, reinigen Sie die Organe aus Fett und halten sie in PBS auf Eis.
  5. Schneiden Sie ein kleines Stück (ca. 0,5 cm lang) aus jedes Organ mit einer Schere oder Skalpell.
    Hinweis: Es ist wichtig, immer das Stück aus etwa der gleichen Teil des Organs in jeder Maus (gleiche Lappen der Leber, proximalen oder distalen Teil des Dickdarms).
  6. Kurz trocknen Sie das Gewebe auf einem Papiertuch und legen Sie sie in die Sammlung/Homogenisierung Rohr dafür sorgen, dass es komplett in RNA Isolierung Reagenz eingetaucht ist.
  7. Das Gewebe in eine High-Speed-Benchtop-Homogenisator zu homogenisieren. Für Weichteile wie Milz, Leber und Dickdarm 1 Zyklus der Homogenisierung mit Geschwindigkeit 6,00 für 30 s.
  8. Inkubieren Sie die Proben für 5 min bei Raumtemperatur.
  9. Legen Sie vorsichtig dem Schlauch in flüssigem Stickstoff Einfrieren Snap das Gewebe lysate. Speichern Sie die Snap lysate bei-80 ° C eingefroren, bis die RNA-Isolierung.

(5) RNA-Extraktion aus Gewebe

Hinweis: RNA Isolierung Reagenzien, Chloroform und Alkohol gelten als Gefahrgut. Durchführen Sie RNA-Extraktion unter einer chemischen Haube. Verwenden Sie zertifizierte RNase-freie Reagenzien und Geräte, um eine RNase-freie Umgebung beizubehalten.

  1. Phasentrennung
    1. Tauen Sie das gefrorene Gewebe lysate auf Eis.
    2. Zentrifugieren Sie die Probe auf 1.000 x g für 5 min bei 4 ° C, die übrigen Gewebe Partikel pellet, die gelassen werden könnte.
    3. Übertragen Sie den überstand auf eine neue Nuklease-freie 1,5 mL Tube.
    4. Fügen Sie 200 µL eiskalte Chloroform pro 1 mL RNA Isolierung Reagenz und schütteln Sie kräftig von Hand für 10-15 s.
    5. Ca. 2-3 min bei Raumtemperatur inkubieren.
    6. Zentrifuge an 12, 000 X g für 15 min bei 4 ° C.
      Hinweis: Die Probe enthält nun 3 Phasen: untere rote Phenol-Chloroform-Phase, die Interphase und der oberen farblosen wässrigen Phase. Die RNA ist in der oberen wässrigen Phase.
    7. Sammeln Sie die oberen wässrigen Phase (50 % des Gesamtvolumens) und den Transfer in eine neue Nuklease-freie 1,5 mL Tube.
  2. RNA-Niederschlag
    1. 0,5 mL eiskaltes Isopropanol pro 1 mL RNA Isolierung Reagenz und mischen Sie sanft durch das Rohr 5-6 mal umdrehen.
    2. 10-15 min bei Raumtemperatur inkubieren.
    3. Zentrifuge bei 12.000 x g für 10 min bei 4 ° C.
      Hinweis: RNA Pellet sollte zu diesem Zeitpunkt sichtbar sein.
  3. Waschen der RNA pellet
    1. Den Überstand mit dem Isopropanol ohne zu stören das Pellet vollständig zu entfernen.
    2. Waschen Sie die Pellets mit 1 mL eiskaltem 75 % Ethanol pro 1 mL RNA Isolierung Reagenz für die anfängliche Lyse verwendet.
    3. Wirbel der Probe kurz.
    4. Zentrifugieren Sie die Probe bei 7.500 (oder 12.000) X g für 5 min bei 4 ° C.
  4. Auflösen von RNA
    1. Vollständig zu entfernen das Ethanol im überstand ohne zu stören das Pellet.
    2. Lassen Sie den geöffneten Schlauch unter der chemischen Haube für 3-5 min das RNA-Pellet bei Raumtemperatur an der Luft trocknen (nicht übermäßig trocken wie in diesem Fall es wird schwierig, RNA aufzulösen).
    3. Lösen Sie die RNA-Pellets in 20-50 µL Nuklease-freies Wasser durch pipettieren vorsichtig rauf und runter.
    4. Inkubation der Probe bei 55 ° C für 10-15 min, die Lösung der RNA weiter zu verbessern.
      Hinweis: In diesem Stadium kann RNA bei-80 ° C bis weitere Analysen gespeichert werden.

(6) Verdauung der verbleibenden DNA

  1. Die RNA-Konzentration mit einem Spektralphotometer durch pipettieren eine Aliquote (2 µl) in die Spektralphotometer Messen und justieren der empfohlenen Konzentration.
  2. Starten Sie die Verdauung kontaminierender DNA mit Max. 10 µg RNA in 50 µL Nuklease-freies Wasser.
  3. Fügen Sie 0,1 Volumen von 10 x DNase I-Puffer und 1 µL rDNase ich pro Sample und Mischung sanft durch pipettieren rauf und runter.
  4. Inkubation bei 37 ° C für 20-30 Minuten.
  5. Vortex DNase Inaktivierung Reagenz und 0,1 Volumen der Probe mit der Pipette gut mischen.
  6. Inkubieren Sie für 5 min bei Raumtemperatur, die gelegentlich von Hand mischen.
  7. Bei 10.000 x g für 1,5 min zentrifugieren.
  8. Übertragen Sie den Überstand mit DNA-freie RNA in das neue Nuklease-freie Rohr.
  9. Messen Sie die RNA-Konzentration und Qualität von Spektralphotometer.

(7) reverse Transkription

  1. Verwenden Sie eine handelsübliches Desoxyribonukleinsäure cDNA reversen Transkription (RT) Kit für reverse Transkription.
    Hinweis: Hier können bis zu 2 µg RNA transkribiert rückgängig gemacht werden.
  2. Berechnen Sie das Volumen, das 2 µg RNA enthält. Pipette 2 µg RNA in einem neuen PCR-Röhrchen.
  3. Die Probe in der PCR-Röhre, um das endgültige Volumen von 10 µL Nuklease-freies Wasser hinzufügen.
  4. Bereiten Sie 2 X Master Mix durch Mischen der folgenden Komponenten in Tabelle 2 aufgeführten vor
  5. 10 µl RNA zu 1 x Master Mix im Gesamtvolumen von 20 µL fügen Sie 10 µL 2 x Master Mix hinzu.
  6. Schließen Sie kurz die Polymerase-Kettenreaktion (PCR) Rohr und Spin-down der Probe.
  7. Legen Sie die Proben in einer PCR-Thermocycler und legen Sie die Einstellungen, die in Tabelle 3aufgeführt.
  8. Speichern Sie die generierten cDNA bei-20 ° C zur weiteren Analyse.

(8) Quantitative PCR (qPCR)

  1. Führen Sie die qPCR-Reaktion mit einem kommerziell erhältlichen Kit.
  2. Selbst entwerfen Sie und testen Sie die Intron-spanning Primer vor der Verwendung mit verschiedenen Konzentrationen der Vorlage cDNA. Analysieren Sie die Wirksamkeit des Primers durch die Schaffung einer Standardkurve und verwenden Sie die Primer mit hoher Wirksamkeit und richtigen Schmelzpunkt Kurven.
    Hinweis: Die Sequenzen von Primern in diesem Experiment verwendet werden in Tabelle 2aufgeführt.
  3. Bereiten Sie die quantitative Polymerase Kettenreaktion (qPCR) Reaktion in den 384-Well-Platte mit dem Reaktion Setup beschrieben in Tabelle 4.
  4. Halten Sie alle Lösungen und die Platte auf Eis mit Aluminiumfolie zu verhindern, dass die Platte nass wenn das Reaktionsgemisch vorbereitet ist.
  5. Führen Sie alle Reaktionen in Triplicates.
  6. Durchführung der PCR-Reaktion auf ein Thermocycler mit der Einstellung, die in Tabelle 5aufgeführt.
  7. Berechnen Sie den Mittelwert Ct für alle Reaktionen von der Triplicates. Alle Zielgene, die Expression des Glycerinealdehyde-3-phosphat-Dehydrogenase zu normalisieren (Gapdh) Zimmermädchen gen durch die Berechnung von 2^(-ΔCt).
    Hinweis: Alle die Zielgene mit der durchschnittlichen Ct > 35 galten unter der Nachweisgrenze liegt.

Representative Results

Um die Folgen für den Host nach dem Eintritt von Bakterien oder bakterielle abgeleitete Produkte zu imitieren, die nach Darmbarriere Verletzung auftritt, LPS in C57Bl/6 Mäusen in subletalen Dosen (2 µg/g Körpergewicht) injiziert wurde. Jeder Mausklick wurde überwacht und erzielte für das Auftreten von endotoxämie mit Parametern im Notenblatt, das enthält, das Erscheinungsbild der Mäuse, die Aktivität der Tiere, den Zustand der Augen, die Atemfrequenz und die Qualität (Tabelle 1) aufgeführten . Die Tiere zeigten die klinischen Symptome der Krankheit, die ihren Höhepunkt 6 bis 10 Std. nach der Injektion von LPS und erholte sich innerhalb von 24 h (Abbildung 1). Individuelle Mäuse waren geopferten 2 h, 4 h und 8 h nach der Injektion von LPS. Gewebe-Stücke wurden von Milz, Leber und Darm gesammelt. RNA wurde von diesen Organen isoliert und rückwärts in cDNA umgeschrieben. Die cDNA wurde als Vorlage für qPCR verwendet, um den Ausdruck von Il6 (Abbildung 2A) Il1b (Abb. 2 b), TNFa (Abbildung 2) und Il10 (Abb. 2D) mit Primer für die qPCR verwendet ermitteln in Tabelle 6aufgeführt. Die Expression von Il6 erreichte 2 h nach Injektion in Milz und Doppelpunkt und 4 h nach der Injektion in der Leber. Der Ausdruck von Il1b, TNFa, und Il10 erreichte 4 h nach der Injektion in Milz, Leber und Darm. Innerhalb von 8 Stunden nach der Injektion kehrte der Ausdruck von Il6, Il1b, TNFa, und Il10 die Ausgangswerte.

Figure 1
Abbildung 1: LPS Injektion (2 µg/g Körpergewicht) induzierte klinische Zeichen einer endotoxämie in C57Bl/6mice. Nach Injektion von 2 µg/g Körpergewicht von LPS, individuelle Mäuse wurden überwacht, mit der Krankheit Punktzahl dargestellt in Tabelle 1, die das Aussehen und die Aktivität der Tiere enthält öffnen ihre Augen und ihre Atemfrequenz und Qualität alle 2 h für 12 h und 24 h nach achtern äh LPS Injektion. Die Krankheit Partitur (y-Achse) der jeweiligen Zeit (x-Achse) ausgelöscht wurde. Meine ± SD für 4-5 Mäuse pro jeden Zeitpunkt vorgestellt wird. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: LPS Injektion (2 µg/g Körpergewicht) induziert die Expression von Pro-inflammatorischen Zytokinen bei C57Bl/6 Mäusen. Mäuse wurden mit 2 µg/g Körpergewicht von LPS und der Ausdruck Il6 (A), Il1b (B)injiziert, Tnfa (C) und Il10 (D) analysiert wurden durch qPCR in Milz, Leber und Darm zur angegebenen Zeit Punkte nach der Injektion. Cytokine Ausdruck Ebenen wurden alle auf die Expression von Gapdhnormalisiert. Meine ± SD für 4-5 Mäuse pro jeden Zeitpunkt angezeigt wird. Bitte klicken Sie hier für eine größere Version dieser Figur.

Tabelle 1: Krankheit Notenblatt C57Bl/6 Mäusen nach LPS-Injektion zu überwachen. Parameter, die nach LPS beobachtet werden. Tiere wurden alle 2 h nach der Injektion für einen Zeitraum von 12 h überwacht und Noten erhielten für jeden einzelnen Parameter in der Tabelle aufgeführt. Das Endergebnis für jedes Tier steht für die Summe aller einzelnen Punkte. Dies ist von Referenz24angepasst. Bitte klicken Sie hier, um diese Datei herunterladen.

Betrag Reagenz
2 µL/Probe 10 x RT Buffer
0,8 µL/Probe 25 X Deoxynucleotide (dNTP) Mix (100 mM)
1 µL/Probe RT zufällige Primer
4.2 µL/Probe Nuklease-freies Wasser

Tabelle 2: Reagenzien verwendet, um den master-Mix für reverse Transkription vorzubereiten.

Temperatur Zeit
25 ° C 10 min
37 ° C 120 min
37 ° C 5 min
4 ° C halten

Tabelle 3: Thermocycler Einstellungen für reverse Transkription verwendet.

Betrag Reagenz
5 µL/well 2 x Master Mix
0,05 µL/well Referenz-Farbstoff
500 nM Finale/Brunnen Forward primer
500 nM Finale/Brunnen Reverse primer
zwischen 10 und 100 verwendeten ng/Well, wir 40 ng/well Vorlage cDNA in eine Vorlage Verdünnungspuffer verdünnt (1/100 Verdünnung dieses Puffers wurde in Nuklease-freies Wasser hergestellt und verwendet, um die Vorlage cDNA verdünnen). Verdünnen die Vorlage in diesem Puffer ermöglicht die Visualisierung der Brunnen wo Vorlage als die Reaktion Farbe ändert sich von blau zu grün hinzugefügt wurde
Nuklease-freies Wasser zu Endvolumen von 10 µL/well Nuklease-freies Wasser

Tabelle 4: Beschreibung der PCR-Reaktion.

Temperatur Zeit
95 ° C 2 min
95 ° C 5 s 40 Zyklen
60 ° C 20 s
95 ° C 15 s schmelzenden Kurve analaysis
60 ° C 1 min
95 ° C 15 s

Tabelle 5: Thermocycler Einstellungen für PCR verwendet.

Grundierung Sequenz Schmelztemperatur Produktlänge
Il6-F TCG GAG GCT TAA TTA CAC ATG TTC T 60.3 94 bp
Il6-R GCATCATCGTTGTTCATACAATCA 58,2
Il1b-F TGTGAAATGCCACCTTTTGA 56,1 94 bp
Il1b-R GTCAAAGGTTTGGAAGCAG 57,2
Il10-F ATCGATTTCTCCCCTGTGAA 56,2 108 bp
Il10-R TGTCAAATTCATTCATGGCCT 56,1
TNFA-F CCACCACGCTCTTCTGTCTAC 60,4 103 bp
TNFA-R AGGGTCTGGGCCATAGAACT 60
GAPDH-F CATCAAGAAGGTGGTGAAGC 56,7 199 bp
GAPDH-R CCTGTTGCTGTAGCCGTATT 58

Tabelle 6: Primer in der qPCR-Reaktion verwendet. Die Reihenfolge der Zündkapseln für qPCR verwendet, um die Maus Zytokine und Hauswirtschaft gen erkennen Gapdh.

Discussion

Dieses Protokoll imitiert immunologische Prozesse, die nach der Invasion durch mikrobielle gewonnenen Erzeugnissen auftreten. Wichtige Schritte im Rahmen des Protokolls sind die Auswahl der mauslinie, den Hygienestatus der Mäuse, die Dosis von LPS, die Überwachung der Tiere für das Auftreten von endotoxämie und der Zeitpunkt der Beendigung des Experiments. Am wichtigsten ist, ist der genetische Hintergrund der Maus Belastung zu berücksichtigen. Verschiedene Mausstämme haben unterschiedliche Anfälligkeit für LPS. Beispielsweise induzierte die C3H/HeJ und C57BL/10ScCr Mäuse sind resistent gegen LPS endotoxämie21,25. Darüber hinaus kann der Hygienestatus der Tiere endotoxämie in LPS beeinflussen. Spezifische-Pathogen-freies (SPF) Tiere werden am häufigsten verwendet. Diese Mäuse sind eine definierte Liste von Krankheitserregern befreit, aber die komplette Mikrobiota Zusammensetzung dieser Tiere ist nicht bekannt,26,27. Sterile keimfrei oder axenic Tiere (das kein Mikrobiota Hafen) unterscheiden sich von SPF Mäuse26. Wahrscheinlicher ist, kann die Besiedlung des axenic Tiere mit einem Mikroorganismus oder mit einem Konsortium von Mikroorganismen (gnotobiotischen Tieren) die Expression von Genen, wie IL-19, nach LPS-Injektion im Vergleich zu SPF Tiere8beeinflussen. Darüber hinaus wurde ein Notenblatt vermutet, dass als ein Notenblatt für eine Sepsis Modell induziert durch die fäkale Injektion in die Bauchhöhle24verwendet wurde. Diese Sheetcan mit dem lokalen Tierschutz-Ausschuss diskutiert werden und können an die jeweiligen Bedürfnisse angepasst werden. Insbesondere die Kriterien für die Kündigung muss mit dem lokalen Tierschutz-Ausschuss diskutiert werden. Dieses Experiment musste abgebrochen werden, wenn eine Partitur > 12 erreicht wird oder wenn die maximale Punktzahl für einen einzelnen Parameter erreicht ist. In diesem Experiment überschritten kein Tier aus acht Tieren eine Krankheit-Punktzahl von 12 nach Injektion von LPS (2 µg/g Körpergewicht). In dieser Studie werden die Ergebnisse zeigen die Expression von Zytokinen Il6, Il1b, TNFa und Il10 in der Leber, Milz und Darm nach Injektion von LPS präsentiert. Der Ausdruck von Il1b, TNFa und Il10 erreichte 4 h nach LPS-Injektion in Milz, Leber und Darm, in der Erwägung, dass Il6 Ausdruck 2 h nach der Injektion der LPS in Milz und Doppelpunkt und 4 h nach LPS-Injektion in die Leber ihren Höhepunkt. Innerhalb von 8 h der Ausdruck Il6kehrte Il1b, TNFa und Il10 Ausgangswert in Milz, Leber und Darm. Krankheitschwierigkeit erreichte ihren Höhepunkt zwischen 6 h und 10 h nach LPS-Injektion als Ausdruck von Il6, Il1b, TNFa und Il10 haben bereits wieder in die Ausgangswerte angibt, die erhöhte Expression von Il6, Il1b, TNFa und Il10 tritt rasch nach LPS-Injektion, aber, dass die Kinetik von anderen Genen ein anderes Muster nach LPS-Injektion zeigen kann. Der Ausdruck dieser Zytokine könnte auch auf die Protein-Spiegel im Blut der Tiere durch ELISA, analysiert werden neben qPCR angesehen werden kann, die.

Modifikationen und Fehlerbehebung der Technik sind in Fällen notwendig, wenn eine Krankheit Partitur > 12 erreicht ist. Daher muss die Dosis von LPS reduziert und besser angepasst an die verwendeten mauslinie und den örtlichen Gegebenheiten, vorzeitigen Beendigung des Experiments zu vermeiden. Die Manipulation von Genen durch Löschen einer bestimmten genomic Region oder ein Gen überexprimiert beeinflussen die Anfälligkeit von Mäusen für LPS. In Vorversuchen kann die Dosis von LPS, die passende Dosis zur Vermeidung von unnötigen Schaden und Tod für die Tiere in diesem Experiment titriert werden. Der Hinweis Kontamination von LPS mit anderen Bakterien stammenden Produkte und MIS Injektionen müssen vermieden werden. Darüber hinaus muss die Kinetik der Expression von Genen des Interesses nach LPS-Injektion bestimmt werden.

Einschränkungen sind, dass diese Technik über die Folgen der Verbreitung von mikrobiellen Produkten in die Host-nach einer Verletzung der Darmbarriere informiert aber nicht Informationen über Veranstaltungen, die führen geben Darmbarriere Verletzung und Ursachen die IBD auslösen. Natürlich, dieses Modell ist nicht Kolitis ulcerosa Vorbild DSS, aber es ist nützlich, neben Kolitis-Modellen, die Folge des Einganges des mikrobiellen Produkte in den Wirt zu studieren. Darüber hinaus stört die i.p.-Injektion von LPS der Bauchhöhle, in denen sich die kleinen und großen Darm befinden. Dies kann die Translokation von Darm abgeleitet Bakterienprodukte aus der Bauchhöhle in die Host-erleichtern.

Die Bedeutung dieses Modells ist die Tatsache, dass es eine definierte PAMP verwendet. In anderen Modellen einschließlich der i.p. Injektion der gesamten Bakterien, die i.p.-Injektion von fäkalen Lösungen24 oder die septische Peritonitis-Modelle, in denen Bauchfellentzündung wird durch cecal Verbindung und Punktion28, eine Vielzahl von Mikroben induziert oder ihre Produkte führt zu Krankheit. Darüber hinaus Injektion von LPS in Mäusen ist eine unkomplizierte Methode und erfordert keine Operation wie septische Peritonitis induziert durch cecal Verbindung und Punktion.

Weitere Anwendung dieses Modells sind Studien, die darauf abzielen zu untersuchen, endotoxämie oder LPS induzierte Blutvergiftung in jedem Kontexten zeichnet sich durch die Translokation von Bakterien-abgeleitete Produkte in den Host, z. B. Verletzung der Hautbarriere oder verletzt von der Urogenitaltraktes. Zusammenfassend handelt es sich um eine einfache Modell, das in jedem Laborumgebung verwendet werden kann. Je nach den örtlichen Gegebenheiten möglicherweise Anpassungen an die lokalen Bedürfnisse notwendig. Insbesondere hat das Notenblatt mit den lokalen Behörden diskutiert werden, bevor das Experiment durchgeführt wird. Dieser Ansatz wurde verwendet, um die Folgen für den Host zu imitieren, wenn Bakterien oder bakterielle gewonnenen Erzeugnisse den Host eingeben, nachdem eine Barriere-Verletzung vorliegt. Dies kann insbesondere in Studien, die die Grundlage der IBD, wo das Auftreten einer Verletzung der Darmbarriere ein häufiges Ereignis in der Pathologie der Krankheit ist, relevant sein.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

JHN wird durch den Schweizerischen Nationalfonds (SNF 310030_146290) unterstützt.

Materials

Name Company Catalog Number Comments
DreamTaq Green PCR Master Mix (2x) Thermo Fisher Scientific, Waltham, MA, USA K1081
High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA 4368813
RNase-Free DNase Set, Qiagen, Hilden, Germany 79254
LPS Escherichia coli O111:B4 Invivogen, San Diego, CA, USA. tlrl-eblps
Omnican 50 Single-use insulin syringe B. Braun Melsungen, Melsungen, Germany 9151125
Bioanalyzer 2100 Agilent Technologie, Santa Clara, USA not applicable
Centrifuge 5430 Eppendorf, Hamburg, Germany not applicable
Centrifuge Mikro 220R Hettich, Kirchlengern, Germany not applicable
Dissection tools Aesculap, Tuttlingen, Germany not applicable
Fast-Prep-24 5G Sample Preparation System M.P. Biomedicals, Santa Ana, CA, USA not applicable
NanoDrop ND-1000 NanoDrop Products, Wilmington, DE, USA not applicable
TRI Reagent Zymo Research, Irvine, CA, USA R2050-1

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Abreu, M. T., et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 123, 679-688 (2002).
  3. Liu, Y., et al. Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease. Gastroenterology. 108, 1396-1404 (1995).
  4. Schaffer, T., et al. Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans. Inflamm Bowel Dis. 13, 1339-1346 (2007).
  5. Sellon, R. K., et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 66, 5224-5231 (1998).
  6. Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. The gut microbiota in mouse models of inflammatory bowel disease. Front Cell Infect Microbiol. 4, 28 (2014).
  7. Schaubeck, M., et al. Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence. Gut. 65, 225-237 (2016).
  8. Steinert, A., et al. The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models. J Immunol. 199, 2570-2584 (2017).
  9. Gabele, E., et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH. J Hepatol. 55, 1391-1399 (2011).
  10. Saunders, S. P., et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol. 184, 2627-2637 (2010).
  11. Spadoni, I., et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science. 350, 830-834 (2015).
  12. Balmer, M. L., et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci Transl Med. 6, 237ra266 (2014).
  13. Maier, R. V., Mathison, J. C., Ulevitch, R. J. Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins. Prog Clin Biol Res. 62, 133-155 (1981).
  14. Lu, Y. C., Yeh, W. C., Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine. 42, 145-151 (2008).
  15. Deng, M., et al. Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis. J Immunol. 190, 5152-5160 (2013).
  16. Kagan, J. C., et al. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 9, 361-368 (2008).
  17. Akira, S., Uematsu, S., Takeuchi, O. Pathogen recognition and innate immunity. Cell. 124, 783-801 (2006).
  18. Cohen, J. The immunopathogenesis of sepsis. Nature. 420, 885-891 (2002).
  19. Suffredini, A. F., et al. Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration. J Immunol. 155, 5038-5045 (1995).
  20. Fink, M. P. Animal models of sepsis. Virulence. 5, 143-153 (2014).
  21. Poltorak, A., et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 282, 2085-2088 (1998).
  22. Hoshino, K., et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 162, 3749-3752 (1999).
  23. Corral, J., et al. Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models. Am J Pathol. 166, 1089-1098 (2005).
  24. Shrum, B., et al. A robust scoring system to evaluate sepsis severity in an animal model. BMC Res Notes. 7, 233 (2014).
  25. Brandwein, S. L., et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol. 159, 44-52 (1997).
  26. Macpherson, A. J., McCoy, K. D. Standardised animal models of host microbial mutualism. Mucosal Immunol. 8, 476-486 (2015).
  27. Masopust, D., Sivula, C. P., Jameson, S. C. Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology. J Immunol. 199, 383-388 (2017).
  28. Wirtz, S., et al. Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27. J Exp Med. 203, 1875-1881 (2006).

Erratum

Formal Correction: Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach
Posted by JoVE Editors on 08/04/2018. Citeable Link.

An erratum was issued for: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

One of the authors' names was corrected from:

Katarina Raduolovic

to:

Katarina Radulovic

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics