Intrakranielt Subarachnoidal ruten infeksjon for undersøker rollene Streptococcus suis biofilm i hjernehinnebetennelse i en mus infeksjon modell

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her beskriver vi intrakranielt subarachnoidal ruten infeksjon i mus å studere roller av biofilm i Streptococcus suis hjernehinnebetennelse. Denne infeksjon modellen passer også for å studere patogenesen av andre bakteriell meningitt og effekten av nye legemidler mot bakteriell hjernehinnebetennelse.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Zhang, S., Gao, X., Xiao, G., Lu, C., Yao, H., Fan, H., Wu, Z. Intracranial Subarachnoidal Route of Infection for Investigating Roles of Streptococcus suis Biofilms in Meningitis in a Mouse Infection Model. J. Vis. Exp. (137), e57658, doi:10.3791/57658 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Streptococcus suis er ikke bare en stor bakteriell patogen griser over hele verden, men også en voksende zoonotiske agent. Mennesker og griser er meningitt en større manifestasjon av S. suis infeksjoner. En egnet infeksjon modell er et viktig verktøy for å forstå mekanismene av sykdommer forårsaket av patogener. Flere ruter infeksjon i mus er utviklet for å studere patogenesen av S. suis infeksjon. Imidlertid er ruter som intraperitoneal, intranasal og intravenøs infeksjon ikke egnet for å studere roller av S. suis overflaten komponenter i hjernehinnebetennelse direkte i hjernen, som ekstracellulær matrix fra biofilm. Selv om intracisternal vaksinasjon er brukt for S. suis infeksjon, har presis injeksjonsstedet ikke blitt beskrevet. Her ble intrakranielt subarachnoidal ruten infeksjon beskrevet i en musemodell å undersøke rollene biofilm i S. suis hjernehinnebetennelse. S. suis planktoniske celler eller biofilm staten celler ble direkte injisert i subarachnoid rommet av musene gjennom injeksjonsstedet ligger 3,5 mm rostral fra bregma. Histopathological analyse og økt mRNA uttrykk for TLR2 og cytokiner av hjernevevet fra mus injisert med biofilm staten celler klart indikerte at S. suis biofilm spiller definitive roller i S. suis hjernehinnebetennelse. Denne ruten av infeksjon har åpenbare fordeler fremfor andre ruter på infeksjon, slik at studiet av vert-bakterie samhandlingen. Videre, det tillater effekten av bakteriell komponenter på verten immunreaksjoner direkte i hjernen til å bli vurdert, og etterligner bakteriell inngangen i sentralnervesystemet. Denne ruten av infeksjon kan utvides for å undersøke mekanismer av hjernehinnebetennelse skyldes andre bakterier. Dessuten, kan det også brukes til å teste effekten av legemidler mot bakteriell hjernehinnebetennelse.

Introduction

Streptococcus suis (S. suis) er en stor bakteriell patogen griser verdensomspennende, forårsaker alvorlige sykdommer, inkludert hjernehinnebetennelse, lungebetennelse, sepsis, endokarditt og leddgikt1. Det er også en nye zoonotiske agent. Så langt, har det blitt rapportert at ni serotyper kan forårsake infeksjon hos mennesker, inkludert serotyper 2, 4, 5, 9, 14, 16, 21, 24 og 312,3,4. Hos mennesker og griser er meningitt en av de store klinisk underskriver av S. suis infeksjoner. I Vietnam og Thailand er S. suis den viktigste årsaken til hjernehinnebetennelse i voksne5. Mikrobiell biofilm er mikroorganismer som følge hverandre og er konsentrert på et grensesnitt; de er avgjørende for bakteriell virulens, overlevelse i ulike miljøer og antibiotikaresistens5. Biofilm er vanligvis omgitt av en ekstracellulær matrix som vanligvis inneholder polysakkarider, proteiner og DNA6. Sistnevnte er kjøpedyktig framprovosere vert inflammatorisk svar og cytokin produksjon7. Biofilm formasjon er rapportert å være involvert i streptokokk hjernehinnebetennelse i tidligere studier. Biofilm bidrar til Streptococcus agalactiae hjernehinnebetennelse i en tilapia fisk modell og biofilm dannelsen har blitt avslørt i hjernen vev og rundt meningeal overflater i vivo til intra-abdominal inoculation8. Under hjernehinnebetennelse, Streptococcus pneumoniae er en biofilm-lignende tilstand og bakterier i slik en biofilm var mer effektive inducing hjernehinnebetennelse i en mus infeksjon modell9. I tillegg i våre tidligere studere biofilm staten tilknyttet S. suis i musen hjernen bidrar til bakteriell virulens med overlevelse analyse10. Men krever direkte bevis for biofilm engasjement i S. suis hjernehinnebetennelse videre etterforskning.

Dyr modeller av S. suis smitte har blitt utviklet i mus intraperitoneal (IP)11, intranasal (i.n.)12, intravenøs (IV)13og intracisternal (IC) rutene infeksjon14, 15 , 16. men IP, i.n. og IV rutene infeksjon er ikke egnet for å studere roller av S. suis overflaten komponenter i hjernehinnebetennelse direkte i hjernen. Disse inkluderer ekstracellulær matrix fra biofilm. Selv IC inoculation ble brukt for S. suis infeksjon, har presis injeksjonsstedet ikke blitt beskrevet i disse papirene. Derimot stereotaxic koordinatene til injeksjonsstedet for intrakranielt subarachnoidal vaksinasjon har klart blitt beskrevet i en tidligere studie17. Dette tillot lett anerkjennelse av vaksinering punktet og mer enkle eksperimentelle protokollen. I tillegg etterligner intrakranielt subarachnoidal ruten infeksjon bakteriell inngangen i sentralnervesystemet fra bihulene eller mellomøret17, og forholdet mellom mellomøret og hjernehinnebetennelse forårsaket av S. suis har blitt demonstrert av Madsen et al18. Videre bruker intrakranielt subarachnoidal ruten infeksjon i mus, har vi vist at S. suis liten RNA rss04 bidrar til hjernehinnebetennelse i våre tidligere studie10.

I denne studien, intrakranielt subarachnoidal ruten infeksjon ble brukt i mus for å undersøke rollene biofilm i S. suis hjernehinnebetennelse. Mus var infisert med planktoniske celler eller biofilm staten celler av S. suis av denne ruten av infeksjon. Histopathological analyse og økt mRNA uttrykk for TLR2 og cytokiner fra hjernevev mus injisert med biofilm staten celler klart indikerte at S. suis biofilm bidrar til hjernehinnebetennelse.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Musen infeksjon eksperimentene ble godkjent av den laboratorium dyr overvåking komité av Jiangsu Province, Kina og utført i laboratorium dyr senter av Nanjing Agricultural University (tillatelse nummer: SYXK (Su) 2017-0007).

1. forberedelse av bakterier

Merk: S. suis serotype 2 kraftig forstuing P1/7 ble isolert fra en syk gris med meningitt19. Belastning P1/7 ble dyrket i Todd-Hewitt kjøttkraft (THB, formel per liter THB: hjertet infusjonen 3.1 g, neopeptone, 20.0 g, druesukker, 2.0 g; natriumklorid, 2.0 g; disodium fosfat, 0.4 g, natriumkarbonat, 2.5 g) og belagt på Todd-Hewitt agar (THA, formel per liter THA: Hjertet infusjonen 3.1 g; neopeptone, 20.0 g; Dekstrose, 2.0 g; natriumklorid, 2.0 g; Disodium fosfat, 0.4 g; natriumkarbonat, 2.5 g; agar, 15,0 g) på 37 ° C og 5% CO2.

  1. Samling av belastning P1/7 planktoniske celler
    1. Samle 5 mL planktoniske celler fra midten av Logg fase kultur (OD600= 0,6), sentrifuge for 3 min 8000 × g og deretter vaske 3 ganger med PBS.
    2. Resuspend cellene med 5 mL av 25% glyserol i THB, aliquot i 5 rør, og deretter lagre på-80 ° C.
  2. Samling av belastning P1/7 biofilm staten celler
    1. Ta 20 mL av en overnatting kultur og legge til 180 mL av fersk THB; dele utvannet kulturen i 10 runde kultur plater, og deretter sette platene i en inkubator på 37 ° C i 5% CO2 24 h.
    2. Etter inkubasjon shake plate forsiktig å resuspend bakterier som ikke overholder platen, og deretter kaste nedbryting av aspirasjon.
      Merk: Riste platen forsiktig og unngå resuspending sediment.
    3. Legge til 5 mL av PBS høste biofilm staten celler, resuspend sediment helt og deretter overføre prøven til en ny tube.
    4. Sonicate biofilm staten cellene fra det siste trinnet med følgende parametere: 60 W, 4 sykluser, 5 s på og 10 s av.
    5. Sentrifuge for 3 min 8000 × g og lagre nedbryting på-80 ° C.
      Merk: Nedbryting kan inneholde biofilm komponenter og den kan brukes til å resuspend biofilm bakterier før infeksjon som beskrevet i dyreforsøk (trinn 3).
    6. Resuspend sediment med 10 mL 25% glyserol i THB og deretter lagre biofilm staten cellene på-80 ° C.

2. skanne elektronmikroskop (SEM) analyse

  1. Fikse de innsamlede biofilm staten cellene og planktoniske med 4% paraformaldehyde for 12-24 h på 4 ° C.
  2. Skyll prøvene raskt med destillert vann og tørke prøvene sekvensielt med en økende konsentrasjon av etanol (25%, 50%, 70%, 90% og 100%) i 30 min i hver løsning.
  3. Overholde tørket prøvene å metall holdere med dobbeltsidig tape og til slutt strøk dem i en fordamperen med gull og palladium.
  4. Observere prøvene av en scanning elektron mikroskop med følgende parametere: EHT (ekstra høy spenning) = 10 kV; WD (arbeidsavstand) = 7.0 eller 8.0 mm; Forstørrelse = 5000 ×; Signal A = SE1.

3. animal eksperimenter

  1. Bruke SPF 6 uke gamle kvinnelige BALB/c mus i denne studien. Infisere alle mus gjennom intrakranielt subarachnoidal ruten infeksjon som injeksjonsstedet er ligger 3,5 mm rostral fra bregma. Stereotaxic koordinatene til injeksjonsstedet ble klart beskrevet av Chiavolini et al17.
    1. For histopathological analyse, infisere to grupper av mus (5 mus per gruppe) planktoniske celler eller biofilm staten celler med ett dose av 3 × 107 colony-forming enheter (CFU), og en annen 5 musene ble injisert med PBS som en kontroll.
    2. For deteksjon av mRNA uttrykk for TLR2 og cytokiner i hjernen, infisere to flere grupper av mus (6 mus per gruppe) cellene planktoniske celler eller biofilm staten på en dose av 3 × 107 CFU.
    3. Bestemme antall levedyktig bakterier ved plating føljetong fortynninger på THA.
    4. Avlive alle mus på 12t etter infeksjon for videre forskning.
      Merk: Glyserol i lager mediet må fjernes før infeksjon. Både planktoniske cellene og biofilm staten utvinnes fra-80 ° C skylt 3 ganger med PBS. Så, planktoniske celler resuspended med PBS og utvannet til riktig dose for infeksjon; biofilm staten celler er resuspended med lagrede nedbryting (fra trinn 1.2.5) og fortynnet til riktig dose for infeksjon. Volumet for infeksjon bør ikke være mer enn 50 µL.
  2. Oppdage mRNA uttrykk for TLR2 og cytokiner i hjernevevet
    1. Pakk ut den totale RNA fra hjernevev bruker en RNA utvinning kit.
      1. For hver musen, kan du bruke hele hjernevev for utpakking RNA. Dele hele hjernevev i 5 rør. Ta til 100 mg hjernevevet og legge 1 mL av lysis løsning til hver rør som inneholder lysing matrix av settet.
      2. Behandle røret i en homogenizer for 40 s innstillingen er 6.0, og deretter sentrifuge røret på 12000 × g og 4 ° C for 5 min.
      3. Etter sentrifugering, overføre den øvre fasen til en ny microcentrifuge tube.
      4. Inkuber overførte utvalget for 5 min ved romtemperatur; legge til 300 µL av kloroform, vortex for 10 s, og deretter Inkuber i 5 minutter ved romtemperatur.
      5. Sentrifuge røret på 12000 × g og 4 ° C i 5 min. overføre den øvre fasen til en ny tube.
      6. Legger til 500 µL av kaldt absolutt etanol røret, før invertere den for 5 ganger, og deretter lagre prøven på-20 ° C i minst 1 time.
      7. Sentrifuge røret på 12000 × g og 4 ° C i 15 min og fjerne nedbryting. Vask pellets med 500 µL av kaldt 75% etanol i RNase-fri H2O.
      8. Fjern etanol, luft tørr pellet i 5 min i romtemperatur, og resuspend RNA i 100 µL RNase-fri H2O.
      9. Inkuber RNA i 5 minutter ved romtemperatur og bestemme RNA konsentrasjonen med en RNA-bioanalyzer.
    2. Utføre cDNA syntese, inkludert eliminering av genomisk DNA (gDNA), en thermocycler med en omvendt transkripsjon (RT) reagenssett.
      1. Tilsett 1 µg av et rør inneholder 2 µL 5 x gDNA eliminering bufferen, 1 µL av gDNA eliminering enzym og RNase-fri H2O til volumet når 10 µL. ruge i 2 minutter på 42 ° C.
      2. Legge til 10 µL av master mix (1 µL av RT enzym bland jeg, 1 µL av RT Primer, 4 µL av 5 x Buffer 2 og 4 µL av RNase-fri H2O) reaksjon løsningen fra sist trinn, og bland forsiktig. Fortsette umiddelbart RT reaksjonen: 37 ° C i 15 min og 85 ° C for 5 s.
      3. Utføre kvantitativ sanntid PCR (RT-qPCR) analyse med en Real-Time PCR-maskin med en SYBR RT-qPCR kit. Legg 10 µL av 2 x enzym, 0,8 µL av fremover primer, 0,8 µL av omvendt primer, 0.4 µL av 50 x ROX referanse fargestoff II, 2 µL cDNA mal og RNase-fri H2O til et totalvolum på 20 µL.
      4. Kjøre hvert utvalg i tre eksemplarer bruker følgende termisk parametere: 30 s på 94 ° C, etterfulgt av 40 sykluser av 5 s på 95 ° C og 34 s ved 60 ° C, med en sluttfasen av 15 s på 95 ° C, 1 min på 60 ° C , og 15 s på 95 ° C. Primere for RT-qPCR er oppført i tabell 1. Housekeeping gener B2m og 18s rRNA ble brukt som de interne kontrollene.
    3. Beregne relative fold endringen basert på metoden 2-ΔΔCt .
  3. Observasjon av histologiske deler
    1. Etter 24 timer fiksering med 10% formalin, rekonstruere fast hjernevev til passende størrelse vev stykker på 2-3 mm.
    2. Sett vev bitene i en innebygging kassett og dyppe i en ny etappe, den stabiliserende løsning for dehydrering med en automatisk vakuum dehydrator.
    3. Ta ut fast vev og tørke det sekvensielt i økende konsentrasjoner av etanol (70%, 80%, 95%, 95% og 100%) i 30 min i hver løsning.
    4. Transparentize prøven med xylen i 15 min, dyppe den i flytende parafin ved 60 ° C i 90 min, og bygg deretter inn ved hjelp av en innebygging maskin.
    5. Skivet parafin blokk innebygd vevet 3 µm flis sektoren på vann på 45 ° C og tørk den i luften.
    6. Inkuber delen for 3 h på 60 ° C, flekker det ved hjelp av haematoxylin og eosin (han) metoden og forsegle den med nøytral tannkjøtt.
    7. Observere histopathological endringene av hjernen med en optisk mikroskop. En fire-punkt gradering systemet ble brukt til å evaluere histologiske endringer. Bruk en kort t -test for statistisk analyse.
      Lunger/slag: fraværende, score 0; lite område av fokal lunger/blødning, score 1; stort område av fokal lunger/blødning eller flere områder av små fokal lunger/blødning, scorer 2; opptil tre store fokal lunger/blødning nettsteder, score 3; Diffus lunger/blødning, score 4.
      Nekrose: fraværende, score 0; fokal nekrose, score 1; Diffus forekomsten av 1-10 nekrotisk celler, scorer 2; fokus på confluent nekrose, score 3; omfattende confluent nekrose, score 4.
      Inflammatorisk celle infiltrasjon: fraværende, score 0; få og focal infiltrasjon, score 1; multifokal infiltrasjon eller infiltrasjon dannelsen av aggregater, score 2; opptil tre aggregat, score 3; og mer enn fire aggregat, score 4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

SEM-analyse ble gjennomført for å undersøke biofilm formasjon under eksperimentelle forhold. Som vist i figur 1, er det en betydelig forskjell i biofilm formasjonen planktoniske cellene (figur 1A) og biofilm tilstand (figur 1B). SEM analyse viste at biofilm bakterier var i klumper og flere lag, og de var innkapslet i den ekstracellulære matrisen, mens planktoniske bakterier var mye mindre tett og hovedsakelig spredt individuelt.

Komponentene i den ekstracellulære matrisen av biofilm, som DNA, kan framprovosere vert inflammatorisk svar og cytokin produksjon. Siden TLR2 og cytokiner CCL2, er IL-6 og TNF-α involvert i cerebral inflammatorisk svar knyttet til hjernehinnebetennelse ifølge tidligere studier10,11,20, mRNA uttrykk for disse genene ble sammenlignet i vivo for mus infisert med planktoniske celler og de infisert med biofilm staten celler. Dette ble gjort for å utforske effekten av biofilm på betennelsesreaksjon i murine hjernevev. Som vist i figur 2, på 12t etter infeksjon, uttrykk for TLR2, CCL2, IL-6, og TNF-α fra hjernen til infiserte mus var signifikant høyere for biofilm staten celler sammenlignet med planktoniske celler.

Mus infisert med biofilm bakterier viste mye mer alvorlige tegn til hjernehinnebetennelse (rigid holdning, ataksi eller kramper) enn de infisert med planktoniske bakterier. Histologiske undersøkelse av hjernevevet fra mus infisert med S. suis belastning P1/7 viste lunger/blødning og nekrose inflammatorisk celle infiltrasjon i meninges, hjernebarken, ventriklene eller diencephalon (Figur 3) . Sammenlignet med mus infisert med planktoniske bakterier (Figur 3Eh), på 12 h etter infeksjon, langt mer alvorlig patologiske forandringer ble observert i hjernevevet fra mus infisert med biofilm bakterier (Figur 3Ad), inkludert store områder av lunger/blødning, nekrose eller intens inflammatorisk celle infiltrasjon. De brutto patologiske forandringene i hjernen fra mus infisert med planktoniske og biofilm bakterier ble innspilt i tabell 2. Verken patologiske forandringer eller nevrologiske symptomer ble observert fra mus injisert med PBS. Sammen viser disse data klart at S. suis biofilm bidrar til induksjon av hjernehinnebetennelse.

Figure 1
Figur 1: SEM bilder av belastning P1/7 planktoniske cellene og biofilm staten. Bakterier ble kultivert THB medium. SEM analyse viste at planktoniske celler (A) var mye mindre tett og hovedsakelig spredt, mens biofilm bakterier (B) ble gruppert i klumper og flere lag, og de var innkapslet i den ekstracellulære matrisen. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: biofilm aktivere mRNA uttrykk for CCL2, IL-6, TNF-α og TLR2 i musen hjernevev i vivo. Seks BALB/c mus per gruppe ble hver injisert gjennom intrakranielt subarachnoidal ruten av infeksjon med 3 × 107 CFU planktoniske celleområde eller biofilm staten celler. Mus var euthanized på 12t etter infeksjon. Resultatene presenteres som fold endre mRNA uttrykk i biofilm tilstand celle-infiserte mus sammenlignet med planktoniske celle-infiserte mus. (A) genet B2m ble brukt som referanse genet; (B) gen 18s rRNA ble brukt som referanse genet. En kort t-test ble brukt for statistisk analyse. ** p ≤0.01, og * p ≤0.05. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: histologiske analyse av hjernevevet mus infisert med belastning P1/7 planktoniske bakterier og biofilm staten bakterier. A-D, hjernen prøver fra mus infisert med biofilm staten bakterier; Eh, hjernen prøver fra mus infisert med planktoniske bakterier. A, B, E, og F: meninges og hjernebarken; C og G: ventriklene; D og H: diencephalon. Δ, lunger/blødning; □, nekrose; ○: provoserende celle infiltrasjon. Forstørrelse = 200 X; skala bar = 100 µm. Klikk her for å se en større versjon av dette tallet.

Primer navn Sekvens (5 - 3') Gene symbol
IL-6 frem CTTCCATCCAGTTGCCTTCT Il6
IL-6 omvendt CTCCGACTTGTGAAGTGGTATAG Il6
TLR2 fremover CACTATCCGGAGGTTGCATATC Tlr2
TLR2 omvendt GGAAGACCTTGCTGTTCTCTAC Tlr2
CCL2 fremover CTCACCTGCTGCTACTCATTC Ccl2
CCL2 omvendt ACTACAGCTTCTTTGGGACAC Ccl2
TNF-α frem TTGTCTACTCCCAGGTTCTCT TNF
TNF-α omvendt GAGGTTGACTTTCTCCTGGTATG TNF
Β2m fremover GGTCTTTCTGGTGCTTGTCT B2m
Β2m omvendt TATGTTCGGCTTCCCATTCTC B2m
18s frem GTAACCCGTTGAACCCCATT 18s rRNA
18s omvendt CCATCCAATCGGTAGTAGCG 18s rRNA

Tabell 1: Primere for RT-qPCR.

Table 1
Tabell 2: brutto histopathological endringer i hjernen fra mus infisert med S. suis belastning P1/7. En fire-punkt gradering systemet ble brukt til å evaluere histologiske endringer, som beskrevet i delen 3.3.7-protokollen. Den endelige poengsummen ble beregnet som summen av score fra ulike histopathological endringer. Gjennomsnittet beregnet som resultat/antall mus. En kort t-test ble brukt for statistisk analyse. ** p ≤0.01.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Intrakranielt subarachnoidal ruten infeksjon beskrevet her har åpenbare fordeler fremfor andre ruter av infeksjon. Den lar etterforskere vert-bakterie samspillet og effekten av bakteriell komponenter på verten immunreaksjoner direkte i hjernen, som etterligner bakteriell inngangen i sentralnervesystemet. Denne ruten av infeksjon kan dermed utvides for å undersøke mekanismer av hjernehinnebetennelse skyldes andre bakterier. Dessuten, kan det også brukes til å teste effekten av legemidler mot bakteriell hjernehinnebetennelse.

For å oppnå gode resultater med denne modellen, er følgende kritisk. Biofilm formasjon må undersøkes under eksperimentelle forhold. I studien, ble det undersøkt scanning elektron mikroskop analyse. Andre metoder kan også brukes til å undersøke biofilm dannelsen, som vev kultur plate metoden og rør metoden21. En dag før infeksjon, må dele både planktoniske cellene og biofilm staten tines fra-80 ° C til å bestemme CFU. Neste dag, bør bakterier fortynnes til passende dose ifølge CFU for infeksjon. Uekte-infiserte kontrollgruppen injisert med PBS må inkluderes og mus fra uekte-infiserte kontrollgruppen bør viser ingen manifestasjoner i løpet av varigheten av forsøket infeksjon. Ulike stammer kan ha ulike smittsomme doser, så en foreløpig eksperiment anbefales sterkt å bestemme riktig smittsomme dosen. I studien, ble en dose av 3 × 107 CFU infisert brukt basert på våre foreløpige eksperiment. Denne dose av biofilm bakterier kunne forårsake alvorlige tegn meningitis og påfølgende død i alle 5 mus 48 timer etter smitte i innledende forsøket.

Avbrudd av blod-hjerne eller blod-cerebrospinal væsken barrierer av S. suis er et viktig skritt i å forårsake hjernehinnebetennelse22,23,24. Intrakranielt subarachnoidal ruten infeksjon er ikke egnet for å vurdere muligheten av S. suis å bryte gjennom disse barrierene. Andre ruter på infeksjon, som IP, IV eller i.n., kan brukes til å oppnå dette målet.

Her viser vi først at S. suis biofilm bidrar til induksjon av hjernehinnebetennelse bruker intrakranielt subarachnoidal ruten infeksjon. Denne infeksjon modellen ikke bare bidrar til å ytterligere for å forstå mekanismene av S. suis hjernehinnebetennelse, men er også egnet for å studere patogenesen av hjernehinnebetennelse forårsaket av andre bakterier og effekten av nye legemidler mot bakteriell hjernehinnebetennelse.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Dette arbeidet ble støttet av tilskudd fra nasjonale nøkkelen forskning og utvikling Program i Kina [2017YFD0500102]; National Natural Science grunnlaget for Kina [31572544]; Stat nøkkelen laboratoriet av veterinær paranoid biologi [SKLVEB2016KFKT005]; Shanghai landbruk brukt teknologi utvikling programmet, Kina [G2016060201].

Materials

Name Company Catalog Number Comments
Todd Hewitt Broth(THB) Becton, Dickinson and Company DF0492078 Dissolve 30 g of the powder in 1 L of purified water. Autoclave at 121° for 15 min.
Agar DSBIO 16C0050 Dissolve 15 g of the powder in 1 L of THB. Autoclave at 121° for 15 min.
Milli-Q Reference Water Purification System Merck KGaA Z00QSVCUS Without Dnase/ Rnase
NaCl Tianjin Kemiou Chemical Reagent Co., Ltd 10019318 Dissolve 8 g NaCl, 0.2 g KCl, 1.42 g Na2HPO3 , 0.27 g KH2PO4 in 1 L of purified water. Autoclave at 121° for 15 min. Use KOH to adjust pH to 7.4.
Na2HPO3 Xilong Scientific Co., Ltd 9009012-01-09 Dissolve 8 g NaCl, 0.2 g KCl, 1.42 g Na2HPO3 , 0.27 g KH2PO4 in 1 L of purified water. Autoclave at 121° for 15 min. Use KOH to adjust pH to 7.4.
KCl Xilong Scientific Co., Ltd 9009017-01-09 Dissolve 8 g NaCl, 0.2 g KCl, 1.42 g Na2HPO3 , 0.27 g KH2PO4 in 1 L of purified water. Autoclave at 121° for 15 min. Use KOH to adjust pH to 7.4.
KH2PO4 Xilong Scientific Co., Ltd 9009019-01-09 Dissolve 8 g NaCl, 0.2 g KCl, 1.42 g Na2HPO3 , 0.27 g KH2PO4 in 1 L of purified water. Autoclave at 121° for 15 min. Use KOH to adjust pH to 7.4.
KOH Xilong Scientific Co., Ltd 9009014-01-09 Dissolve 8 g NaCl, 0.2 g KCl, 1.42 g Na2HPO3 , 0.27 g KH2PO4 in 1 L of purified water. Autoclave at 121° for 15 min. Use KOH to adjust pH to 7.4.
Glycerol Sionpharm Chemical Reagent Co., Ltd 10010618 Diluted with equal volumu of purified water, autoclave at 121° for 15 min
4% paraformaldehyde Sionpharm Chemical Reagent Co., Ltd 80096675
25% Glutaraldehyde Sionpharm Chemical Reagent Co., Ltd 30092436 10-fold diluted with purified water for fixation.
Ethanol Sionpharm Chemical Reagent Co., Ltd 10009218
Chloroform Sionpharm Chemical Reagent Co., Ltd 10006818
Spctrophotometre DeNovix Inc. DS-11+
Ultrasound cell crusher NingBo Scientz Biotechnology Co.,Ltd JY96-IIN
Centrifuge Hitachi Koki Co., Ltd CT15RE
Refrigerator Aucma Co., Ltd DW-86L500
Scanning electron microscope Zeiss EVO-LS10
FastRNA Pro Green Kit MP Biomedicals #6045-050
FastPrep-24 Instrument MP Biomedicals 116005500
Instrument for PCR SensoQuest GmbH 1124310110
QuantStudio 6 Flex Thermo Fisher Scientific 4485689
SYBR Premix Ex Taq II Takara Biomedical Technology (Beijing) Co., Ltd RR820A
PrimeScript RT reagent kit with gDNA Eraser Takara Biomedical Technology (Beijing) Co., Ltd RR047A
Fully Enclosed Tissue Processor Leica Biosystems Nussloch GmbH ASP200S
Heated Paraffin Embedding Module Leica Biosystems Nussloch GmbH EG1150H
Semi-Automated Rotary Microtome Leica Biosystems Nussloch GmbH RM2245
Water bath for paraffin sections Leica Biosystems Nussloch GmbH HI1210
Autostainer XL Leica Biosystems Nussloch GmbH ST5010
Agilent 2100 Agilent Technologies G2939A
Optical microscope Olympus BX51

DOWNLOAD MATERIALS LIST

References

  1. Gottschalk, M., Xu, J., Calzas, C., Segura, M. Streptococcus suis: a new emerging or an old neglected zoonotic pathogen? Future Microbiology. 5, 371-391 (2010).
  2. Goyette-Desjardins, G., Auger, J. P., Xu, J., Segura, M., Gottschalk, M. Streptococcus suis, an important pig pathogen and emerging zoonotic agent-an update on the worldwide distribution based on serotyping and sequence typing. Emerging Microbes & Infections. 3, (6), e45 (2014).
  3. Kerdsin, A., et al. Emergence of Streptococcus suis serotype 9 infection in humans. Journal of Microbiology, Immunology and Infection. 50, (4), 545-546 (2017).
  4. Hatrongjit, R., et al. First human case report of sepsis due to infection with Streptococcus suis serotype 31 in Thailand. BMC Infect Diseases. 15, 392 (2015).
  5. Fittipaldi, N., Segura, M., Grenier, D., Gottschalk, M. Virulence factors involved in the pathogenesis of the infection caused by the swine pathogen and zoonotic agent Streptococcus suis. Future Microbiology. 7, (2), 259-279 (2012).
  6. Hall-Stoodley, L., Costerton, J. W., Stoodley, P. Bacterial biofilms: from the natural environment to infectious diseases. Nature Reviews Microbiology. 2, (2), 95-108 (2004).
  7. Fuxman Bass, J. I., et al. Extracellular DNA: a major proinflammatory component of Pseudomonas aeruginosa biofilms. Journal of Immunology. 184, (11), 6386-6395 (2010).
  8. Isiaku, A. I., et al. Biofilm is associated with chronic streptococcal meningoencephalitis in fish. Microbial Pathogenesis. 102, 59-68 (2017).
  9. Oggioni, M. R., et al. Switch from planktonic to sessile life: a major event in pneumococcal pathogenesis. Molecular Microbiology. 61, (5), 1196-1210 (2006).
  10. Xiao, G., et al. Streptococcus suis small RNA rss04 contributes to the induction of meningitis by regulating capsule synthesis and by inducing biofilm formation in a mouse infection model. Veterinary Microbiology. 199, 111-119 (2017).
  11. Dominguez-Punaro, M. C., et al. Streptococcus suis serotype 2, an important swine and human pathogen, induces strong systemic and cerebral inflammatory responses in a mouse model of infection. Journal of Immunology. 179, (3), 1842-1854 (2007).
  12. Seitz, M., et al. A novel intranasal mouse model for mucosal colonization by Streptococcus suis serotype 2. Journal of Medical Microbiology. 61, (Pt 9), 1311-1318 (2012).
  13. Busque, P., Higgins, R., Caya, F., Quessy, S. Immunization of pigs against Streptococcus suis serotype 2 infection using a live avirulent strain. Canadian Journal of Veterinary Research. 61, (4), 275-279 (1997).
  14. Williams, A. E., Blakemore, W. F. Pathology of Streptococcal meningitis following intravenous intracisternal and natural routes of infection. Neuropathology and Applied Neurobiology. 4, (4), 345-356 (1990).
  15. Dominguez-Punaro, M. C., et al. Severe cochlear inflammation and vestibular syndrome in an experimental model of Streptococcus suis infection in mice. European Journal of Clinical Microbiology & Infectious Diseases. 31, (9), 2391-2400 (2012).
  16. Auger, J. P., Fittipaldi, N., Benoit-Biancamano, M. O., Segura, M., Gottschalk, M. Virulence Studies of Different Sequence Types and Geographical Origins of Streptococcus suis Serotype 2 in a Mouse Model of Infection. Pathogens. 5, (3), (2016).
  17. Chiavolini, D., et al. Method for inducing experimental pneumococcal meningitis in outbred mice. BMC Microbiology. 4, 36 (2004).
  18. Madsen, L. W., Svensmark, B., Elvestad, K., Jensen, H. E. Otitis interna is a frequent sequela to Streptococcus suis meningitis in pigs. Veterinary Pathology. 38, (2), 190-195 (2001).
  19. Holden, M. T., et al. Rapid evolution of virulence and drug resistance in the emerging zoonotic pathogen Streptococcus suis. PLoS One. 4, (7), e6072 (2009).
  20. Dominguez-Punaro Mde, L., et al. In vitro characterization of the microglial inflammatory response to Streptococcus suis, an important emerging zoonotic agent of meningitis. Infection and Immunity. 78, (12), 5074-5085 (2010).
  21. Hassan, A., et al. Evaluation of different detection methods of biofilm formation in the clinical isolates. Brazilian Journal of Infectious Diseases. 15, (4), 305-311 (2011).
  22. Vanier, G., et al. New putative virulence factors of Streptococcus suis involved in invasion of porcine brain microvascular endothelial cells. Microbial Pathogenesis. 46, (1), 13-20 (2009).
  23. Takeuchi, D., et al. The contribution of suilysin to the pathogenesis of Streptococcus suis meningitis. Journal of Infectious Diseases. 209, (10), 1509-1519 (2014).
  24. Tenenbaum, T., et al. Polar bacterial invasion and translocation of Streptococcus suis across the blood-cerebrospinal fluid barrier in vitro. Cellular Microbiology. 11, (2), 323-336 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics