첫 번째 심장 필드 같은 심장 창시자와 같은 심 실 Cardiomyocytes 인간 만능 줄기 세포에서의 세대

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

여기 우리 Activin A와 overexpression-lentivirus 중재 Id1의 간단한 조합을 사용 하 여 첫 번째 심장 필드 같은 심장 창시자와 같은 심 실 cardiomyocytes 인간 만능 줄기 세포에서 생성 하는 확장 메서드를 설명 합니다.

Cite this Article

Copy Citation | Download Citations

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

많은 양의 기능 인간의 pluripotent 줄기 세포 파생 심장 창시자의 정의 심장 분야 원산지 cardiomyocytes 세대 셀 기반 심장 치료 및 질병 모델링에 대 한 필수입니다. 우리는 최근 Id 유전자는 필요 하 고 척추 개발 하는 동안 첫 번째 심장 필드 창시자 지정 하려면 충분 한 나타났습니다. 이 분화 프로토콜 이러한 연구 결과 활용 하 고 첫 번째 심장 필드 같은 (FHF-L) 창시자를 생산 하 강력한 지정 큐로 Activin A와 함께에서 Id1 overexpression를 사용 합니다. 중요 한 것은, 결과 창시자 효율적으로 심 실 같은 cardiomyocytes에 (~ 70-90%)를 구분합니다. 여기는 1) 생성 Id1 overexpressing hPSCs 2) 차별화 cryopreservable FHF L 창시자와 같은 심 실 cardiomyocytes의 확장 가능한 수량을 상세한 방법에 설명 합니다.

Introduction

인간 만능 줄기 세포 (hPSCs)의 대규모 생산-파생된 심장 창시자 및 cardiomyocytes는 줄기 세포 기반 요법1,2,3 와의 빠른 특성을 모델링 하는 질병에 대 한 필수 새로운 통로 규제 심장 차별화4,,56 과 생리학7,8. 비록 연구9,10,11,12,,1314의 번호,15 는 앞에서 설명한 고효율 심장 차별화 프로토콜 hPSCs에서, 아무도 중요 한 분자 차이 왼쪽의 식별도 결과 cardiomyocytes의 심장 필드 근원 해결 (첫 번째 심장 분야) 및 오른쪽 (두 번째 심장 분야) 심 실 cardiomyocytes16 과 심장 분야 특정 선 천 성 심장 질환;의 존재 즉, hypoplastic 좌 심 혼 증후군17 또는 arrhythmogenic 오른쪽 심 실 발육 이상18. 따라서, 심장 창시자의 생성 및 hPSCs에서 정의 된 심장 분야 원산지 cardiomyocytes 되고있다 치료로 그들의 관련성을 증가 하기 위하여 필요성 및 질병 모델링 도구.

이 프로토콜의 Id1, 최근 확인 된5 첫 번째 심장 필드 지정 큐 필요 하 고 충분 한 hPSCs에서 cardiogenesis를 시작 하는 Activin A와 함께에서 하는 제정 overexpression에 의존 합니다. 특히, 커닝 햄 외. (2017) 5 표시는 Id1 유도 창시자 구체적으로 표현 첫 심장 필드 (HCN4, TBX5) 하지만 하지 두 번째 심장 필드 마커 (SIX2, ISL1) 그들은 심장 차별화를 받 다. 또한, 저자는 또한 표시 유전자 변형 마우스 배아의 유전자 (i d 1-4), 전체 Id 가족 부족 첫 심장 필드 심장 창시자, 더 많은 중간과 뒷부분 심장 창시자 (동안 형성 없이 개발 두 번째 심장 필드) 아직도 그로 인하여 Id 단백질 필수적인 첫 번째 심장 필드 cardiogenesis에서 vivo에서시작 하는 제안, 형성할 수 있다. 편리 하 게, Id1 유도 창시자 cryopreserved 수 고 저절로 cardiomyocytes 표시 심 실 같은 특성을 포함 하 여 심 실 전용 마커 (IRX4, MYL2) 식으로 차별화 하 고 같은 심 실 활동 전위.

여기는 첫 번째 심장 필드 같은 (FHF-L) 심장 창시자와 같은 심 실 cardiomyocytes Id1 overexpressing hPSCs에서 생성 하는 간단 하 고 확장 가능한 방법에 설명 합니다. 이 프로토콜의 중요 한 특징은 편리한 cryopreservation 단계를 사용 하 여 후속 cardiomyocyte 생산에서 심장 조상 세대 연결을 푸십시오 가능성. 요약 하자면,이 프로토콜 (1) 생성 Id1 overexpressing hPSCs, (2) hPSCs에서 FHF L 심장 창시자를 생성, (3) cryopreserve 결과 창시자, 및 (4) 재개 FHF L 심장 조상 차별화에 필요한 단계를 자세히 설명 하 고 생성 매우 농축 (> 70-90%) 심 실 같은 cardiomyocytes 박동.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Id1 바이러스 준비 및 감염

  1. 공동 transfecting pCMVDR8.74, pMD2.G, 및 pCDH EF1 Id1 PGK PuroR Id1 overexpressing lentivirus 생성 (Addgene: 플라스 미드 #107735) HEK293T 세포로. 바이러스 성 입자를 수집 하 고, 여과 하 고, 상쾌한에서 정화 하 고 무라 에서-80 ° C에서 저장 (2003) 19. 또는 pCDH EF1 Id1 PGK PuroR lentivirus 생산 공급 업체에 전송 하 여 Id1 lentivirus를 상업적으로 생산.
    주의: lentiviral 안전 규정 및 표준 작동 프로토콜을 따르시기 바랍니다.
    참고: 중요 한: 최적의 바이러스 titer 적어도 10 이어야 한다8 10에9 Transducing 단위/mL (TU/mL).
  2. 이전에 감염, 코팅 시 약, 일반적으로 Engelbreth-Holm-떼 마우스 육 종 세포 ( 재료의 표참조)에 의해 분 비 젤라틴 단백질 혼합물의 50 µ l 96 잘 접시의 한 잘 코트.
  3. 6 잘 플레이트에서 PBS 캘리포니아2 + 그리고 마그네슘2 + 고 0.5 m EDTA의 1 mL을 추가 하 여 재배 하는 만능 줄기 세포의 한 잘 해리
    참고: 3-10 분에서 분리 시간 변화 한다. 세포의 80% 이상이 접시의 바닥에서 분리 됩니다, 다음 단계로 진행.
  4. 피펫으로 멸 균과 세포 현 탁 액 15 mL 플라스틱 원심 분리기 튜브에 수집 합니다.
  5. 분리 시 약 5 mL의 PBS 포함 된 캘리포니아2 + 그리고 마그네슘2 +와 중화.
  6. 원심 (200 x g 3 분) 하 여 펠 릿 세포.
  7. 상쾌한을 제거 하 고 부드럽게 펠 릿을 꺼내 위해 튜브를 터치.
  8. 다시 셀 줄기 세포 미디어의 1 ml에서를 일시 중단 합니다.
  9. 공급 업체 지침에 따라 자동된 셀 카운터를 사용 하 여 셀을 계산 합니다.
  10. 당 접시 20000 가능한 셀 줄기 세포 미디어 2 µ M로 / 바위 통로 억제제 보충의 50 µ L에서 잘 (96 잘 접시) 코팅 ( 표 1 및 2참조).
  11. 24 시간 후에 셀 첨부 파일에 대 한 모니터링 및 2 µ M로 / 바위 통로 억제제와 6 ng/mL hexadimethrine 브 로마 이드 보충 100 µ l 줄기 세포 미디어 미디어 바꿉니다 ( 표 1 2참조), lentiviral 감염 전에 한 h.
    참고: 셀 해야 단단히 장착할 접시의 바닥에.
  12. 얼음에 Id1 lentivirus 녹여
  13. 잘 당 정화 lentivirus의 3 µ L 추가 (바이러스 titer 10 사이 여야8 109 화/mL), 다음 셀 문화 인큐베이터 (37 ° C, 5% CO2, 20% O2)를 다시 접시를 전송.
  14. 24 시간 후 바이러스 성 감염, 감염된 세포에 신선한 줄기 세포 미디어의 100 µ L를 추가.
  15. 48 h 후 lentiviral 감염, 신선한 줄기 세포 미디어 1 µ g/mL puromycin 보충의 200 µ L 미디어를 포함 하는 대체 바이러스.
  16. 줄기 세포 미디어 1 µ g/mL puromycin 보충의 200 µ L 매일 미디어를 새로 고침 합니다.
  17. 문화 80 %confluency 도달, 해리 (96 잘 접시의 한 우물)에 대 한 캘리포니아2 + 그리고 마그네슘2 + + 0.5 m EDTA 없이 PBS의 200 µ L를 사용 하 여 셀.
  18. 원심 분리기 튜브에 세포 현 탁 액을 수집 합니다.
  19. 분리 시 약 5 mL의 PBS 포함 된 캘리포니아2 + 그리고 마그네슘2 +와 중화.
  20. 원심 (200 x g 3 분) 하 여 펠 릿 세포.
  21. 상쾌한을 제거 하 고 부드럽게 펠 릿을 꺼내 위해 튜브를 터치.
  22. 다시 셀 줄기 세포 미디어 2 µ M로 / 바위 통로 억제제 보충의 1 ml를 일시 중단 합니다.
  23. 모든 셀 (1 mL) 전송 12-잘 접시의 코팅.
  24. 24 시간 후 셀 줄기 세포 미디어의 1 mL와 잘 및 바꾸기 미디어 첨부 파일에 대 한 모니터는 6 ng/mL hexadimethrine 브 로마 이드, 변환 전에 한 h 2 µ M로 / 바위 통로 억제제와 보충.
  25. 얼음에 Id1 lentivirus 녹여
  26. 잘 (12-잘 접시) 당 정화 바이러스의 5 µ L를 추가 합니다.
  27. 24 시간 후 lentiviral 감염, 신선한 줄기 세포 미디어 3 µ g/mL puromycin 보충의 1 mL와 함께 미디어를 포함 하는 대체 바이러스.
  28. 48 h lentiviral 감염 게시, 신선한 줄기 세포 미디어 6 µ g/mL puromycin 보충의 1 mL와 함께 미디어를 포함 하는 바이러스를 대체.
  29. 문화 80 %confluency 도달, 해리 (12-잘 접시의 한 우물)에 대 한 PBS 캘리포니아2 + 그리고 마그네슘2 + 고 0.5 m EDTA의 500 µ L를 사용 하 여 셀.
  30. 절반을 전송 (250 µ L) 코팅 시 약의 한 잘에 세포 현 탁 액의 줄기 세포 미디어 2 µ M로 / 바위 통로 억제제 보충의 2 개 mL를 포함 하는 6 잘 플레이트 코팅.
  31. 다른 절반을 사용 (250 µ L) RNA 추출 및 qRT-PCR lentiviral 중재 Id1 식 레벨, Colas 로 결정 하기 위해 샘플의 (2012 년) 4.
    참고: 중요 한: Id1 mRNA 식 레벨 GAPDH 식 수준 (qRT-PCR 뇌관 표 3 참조)의 0.005 배 보다 낮은 경우, 반복 감염 과정 Id1 식 수준 초과 될 때까지 위에서 설명한 대로 임계값입니다.

2입니다. hPSCsId1 유지 보수

  1. 코팅된 6 잘 플레이트에 hPSCsId1 문화와 줄기 세포 미디어 6 µ g/mL puromycin 보충의 당 3 mL에서 성장.
  2. HPSCsId1 80 %confluency 도달, 효소 없는 분리 시 약 공급 업체의 지침을 사용 하 여 집계 (1:6 분할 비율)로 셀을 통과 하 고 줄기 세포 미디어 6 µ g/mL puromycin 보충의 당 3 mL에 성장 한다.

3. 차별화 hPSCsi d 1 의 준비

  1. 코트 코팅 시 약의 당 500 µ L와 12-잘 접시.
  2. Id1 도달 90% confluency hPSCs 1 mL의 PBS 캘리포니아2 + 그리고 마그네슘2 + 고 잘 당 0.5 m m EDTA 추가 하 여 세포를 분리 하는 경우 5-10 분에 대 한 분리 과정 1 분 마다 확인 하 고 세포의 80%는 접시에서 해리는 한 번 다음 단계를 수행 하십시오.
  3. 원심 분리기 튜브에 세포 현 탁 액을 수집 합니다.
  4. 분리 시 약 5 mL의 PBS 포함 된 캘리포니아2 + 그리고 마그네슘2 +와 중화.
  5. 원심 (200 x g 3 분) 하 여 펠 릿 세포.
  6. 상쾌한을 제거 하 고 부드럽게 펠 릿을 꺼내 위해 튜브를 터치.
  7. 다시 셀 줄기 세포 미디어 2 µ M로 / 바위 통로 억제제 보충의 2 개 mL를 일시 중단 합니다.
  8. 자동된 셀 카운터를 사용 하 여 셀을 계산 합니다.
  9. 줄기 세포 미디어 조직 문화 인큐베이터에 2 µ M로 / 바위 통로 억제제 및 6 µ g/mL puromycin, 전송 접시 보충의 1 mL에 잘 당 300000 플레이트 세포.
  10. 줄기 세포 미디어 문화 90 %confluency 도달할 때까지 6 µ g/mL puromycin 보충의 2 mL와 함께 매일 미디어를 새로 고침 합니다. 이 시점에서 심장 차별화를 시작 (다음 단계).

4. 첫 번째 심장 필드 같은 심장 창시자 (FHF L CPs)에 hPSCsi d 1 의 차별화

  1. 12 잘 플레이트 형식에 대 한 유도 미디어 (표 1)의 1.5 mL와 함께 줄기 세포 미디어를 대체 하 여 시작 차별화 (0 일) 보충 Activin를 (100 ng/mL) (참조 표 2 에 대 한 권장 볼륨 및 Activin A에 대 한 농도 다른 플레이트 형식)입니다.
  2. 하루에 1 (차별화 시작 후 24 h), 미디어를 (당 12-잘 접시의 우물) Activin A 없이 유도 미디어의 2 mL 바꿉니다.
  3. 3 일에 2 mL (당 12-잘 접시의 우물) Activin A 없이 유도 미디어의 미디어를 바꿉니다.
  4. 당일 5, FHF L CPs cryopreservation 수집 (다음 단계).
    참고: 중요 한: Cryopreservation는 선호이 시점에서, 그것은 연결을 푸십시오 셀의 후속 cardiomyocyte 생산과 biobank 대규모 배치에서 심장 조상 세대 수 있습니다. 참고 또는 그 날 5 FHF L CPs 차별화 계속, 단계 5.1-5.5 passFHF L CPs 참조 하십시오 다음 단계 6.5 차별화 진행을 갓 코팅된 판에 전달 될 수 있습니다.

5입니다. cryopreservation FHF L CPs의

  1. 5 일을 포함 하는 우물에서 모든 미디어를 발음 FHF L CPs 신속 하 게 따뜻한 (37 ° C) 1 x 분리 시 약 포함 하는 효소의 1 mL을 추가 ( 재료의 표참조). 조직 문화 인큐베이터에 접시를 놓습니다.
  2. 1 분 후 접시를 인큐베이터에서 좌우로 흔들어.
  3. 2 분 (전체 시간), 후 인큐베이터에서 플레이트를 제거 하 고 10 %FBS 미디어의 1 mL를 추가 합니다.
  4. 부드럽게 피펫으로 세포를 위아래로 5 mL 피펫으로 접시에서 셀 분리를 촉진 하기 위하여와.
  5. 3 분 x g 200에서 원심 분리 하 여 원심 분리기 튜브와 펠 릿 세포에 세포 현 탁 액을 수집
  6. 다시 cryopreservation 시 약의 2 mL에 셀 펠 릿을 일시 중단 합니다.
  7. 자동된 셀 카운터를 사용 하 여 셀을 계산 합니다.
  8. 추가 cryopreservation 시 약 ( 재료의 표참조) 원하는 농도 (일반적으로 5-10 × 106 셀/mL)에서 세포를 cryopreserve에 충분 한 볼륨에.
  9. Cryopreservation 튜브 셀 전송 냉각 장치 (1 ° C/min)에 튜브를 배치 하 고 냉각 장치-80 ° C 냉장고에서 밤새 껏 두기 위하여.
  10. 24 시간 후 장기 저장을 위한 액체 질소 냉동된 튜브 전송.
    참고: 프로토콜 수 수 일시 중지 여기.

6. 심 실 같은 Cardiomyocytes에 FHF L CP 차별화

  1. 드라이 아이스 용기에 액체 질소 저장에서 하루 5 FHF L CPs 냉동 튜브를 전송.
  2. 세포 현 탁 액은 완전히 해 동 때까지 2 ~ 3 분 동안 37 ° C 물 목욕에 튜브를 배치 합니다.
    참고: 중요 한: 녹고 과정은 시간에 민감한. 과도 한 양의 시간에 대 한 셀 cryopreservation 미디어 노출 (즉, 10 분) 세포 생존 능력을 감소 것입니다.
  3. 15 또는 50 mL 원심 분리기 튜브, 해 동된 튜브의 수에 따라 셀 전송.
  4. Dropwise (5 방울 30 초 마다) 미리 데워 진된 (37 ° C) cardiogenic 미디어 (표 1) 셀 솔루션을 분배. 1:3 cryopreservation 미디어까지이 과정을 계속: cardiogenic 미디어 비율에 도달. 이 시점에서, 1시 10분까지 cardiogenic 미디어 추가 속도 증가 cryopreservation 미디어: cardiogenic 미디어 비율에 도달.
    참고: 중요 한: 빠른 osmolarity 변경 과정에서 녹고; 세포 죽음을 증가할 것 이다 따라서, cardiogenic 미디어의 dropwise 또한 위에서 설명한 대로 좋습니다.
  5. 원심 (200 x g 3 분)에 의해 세포 현 탁 액 및 펠 릿 세포를 원심.
  6. 상쾌한을 제거 하 고 부드럽게 터치 하는 원심 분리기 튜브 셀 펠 릿을 꺼내.
  7. 다시 2 µ M로 / 바위 통로 억제제 보충 하는 cardiogenic 미디어와 셀을 일시 중단 합니다.
    참고: 셀 생존 thaw 해 동에서 하 고, 일반적으로 다를 수 있습니다, 그리고 > 65% 생존 예측 좋은 도금 효율.
  8. 도금에 대 한 원하는 셀 농도를 2 µ M로 / 바위 통로 억제제 보충 하는 cardiogenic 미디어와 희석 집중 세포 현 탁 액 (다른 판 형식에 대 한 표 2 참조).
    참고: 중요 한: 주의 심장 분화 효율 셀 너무 띄엄띄엄 시드 경우 거부할 수 있습니다.
  9. 접시에 시드 셀입니다.
  10. 조직 문화 인큐베이터에 그것을 전송 하기 전에 20 분 동안 조직 문화 후드에서 플레이트를 유지.
  11. 차별화의 날 6, 셀 첨부 파일을 모니터링 합니다.
    참고: 심장 창시자는 차별화의 5 일에 cryopreserved는. 셀을 녹고 후 24 h는 차별화의 6 일에는 것입니다.
    참고: 부동 (죽은) 세포의 존재를 일반적입니다.
  12. 7 일에는 미디어의 50%를 발음 하 고 신선한 cardiogenic 미디어의 동일한 금액으로 바꿉니다.
    참고: cardiogenic 미디어 로/바위 통로 억제제의 추가 필요 하지 않습니다이 시점 이후.
  13. 매일 cardiogenic 미디어와 미디어의 50%를 교체 합니다.
  14. 참고를 꺾고 자발적인 11 일과 13 일 사이 나타납니다.
  15. 15 일에 DAPI (핵 얼룩) 및 ACTC1를 사용 하 여 면역 형광에 의해 심장 분화 효율을 계량 (팬 심장 마커).

7. 합격 및 심 실 같은 Cardiomyocytes의 유지 보수

참고: 하루 14 ~ 16, 자발적으로 심 실 같은 cardiomyocytes 계약의 단층 해야 얻을 수 있습니다. 이 시점에서, 그것은 해리 하 고 다시 접시 cardiomyocytes 문화를 균질 하 고 셀 접시에서 분리 하는 것을 방지 하기 위해 좋습니다.

  1. 우물에서 모든 미디어를 발음 하 고 신속 하 게 미리 따뜻하게 (37 ° C) 1 분리 시 약 포함 하는 효소의 1 mL를 추가 합니다.
    참고: 포함 하는 효소 분리 시 볼륨 x 1 플레이트 형식에 따라 다르지만 완전히 잘 표면의 바닥을 커버 해야 합니다.
  2. 조직 문화 인큐베이터에 접시를 전송 합니다.
  3. 부드럽게 흔들 플레이트 좌우로 분리 프로세스를 가속 화 하기 위해 인큐베이터 안에 매 2 분.
  4. 5-15 분 후 세포의 80% ~ 100%는 접시의 바닥에서 분리 때 인큐베이터에서 접시를 제거 하 고 10 %FBS 미디어의 동일한 볼륨을 추가 하 여 포함 하는 효소 분리 시 약 활동 x 1을 억제.
    참고:이 프로세스에 대 한 1 x 효소 포함 된 분리 된 보육 시간 일괄 처리를 일괄 처리에서 달라질 수 있습니다.
  5. 원심 분리기 튜브에 세포 현 탁 액을 수집 합니다.
  6. 피펫으로 및 count 셀 자동된 셀 카운터를 사용 하 여 세포 현 탁 액을 혼합.
  7. 원하는 셀 농도에 세포 현 탁 액 희석 (다른 판 형식에 대 한 표 2 참조) 유지 보수 미디어 2 µ M로 / 바위 통로 억제제 보충.
  8. Cardiomyocytes 접시에 시드, 후 균등 하 게 셀 하 고 세포 조직 문화 인큐베이터에 접시를 전송 하기 전에 10-20 분에 대 한 연결을 허용 합니다.
  9. 다시 도금 후 h 24 모니터링 셀 첨부 파일 및 복구 합니다.
    참고: 부동 (죽은) 세포의 존재를 일반적입니다. 다시 도금 후 48-72 h, cardiomyocyte 자발적 수축을 재개 한다.
  10. Cardiomyocyte 문화를 유지 하려면 대체 미디어의 50% 유지 보수 미디어와 함께 매일 같은 심 실 cardiomyocytes의 사용까지 후속 실험에 대 한.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

HPSCs의 생성 I d 1 라인
hPSCs 중재 Id1 overexpression (그림 1A) lentivirus 감염 됩니다. HPSCId1 생성 됩니다 일단 transgene 식 qRT-PCR (그림 1B)에 의해 정량입니다. 그 GAPDH 0.005 배 보다 높은 레벨에서 Id1 mRNA 표현으로 하는 hPSCId1 선만 차별화 사용 되어야 한다.

hPSCs I d 1 유지 보수 및 D에 대 한 준비 ifferentiation
최적의 문화 조건이 필요 하 고 중요 한 성공적인 첫 필드 같은 심장 조상 차별화 (그림 2A) 심장. hPSCId1 문화 줄기 형태 유지 관리 및 지속적인 확산에 대 한 매일 모니터링 해야 합니다. 단단히 포장된 줄기 세포 식민지를 도달할 때 차별화를 시작 합니다 > 90 %confluency (그림 2B). 차별화가 시작 되는 최적의 confluency 이전 세포 죽음은 향상 하 고 분화 효율 (그림 2C)를 거부할 수 있습니다. 마찬가지로, 자란된 문화 제대로 (그림 2D)를 수행 합니다.

첫 번째 심장 필드 같은 심장 창시자 (FHF L CPs)에서 세대 hPSCs I d 1
하루에 1 (24 h 게시물 차별화 개시), 셀 (셀 표시 아첨 하 고 줄기 세포 보다 어두운) 줄기 형태학의 손실을 관찰 하 모니터링 해야 합니다. 세포 죽음은 차별화, 첫날 있지만 셀 합류에 유지 한다 > 75% (그림 2E). 차별화의 24 h 후 대상된 면적의 50% 이상 손실 된 경우 셀을 폐기 해야한다.

3 일에 차별화 셀 클러스터 된 있어야 하 고 초기 24 시간 기간 (그림 2F) 동안 만든 격차를 가득. 독립적으로 성장 하는 플랫 셀 차선 분화 조건을 나타내는 있습니다.

하루에 4, 최적의 차별화는 지속적인 확장과 접시의 범위를 표시 합니다.

5 일에 세포는 수확 하 고 cryopreserved. 최적의 차별점 균질 형태학 모양 (그림 2G)와 밀접 하 게 연결 된 셀 클러스터 발생 한다. 참고 플랫 셀의 낮은 밀도 클러스터 차선 차별화 결과 표시 합니다. 다양 한 잘 당 5 심장 창시자 문화 형식 하루의 평균 수익률 표 2 를 참조 하십시오.

FHF L CPs에서 심 실 같은 Cardiomyocytes의 세대
하루 5 FHF L CPs는 플레이트 형식 종속 밀도 그들의 심장 감 별 법 잠재력을 극대화 하기 표 2에 설명 된 (그림 3A 표 2)에서 해 동. 녹고 후 생존 모니터링할 필요가 있다. 일반적으로, 생존 범위는 70-80%에서. 생존 능력 60%가 하 있는 경우에, cardiomyocytes의 수익률 영향을 받을 것 이다.

날 6 (24 h 차별화를 다시 시작한 후), FHF L CPs 커버 한다 > 90%의 사용 가능한 면적 및 셀 (그림 3B)의 유형이 같은 단일 레이어로 나타납니다. 6 일에 낮은 합류 cardiomyocytes에 FHF L CPs 차별화를 줄일 것입니다.

결과 cardiomyocytes 하루 11-13 (그림 3C영화 1) 차별화의 려 시작 합니다. 하루 14-16 replating 프로세스 동안 다양 한 문화 형식에 잘 당 cardiomyocytes의 평균 수확량에 대 한 표 2 를 참조 하십시오. 분화 효율은 일반적으로 핵 (DAPI) 마커 및 혈관 내 피 마커 (CDH5), 섬유 (TAGLN), 심장 (ACTC1)에 대 한 면역 형광에 의해 평가 됩니다. 리니지 정량화 자동된 이미징 및 형광 정량화, 커닝 햄 에서 사용 하 여 수행 됩니다. (2017) 5 (그림 3D-E). 결과 cardiomyocytes의 하위 특성 qRT-PCR (그림 3F) 및 활동 전위 과도 분석 운동 이미징 및 전압 감지 프로브 (그림 3G 및 영화 2)를 사용 하 여 의해 수행 됩니다. 전압 프로브 및 결과 활동 전위 추적 분석 (그림 3H)에 대 한 형광 정량화는 McKeithan 에 설명 된 대로 수행 (2017) 7.

Figure 1
그림 1: hPSC의Id1 라인. (A) hPSCsId1 세대 프로토콜의 도식 적인 표현입니다. QRT-PCR 결과 hPSCId1 한 hESC 라인 등의 뚜렷한 선과 hPSC 라인의 두 줄에서 중재 lentiviral 표현식에 의해 생성 하는 대표적인 Id1 mRNA 레벨을 보여주는 (B) 예. 파선은 Id1 식 임계값을, 어떤 hPSCId1 아래 라인 Id1 lentivirus 감염의 추가 사이클을 받이 필요가 나타냅니다. "p" 통행 수를 나타냅니다. 괄호에 번호 Id1 lentiviral 감염의 라운드의 수를 나타냅니다. 오차 막대는 3 중에서 수행 하는 실험의 표준 편차를 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 세대의 첫 번째 심장 Field-Like 심장 창시자 (FHF L CPs) 차별화에서 hPSCId1. (A) FHF L CP 세대 프로토콜의 도식 대표. HPSC 최적 (B),Id1 (0 일)의 대표적인 밝은 필드 사진 하위 합칠 (노란색 화살표 표시 셀 사이의 빈 영역) (C) 와 오버 합칠 (D) 밀도. 하루에 1, hPSCId1 차별화의 대표적인 밝은 필드 사진 3과 5를 각각 (E), (F), (G). 눈금 막대 = 100 µ m. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: 심 실 같은 Cardiomyocyte FHF L CPs에서의 세대. (A) 심 실 같은 cardiomyocyte 세대 프로토콜의 도식 적인 표현입니다. (B) (1 일 후 녹고) 하루 6 분화 세포의 밝은 필드 이미지. 하루 12 잔 문화 (C) 밝은 필드 이미지. 하루 15 문화 (384-잘 플레이트 형식)의 (D) 대표적인 면역 형광 이미지. ACTC1 표시 cardiomyocytes, TAGLN: 섬유 아 세포/부드러운 근육, CDH5: 혈관 내 피 세포와 DAPI: 핵 (는 삽입 참조). (E) 하루 15 문화의 계보 정량화. ((F)) qRT-PCR 데이터 시간 코스 식 5 일에서 하루 25 심 실 전용 마커 (IRX4MYL2) 및 팬 심장 마커 (MYL7)입니다. 차별화의 하루에 25 실의 같은 cardiomyocytes에서 (G) 대표 활동 전위 추적입니다. (H) 활동 전위 기간 (APD50 및 APD90)의 측정 결과 심 실 같은 cardiomyocytes (n = 12). 오차 막대 (별도로 지정 되지 않은 경우) quadruplicate에서 수행 하는 실험의 표준 편차를 나타냅니다. 바 규모 = 100 µ m. RFU, 상대 형광 단위. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

매체 기본 매체 첨가제
줄기 세포 미디어 mTesR1 n/a
유도 미디어 RPMI 1640 매체 인슐린 없이 B-27 혈 청 무료 보충, 1 x
유도 미디어 RPMI 1640 매체 Puromycin, 6 µ g/ml
유도 미디어 RPMI 1640 매체 페니실린-스, 1 x
Cardiogenic 미디어 RPMI 1640 매체 B-27 혈 청 무료 보충, 1 x
Cardiogenic 미디어 RPMI 1640 매체 페니실린-스, 1 x
미디어 유지 관리 RPMI 1640 매체 B-27 혈 청 무료 보충, 1 x
미디어 유지 관리 RPMI 1640 매체 녹아웃 혈 청 교체, 2%
미디어 유지 관리 RPMI 1640 매체 페니실린-스, 1 x

표 1: 미디어 구성 요소 (기본 미디어 및 첨가제 재료의 표 참조).

384 잘 96 잘 12 잘 6 잘 100 m m 150 mm
(잘) 당 코팅 볼륨 10 Μ L 50 Μ L 500 Μ L 1 mL 5 mL 10 mL
중간 볼륨
(잘) 당
100 Μ L 300 Μ L 2 mL 5 mL 12 mL 30 mL
차별화 0 activin 농도 (ng/mL) 100 100 100 300
심장 시 조
제 5 일 수익률
(셀/잘)
1.0-1.2 10 x5 2.5-3.0 10 x5 1.0-1.5 10 x7 2.0-3.0 10 x7
심장 조상 하루 5 replating 또는 밀도 (셀/잘) 녹고 2.0 x 104 7.5 x 105 4.5 x 106 8.0 x 106 2.2 x 107
심 같은 cardiomyocyte
14-16 일 수익률
(셀/잘)
2.0-5.0 10 x4 0.8-1.2 x 106 3.5-5.0 x 106 0.8-1.2 x 107 1.8-2.5 10 x7
심 같은 cardiomyocyte 밀도 replating
(셀/잘)
2.5 x 104 1.0 x 106 4.5 x 106 1.0 x 107 2.2 x 107

표 2: 확장 가능한 차별화 매개 변수 (코팅 볼륨, 중간 볼륨, Activin A 농도, 밀도 replating 수확량).

유전자 이름 유전자 은행 가입 시퀀스
GAPDH NM_001256799 F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
마우스 Id1 NM_010495 F: CCTAGCTGTTCGCTGAAGGC
R: CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 F: GGCTCCCCAGTTCTTGATGG
R: TAGACCGGGCAGTAGACCG
MYL2 NM_000432 F: TTGGGCGAGTGAACGTGAAAA
R: CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 F: GCCCAACGTGGTTCTTCCAA
R: CTCCTCCTCTGGGACACTC

표 3: qRT-PCR 뇌관 시퀀스입니다.

Movie 1
영화 1: 밝은 필드 녹음 (100 프레임/s) 하루 15 cardiomyocytes 자발적 수축을 관찰할 수 있다. 이 비디오를 보려면 여기 클릭 하십시오 (다운로드 오른쪽 클릭.)

Movie 2
영화 2: 하루 25 id1 유발 심 실 같은 cardiomyocytes에 전압에 민감한 형광 프로브의 운동 영상 (100 프레임/s). 이 비디오를 보려면 여기 클릭 하십시오 (다운로드 오른쪽 클릭.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

성공적인 차별점에 대 한 밀접 하 게 지침에 따라 위에 나열 된 확인 합니다. 또한, 여기 우리가 강력 하 게 차별화 결과 영향을 주는 주요 매개 변수 강조 표시 합니다. 감 별 법을 시작 하기 전에 다음 세 개의 매개 변수 형태를 관찰 해야 합니다: hPSCsId1, 높은 세포 압축 및 높은 합류의 줄기 형태 (> 90%) 0에서 문화. 그런 측면에서 최적의 차별화 조건 단일 세포로 도금 해리 hPSCsi d 1 에 의해 만들어집니다 가장 하 고 형태를 밀접 하 게 그들을 수 있도록 클러스터 성장 monolayers ~ 90% 합류 2 ~ 3 일의 과정. 반대로, hPSCId1 문화 쇼 가난한 셀 및 식민지 형태학, 낮은 식민지 압축 및 문화 내에서 차별화의 큰 분야의 존재, 성공적인 FHF L CP 차별화 가능성이 되지 않습니다.

미디어 볼륨 및 Activin A 농도 FHF L CP 차별화 및 플레이트 형식 의존 ( 표 2참조)의 중요 한 매개 변수가 있습니다. 또한 최적의 Activin A 농도에 따라 다를 수 있습니다 점에 유의 hPSC 라인을 사용 하 고 농도 최적화를 해야 할 수도 있습니다.

HPSCs에 Id1 mRNA 수준은입니다 효율적으로 홍보 FHF L CP. 차선 Id1 수준 강력한 FHF L CP 차별화를 생산 실패 하 고 차별화의 1 하루에 의해 대규모 세포 죽음 관찰 될 것 이다 중요 한. -투-GAPDH Id1의 상대 식 비 효율적인 분화를 촉진 하는 0.005를 초과 해야 한다. Puromycin (6-10 µ g/mL)의 높은 복용량을 사용 하 여 지속적인된 선택 lentiviral 중재 Id1 식의 높은 레벨을 유지 하려면 것이 좋습니다. Id1 mRNA 수준 평가 10 구절 마다 것이 좋습니다.

5 일의 밀도 도금 FHF L CPsis 또한 심장 분화 효율에 대 한 중요 한 매개 변수. 경우 하루 5 FHF L CPs는 낮은 밀도에서 도금, 상대 심장 수율 저하 됩니다. 최적의 도금 밀도 표 2 에 나열 되며 플레이트 형식에 따라 다릅니다.

이 프로토콜에 대 한 주요 제한 결과 창시자와 같은 심 실 cardiomyocytes의 치료 사용을 제한할 수 있습니다 promoteFHF L CP 차별화에 Id1 overexpression lentiviral 중재의 사용 이다. 또한, 때문에 lentiviruses 사이트에 통합할 수 있습니다 그 수 잠재적으로 영향 hPSC 유지 보수 및 개발 잠재력, stemnessId1 식민지 hPSCs의 모니터링 해야 평가 하 여 줄기 유전자 발현 및 형태학 징후 관찰 감 별 법입니다. 참고는이 제한을 극복 하는 것 하 고는 현재 저희 연구실에서 조사 되 고 비 통합 벡터를 사용 하 여 Id1 overexpressing.

이 방법의 한 편리한 기능만 한 cytokine, Activin A, FHF L CPs hPSCsi d 1에서 생성 하 요구 하는 때 분화 프로토콜의 단순입니다. 비교에서는, 다른 프로토콜 9,10,11,12,13,,1415 cytokines의 조합의 복잡 한 시퀀스 요구 및/또는 홍보 하 고 심장 차별화를 유지 하기 위해 작은 분자. 또한,이 프로토콜 고유 하 게 연결을 푸십시오 FHF L CP 세대 후속 cardiomyocyte 생산에서을 가능 하 게 편리한 cryopreservation 단계를 설명 합니다. 이 기능을 biobank 큰 일괄 처리를 사용 하면 하루 5 녹고 시에서 심장 차별화로 다시 FHF L CPs의와 신속 하 게 생성 cardiomyocytes 냉동된 창시자에서. 이 전략 hPSCs에서 심장 차별화를 시작 하는 것에 비해 시간 2 주 1을 얻을 수 있습니다. 또한, 그리고 가장 중요 한 것은,이 프로토콜은 다른 프로토콜9,,1011,12 동안 정의 된 심장 필드 출신의 심장 창시자를 생성 하는 날짜에 첫 번째 프로토콜 ,13,,1415 남아 그런 측면에서 정의 되지 않은.

요약,이 프로토콜을 대량 생산 하는 강력 하 고 확장 가능한 방법 설명 (> 108– 109) 발달 관련 FHF L CPs 및 심 실 같은 cardiomyocytes. 차례로 결과 세포 심장 차별화 및 생리학, 소설 규정 경로 식별 하기 위해 사용할 수 있습니다에 대 한 재생 및 질병 모델링 목적.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgments

우리는 유용한 토론 Colas 실험실의 구성원 및 원고의 중요 한 리뷰 감사합니다. 이 연구는 NIH/NIEHS R44ES023521-02에 의해 지원 되었다 고 CIRM DISC2-10110 박사 Colas를 부여 합니다.

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics