हृदय Progenitors और वेंट्रिकुलर की तरह पहले दिल क्षेत्र की पीढ़ी-मानव Pluripotent स्टेम कोशिकाओं से Cardiomyocytes की तरह

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

यहाँ हम एक स्केलेबल विधि का वर्णन, Activin के एक सरल संयोजन का उपयोग कर एक और lentivirus-मध्यस्थता Id1-व्यक्त, पहले हृदय क्षेत्र उत्पन्न करने के लिए-जैसे कार्डियक progenitors और वेंट्रिकुलर-cardiomyocytes की तरह मानव pluripotent स्टेम कोशिकाओं से.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

कार्यात्मक मानव pluripotent स्टेम कोशिकाओं की बड़ी मात्रा की पीढ़ी-प्राप्त हृदय progenitors और परिभाषित दिल क्षेत्र मूल के cardiomyocytes एक पूर्व सेल के लिए अपेक्षित हृदय चिकित्सा और रोग मॉडलिंग आधारित है । हम हाल ही में पता चला है कि आईडी जीन दोनों आवश्यक है और हड्डीवाला विकास के दौरान पहली दिल क्षेत्र progenitors निर्दिष्ट पर्याप्त है । इस भेदभाव प्रोटोकॉल इन निष्कर्षों leverages और Activin के साथ संयोजन में Id1 का उपयोग करता है एक के रूप में शक्तिशाली cues निर्दिष्ट करने के लिए पहले दिल क्षेत्र की तरह उत्पादन (FHF-L) progenitors । महत्वपूर्ण बात, जिसके परिणामस्वरूप progenitors कुशलतापूर्वक अंतर (~ 70 – 90%) in वेंट्रिकुलर-like cardiomyocytes । यहाँ हम एक विस्तृत विधि का वर्णन करने के लिए 1) उत्पन्न Id1-एक्सप्रेस hPSCs और 2) cryopreservable FHF-L progenitors और वेंट्रिकुलर-जैसे cardiomyocytes की स्केलेबल मात्रा में अंतर.

Introduction

मानव pluripotent स्टेम सेल (hPSCs) के बड़े पैमाने पर उत्पादन-व्युत्पंन कार्डियक progenitors और cardiomyocytes एक पूर्व स्टेम कोशिका के लिए अपेक्षित चिकित्सा आधारित है1, रोग मॉडलिंग2,3 और तेजी के लक्षण वर्णन उपंयास हृदय विभेद को विनियमित रास्ते4,5,6 और फिजियोलॉजी7,8। हालांकि अध्ययन के एक नंबर9,10,11,12,13,14,15 पहले अत्यधिक कुशल बताया गया है hPSCs से हृदय भेदभाव प्रोटोकॉल, कोई नहीं जिसके परिणामस्वरूप cardiomyocytes के दिल क्षेत्र मूल को संबोधित किया है, के बीच महत्वपूर्ण आणविक मतभेदों की पहचान के बावजूद छोड़ दिया (पहले दिल क्षेत्र) और सही (दूसरा दिल क्षेत्र) वेंट्रिकुलर cardiomyocytes16 और हृदय क्षेत्र-विशिष्ट जन्मजात हृदय रोगों के अस्तित्व; यानी, hypoplastic लेफ्ट हार्ट सिंड्रोम17 या arrhythmogenic राइट वेंट्रिकुलर dysplasia18. इस प्रकार, हृदय progenitors और hPSCs से परिभाषित हृदय क्षेत्र मूल के cardiomyocytes की पीढ़ी के लिए चिकित्सीय और रोग मॉडलिंग उपकरण के रूप में उनकी प्रासंगिकता को बढ़ाने के लिए एक आवश्यकता होती जा रही है ।

इस प्रोटोकॉल Id1, एक हाल ही में पहचान की5 पहले दिल क्षेत्र के गठन पर निर्भर करता है-क्यू निर्दिष्ट है कि Activin के साथ संयोजन में, दोनों आवश्यक है और hPSCs में cardiogenesis आरंभ करने के लिए पर्याप्त है । विशेष रूप से, Cunningham एट अल । (२०१७) 5 दिखाएं कि Id1 प्रेरित progenitors विशेष रूप से व्यक्त पहले दिल क्षेत्र (HCN4, TBX5) लेकिन नहीं दूसरा दिल क्षेत्र मार्करों (SIX2, ISL1) के रूप में वे हृदय भेदभाव से गुजरना । इसके अलावा, लेखकों को भी पता चलता है कि ट्रांसजेनिक माउस के जीन की पूरी आईडी परिवार की कमी भ्रूण (Id1-4), पहले दिल क्षेत्र कार्डिएक progenitors बनाने के बिना विकसित, जबकि अधिक औसत दर्जे का और पीछे कार्डियक progenitors ( दूसरा दिल क्षेत्र) अभी भी फार्म कर सकते हैं, जिससे कि आईडी प्रोटीन vivo मेंपहली दिल क्षेत्र cardiogenesis आरंभ करने के लिए आवश्यक है सुझाव । आसानी से, Id1 प्रेरित progenitors cryopreserved जा सकता है और अनायास वेंट्रिकुलर-विशिष्ट मार्करों (वेंट्रिकुलर, IRX4) अभिव्यक्ति शामिल है और cardiomyocytes की तरह विशेषताओं को प्रदर्शित करने में अंतर, और वेंट्रिकुलर की तरह कार्रवाई क्षमता ।

यहां हम एक सरल और स्केलेबल विधि का वर्णन करने के लिए पहले दिल क्षेत्र की तरह उत्पंन (FHF-एल) कार्डिएक progenitors और वेंट्रिकुलर-Id1 से cardiomyocytes की तरह hPSCs व्यक्त । इस प्रोटोकॉल की एक महत्वपूर्ण विशेषता एक सुविधाजनक cryopreservation कदम का उपयोग कर बाद cardiomyocyte उत्पादन से कार्डियक जनक पीढ़ी को जोड़े करने की संभावना है । संक्षेप में, इस प्रोटोकॉल विवरण के लिए आवश्यक कदम (1) उत्पंन Id1-एक्सप्रेस hPSCs, (2) उत्पंन FHF-L कार्डिएक progenitors से hPSCs, (3) cryopreserve परिणामस्वरूप progenitors, और (4) फिर से शुरू FHF-l कार्डिएक जनक विभेद और उत्पंन अत्यधिक समृद्ध (> 70-90%) वेंट्रिकुलर की तरह cardiomyocytes की धड़कन ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Id1 वायरस तैयारी और संक्रमण

  1. सह-transfecting pcmvdr 8.74, pMD2. जी, और pCDH-EF1-Id1-PGK-PuroR (Addgene: प्लाज्मिड #107735) द्वारा HEK293T कोशिकाओं में Id1 व्यक्त lentivirus उत्पन्न करते हैं. वायरल कणों लीजिए, छानने का supernatant से शुद्ध, और Kitamura एट अल में के रूप में-८० डिग्री सेल्सियस पर दुकान । (२००३) 19. वैकल्पिक रूप से, एक Id1-उत्पादक विक्रेता को pCDH-EF1-PGK-PuroR-lentivirus को भेजकर व्यावसायिक रूप से Id1 lentivirus का उत्पादन करना ।
    चेतावनी: कृपया lentiviral सुरक्षा नियमों और मानक आपरेशन प्रोटोकॉल का पालन करें ।
    नोट: महत्वपूर्ण: इष्टतम वायरस titer 108 से 109 Transducing इकाइयों/एमएल (टू/एमएल) होना चाहिए ।
  2. संक्रमण से पहले, कोट कोटिंग रिएजेंट के ५० µ एल के साथ एक ९६ अच्छी तरह से थाली के एक अच्छी तरह से, आमतौर पर एक चिपचिपा प्रोटीन Engelbreth-होल्म-झुंड माउस सार्कोमा कोशिकाओं द्वारा स्रावित मिश्रण ( सामग्री की तालिकादेखें) ।
  3. अलग कर देना pluripotent स्टेम कोशिकाओं के एक अच्छी तरह से एक 6 अच्छी तरह से थाली में उगाया सीए 2 बिना पंजाबियों की 1 मिलीलीटर+ और2 मिलीग्राम + और ०.५ mM EDTA के साथ ।
    नोट: पृथक्करण समय से 3-10 मिनट में बदलता है । जब कोशिकाओं के ८०% से अधिक प्लेट के नीचे से अलग कर रहे हैं, अगले कदम के लिए आगे बढ़ना ।
  4. 15 मिलीलीटर प्लास्टिक केंद्रापसारक ट्यूब में बाँझ प्लास्टिक के साथ सेल निलंबन ले लीजिए ।
  5. 2 + और एमजी2 +, पंजाबियों की 5 मिलीलीटर-सीए युक्त के साथ पृथक्करण एजेंट बेअसर ।
  6. केंद्रापसारक द्वारा गोली कोशिकाओं (3 मिनट के लिए २०० x g) ।
  7. निकालें supernatant और धीरे ट्यूब झटका करने के लिए गोली को उखाड़ देना ।
  8. स्टेम सेल मीडिया के 1 मिलीलीटर में कोशिकाओं को पुनः निलंबित ।
  9. विक्रेता के निर्देशों का पालन करते हुए स्वचालित कक्ष काउंटर का उपयोग करके कक्ष गिनना ।
  10. प्लेट २०,००० में लेपित अच्छी तरह से प्रति व्यवहार्य कोशिकाओं (९६ अच्छी तरह से प्लेट) ५० µ में स्टेम सेल मीडिया के एल 2 µ एम RHO के साथ पूरक/रॉक मार्ग अवरोध करनेवाला ( 1 और 2 टेबलदेखें) ।
  11. के बाद 24 एच, सेल लगाव के लिए मॉनिटर और १०० µ एल के साथ मीडिया की जगह स्टेम सेल मीडिया 2 µ m RHO के साथ पूरक/रॉक मार्ग अवरोध करनेवाला और 6 एनजी/एमएल hexadimethrine ब्रोमाइड ( टेबल 1 और 2देखें), lentiviral संक्रमण से पहले एक एच ।
    नोट: कोशिकाओं को मजबूती से थाली के नीचे से जुड़ी होनी चाहिए ।
  12. गल Id1-बर्फ पर lentivirus.
  13. अच्छी तरह से प्रति शुद्ध lentivirus के 3 µ एल जोड़ें (वायरस titer 108 से 109 मं/एमएल के बीच होना चाहिए), और फिर थाली वापस सेल संस्कृति मशीन (३७ ° c, 5% सह2, 20% ओ2) के लिए स्थानांतरण ।
  14. 24 एच के बाद वायरल संक्रमण, संक्रमित कोशिकाओं को ताजा स्टेम सेल मीडिया के १०० µ एल जोड़ें ।
  15. ४८ एच के बाद lentiviral संक्रमण, २०० µ एल के साथ मीडिया युक्त वायरस की जगह ताजा स्टेम सेल मीडिया के 1 µ जी के साथ पूरक/एमएल puromycin ।
  16. ताज़ा मीडिया दैनिक २०० µ के साथ स्टेम सेल मीडिया के एल 1 µ g/एमएल puromycin के साथ पूरक ।
  17. जब संस्कृतियों ८०% तक पहुंच को प्रभावित, अलग कर देना की कोशिकाओं का उपयोग कर २०० µ l पंजाबियों के बिना सीए2 + और मिलीग्राम2 + + ०.५ mM EDTA (एक अच्छी तरह से एक ९६ के लिए अच्छी तरह से थाली).
  18. एक केंद्रापसारक ट्यूब में सेल निलंबन इकट्ठा ।
  19. 2 + और एमजी2 +, पंजाबियों की 5 मिलीलीटर-सीए युक्त के साथ पृथक्करण एजेंट बेअसर ।
  20. केंद्रापसारक द्वारा गोली कोशिकाओं (3 मिनट के लिए २०० x g) ।
  21. निकालें supernatant और धीरे ट्यूब झटका करने के लिए गोली को उखाड़ देना ।
  22. 2 µ m RHO/रॉक मार्ग अवरोधक के साथ पूरक स्टेम सेल मीडिया के 1 मिलीलीटर में पुन: निलंबित कोशिकाओं.
  23. सभी कोशिकाओं (1 एमएल) एक 12-अच्छी तरह से थाली के एक लेपित अच्छी तरह से स्थानांतरण ।
  24. 24 एच के बाद, अच्छी तरह से सेल लगाव के लिए निगरानी और स्टेम सेल मीडिया के 1 मिलीलीटर के साथ 2 µ m RHO/रॉक मार्ग अवरोधक और 6 एनजी/एमएल hexadimethrine ब्रोमाइड, एक एच transduction करने से पहले के पूरक के साथ मीडिया की जगह ।
  25. गल Id1-बर्फ पर lentivirus.
  26. अच्छी तरह से प्रति शुद्ध वायरस के 5 µ एल जोड़ें (12-अच्छी तरह से थाली) ।
  27. 24 एच के बाद lentiviral संक्रमण, ताजा स्टेम सेल मीडिया के 1 मिलीलीटर के साथ मीडिया युक्त वायरस की जगह 3 µ g/एमएल puromycin के साथ पूरक ।
  28. ४८ एच पोस्ट lentiviral संक्रमण, वायरस से युक्त मीडिया की जगह 1 मिलीलीटर के साथ ताजा स्टेम सेल मीडिया 6 µ g/एमएल puromycin के साथ पूरक ।
  29. जब संस्कृतियों ८०% तक पहुंच प्रवाह, अलग कर देना कोशिकाओं के ५०० µ एल का उपयोग कर के साथ2 + और2 मिलीग्राम + और ०.५ mM EDTA के साथ (एक के लिए अच्छी तरह से एक 12 की अच्छी तरह से थाली) ।
  30. स्थानांतरण आधा (२५० µ एल) सेल निलंबन के एक अच्छी तरह से एक कोटिंग रिएजेंट लेपित 6-खैर प्लेट स्टेम सेल मीडिया के 2 मिलीलीटर युक्त 2 µ m RHO के साथ पूरक/
  31. lentiviral-मध्यस्थता Id1 अभिव्यक्ति का स्तर निर्धारित करने के क्रम में, आरएनए निष्कर्षण और qRT-पीसीआर के लिए नमूने के अन्य आधे (२५० µ एल) का उपयोग कोला एट अल में के रूप में. (२०१२) 4.
    नोट: महत्वपूर्ण: यदि Id1 mRNA अभिव्यक्ति स्तर से कम है ०.००५ GAPDH अभिव्यक्ति स्तर की तह (देखें तालिका 3 qRT-पीसीआर प्राइमरों के लिए), दोहराने संक्रमण की प्रक्रिया के रूप में ऊपर वर्णित के रूप में जब तक Id1 अभिव्यक्ति स्तर से अधिक थ्रेशोल्ड.

2. hPSCsId1 रखरखाव

  1. संस्कृति hPSCsId1 में लेपित 6 अच्छी तरह से प्लेटें और 6 µ g/एमएल puromycin के साथ पूरक स्टेम सेल मीडिया के प्रति अच्छी तरह से 3 मिलीलीटर में बढ़ने ।
  2. जब hPSCsId1 तक पहुंचने ८०% प्रवाह, समुच्चय के रूप में पारित कोशिकाओं (1:6 विभाजन अनुपात) एंजाइम मुक्त पृथक्करण रिएजेंट के बाद विक्रेता के दिशा निर्देशों का उपयोग और स्टेम सेल मीडिया के प्रति अच्छी तरह से 3 मिलीलीटर में विकसित 6 µ g/एमएल puromycin के साथ पूरक ।

3. विभेदन के लिए hPSCsId1 की तैयारी

  1. कोट एक 12-कोटिंग रिएजेंट की अच्छी तरह से प्रति ५०० µ एल के साथ अच्छी तरह से थाली ।
  2. जब hPSCsId1 Ca2 + और मिलीग्राम2 + और ०.५ mM EDTA के साथ अच्छी तरह के लिए प्रति 5-10 मिनट के बिना पंजाबियों की 1 मिलीलीटर जोड़कर ९०% प्रवाह अलग कर देना कोशिकाओं तक पहुंचते हैं । पृथक्करण प्रक्रिया हर मिनट की जाँच करें, और एक बार ८०% कोशिकाओं की थाली से असंबद्ध हैं , तो अगले चरण पर आगे बढ़ें ।
  3. एक केंद्रापसारक ट्यूब में सेल निलंबन इकट्ठा ।
  4. 2 + और एमजी2 +, पंजाबियों की 5 मिलीलीटर-सीए युक्त के साथ पृथक्करण एजेंट बेअसर ।
  5. केंद्रापसारक द्वारा गोली कोशिकाओं (3 मिनट के लिए २०० x g) ।
  6. निकालें supernatant और धीरे ट्यूब झटका करने के लिए गोली को उखाड़ देना ।
  7. 2 µ m RHO/रॉक मार्ग अवरोधक के साथ पूरक स्टेम सेल मीडिया के 2 मिलीलीटर में फिर से निलंबित कोशिकाओं ।
  8. किसी स्वचालित कक्ष काउंटर का उपयोग करके कक्ष गिनना ।
  9. प्लेट ३००,००० स्टेम सेल मीडिया के 1 मिलीलीटर में प्रति अच्छी तरह से 2 µ m RHO/रॉक मार्ग अवरोधक और 6 µ जी/एमएल puromycin, और ऊतक संस्कृति मशीन में स्थानांतरण प्लेट के साथ पूरक की कोशिकाओं ।
  10. ताजा मीडिया दैनिक स्टेम सेल मीडिया के 2 मिलीलीटर के साथ 6 µ g/एमएल puromycin के साथ पूरक जब तक संस्कृतियों ९०% प्रवाह तक पहुंचने । इस बिंदु पर, हृदय विभेद शुरू (अगला कदम) ।

4. hPSCsId1 का प्रथम हृदय क्षेत्र में विभेद-हृदय Progenitors की तरह (FHF-L सीपीएस)

  1. 12 के लिए अच्छी तरह से प्लेट प्रारूप, शुरू भेदभाव (0 दिन) प्रेरण मीडिया (तालिका 1) के १.५ मिलीलीटर के साथ स्टेम सेल मीडिया की जगह से Activin एक (१०० एनजी/एमएल) (की सिफारिश की मात्रा के लिए तालिका 2 देखें और Activin के लिए एक सांद्रता के साथ अलग प्लेट प्रारूपों) ।
  2. 1 दिन पर (24 घंटे के बाद भेदभाव शुरू की है), एक Activin बिना प्रेरण मीडिया के 2 मिलीलीटर के साथ मीडिया की जगह (एक 12 के प्रति अच्छी तरह से अच्छी प्लेट) ।
  3. 3 दिन पर, Activin के बिना प्रेरण मीडिया के 2 मिलीलीटर के साथ मीडिया की जगह एक (12 के प्रति अच्छी तरह से प्लेट अच्छी तरह से) ।
  4. 5 दिन पर, cryopreservation (अगला कदम) के लिए FHF-L सीपीएस इकट्ठा ।
    नोट: महत्वपूर्ण: Cryopreservation इस बिंदु पर पसंद किया जाता है, के रूप में यह बाद cardiomyocyte उत्पादन और कोशिकाओं के बैंक बड़े बैचों से कार्डियक जनक पीढ़ी के लिए सक्षम बनाता है । ध्यान दें कि वैकल्पिक रूप से, 5 दिन FHF-l सीपीएस एक हौसले से लेपित प्लेट को अंतर जारी रखने के लिए पारित किया जा सकता है, कृपया चरण 5.1 – 5.5 करने के लिए passFHF-l सीपीएस को देखें और फिर भेदभाव के लिए ६.५ कदम आगे बढ़ना ।

5. Cryopreservation का FHF-L सीपीएस

  1. महाप्राण 5 FHF-L सीपीएस युक्त कुओं से सभी मीडिया और जल्दी से गर्म (३७ डिग्री सेल्सियस) 1x एंजाइम युक्त पृथक्करण रिएजेंट की 1 मिलीलीटर जोड़ने ( सामग्री की तालिकादेखें) । टिशू कल्चर मशीन में प्लेट प्लेस ।
  2. 1 मिनट के बाद, मशीन में पक्ष को थाली पक्ष हिला ।
  3. 2 मिनट (कुल समय) के बाद, मशीन से प्लेट हटाने और 10% FBS मीडिया के 1 मिलीलीटर जोड़ें ।
  4. प्लेट से सेल टुकड़ी की सुविधा के लिए एक 5 मिलीलीटर प्लास्टिक के साथ धीरे से कोशिकाओं को ऊपर और नीचे प्लास्टिक ।
  5. 3 मिनट के लिए २०० x g पर केंद्रापसारक द्वारा एक केंद्रापसारक ट्यूब और गोली कोशिकाओं के लिए सेल निलंबन ले लीजिए
  6. cryopreservation रिएजेंट के 2 मिलीलीटर में फिर से निलंबित सेल गोली ।
  7. किसी स्वचालित कक्ष काउंटर का उपयोग करके कक्ष गिनना ।
  8. एक पर्याप्त मात्रा में वांछित एकाग्रता (आमतौर पर 5-10 x 106 कोशिकाओं/एमएल) पर cryopreserve कोशिकाओं के लिए cryopreservation एजेंट ( सामग्री की तालिकादेखें) जोड़ें ।
  9. cryopreservation शीशियों और ठंडा डिवाइस में जगह शीशियों को स्थानांतरित कोशिकाओं (1 ° c/मिनट) और जगह में ठंडा डिवाइस-८० ° c फ्रीजर रात भर ।
  10. 24 घंटे के बाद, लंबी अवधि के भंडारण के लिए तरल नाइट्रोजन के लिए जमे हुए शीशियों हस्तांतरण ।
    नोट: प्रोटोकॉल यहां ठहराया जा सकता है ।

6. FHF-एल सीपी वेंट्रिकुलर में विभेद-जैसे Cardiomyocytes

  1. स्थानांतरण दिवस 5 FHF-एल सीपीएस जमे हुए शीशियों तरल नाइट्रोजन भंडारण से सूखी बर्फ कंटेनर में ।
  2. 2 से 3 मिनट के लिए ३७ ° c पानी स्नान में शीशियों प्लेस, जब तक सेल निलंबन पूरी तरह से गल गया है ।
    नोट: महत्वपूर्ण: गल प्रक्रिया समय के प्रति संवेदनशील है । समय की एक अत्यधिक राशि के लिए cryopreservation मीडिया के लिए कोशिकाओं को उजागर (यानी, 10 मिनट) कोशिका व्यवहार्यता कम हो जाएगा ।
  3. गल शीशियों की संख्या पर निर्भर करता है, 15 या ५० एमएल केंद्रापसारक ट्यूब करने के लिए स्थानांतरण कोशिकाओं ।
  4. dropwise वितरण (5 हर 30 सेकंड बूंदें) पूर्व गरम (३७ ° c) फुलाव मीडिया (तालिका 1) के लिए सेल समाधान । 1:3 cryopreservation मीडिया तक इस प्रक्रिया को जारी रखें: फुलाव मीडिया अनुपात तक पहुंच गया है । इस बिंदु पर, फुलाव मीडिया इसके अतिरिक्त दर एक 1:10 cryopreservation मीडिया तक बढ़ाएं: फुलाव मीडिया अनुपात तक पहुंच गया है ।
    नोट: महत्वपूर्ण: तेजी से osmolarity परिवर्तन गल प्रक्रिया के दौरान कोशिका मृत्यु में वृद्धि होगी; इसलिए, फुलाव मीडिया के dropwise इसके अलावा ऊपर वर्णित के रूप में अत्यधिक की सिफारिश की है ।
  5. केंद्रापसारक द्वारा सेल सस्पेंशन और गोली कोशिकाओं (3 मिनट के लिए २०० x g) ।
  6. supernatant निकालें और धीरे झटका केंद्रापसारक ट्यूब सेल गोली हटाना करने के लिए ।
  7. फुलाव मीडिया 2 µ m RHO/रॉक मार्ग अवरोधक के साथ पूरक के साथ पुनः निलंबित कोशिकाओं ।
    नोट: सेल व्यवहार्यता गल से गल के लिए भिंन हो सकते हैं, और, सामांय में, > ६५% व्यवहार्यता अच्छा चढ़ाना दक्षता की भविष्यवाणी की ।
  8. चढ़ाना के लिए वांछित सेल एकाग्रता प्राप्त करने के लिए 2 µ m RHO/रॉक मार्ग अवरोधक के साथ पूरक फुलाव मीडिया के साथ केंद्रित सेल निलंबन पतला (अलग प्लेट प्रारूपों के लिए तालिका 2 देखें) ।
    नोट: महत्वपूर्ण: ध्यान दें कि हृदय विभेदक दक्षता में गिरावट आ सकती है यदि कोशिकाओं को भी बहुत विरले मिले हैं ।
  9. प्लेट पर बीज कोशिकाओं ।
  10. 20 मिनट के लिए ऊतक संस्कृति हूड में थाली रखने के लिए यह ऊतक संस्कृति मशीन को स्थानांतरित करने से पहले ।
  11. भेदभाव के 6 दिन पर, सेल लगाव की निगरानी ।
    नोट: कार्डिएक progenitors विभेद के 5 दिन पर cryopreserved हैं । 24 h गल के बाद कोशिकाओं को भेदभाव के 6 दिन पर होगा ।
    नोट: अस्थायी (मृत) कोशिकाओं की उपस्थिति आम है.
  12. 7 दिन, मीडिया के ५०% महाप्राण और ताजा फुलाव मीडिया के एक बराबर राशि के साथ बदलें ।
    नोट: फुलाव मीडिया के लिए RHO/रॉक मार्ग अवरोधक के अलावा इस बिंदु के बाद आवश्यक नहीं है ।
  13. फुलाव मीडिया के साथ हर दूसरे दिन मीडिया के ५०% की जगह ।
  14. नोट सहज धड़कन है कि दिन 11 और 13 दिन के बीच प्रकट होता है ।
  15. 15 दिन पर, DAPI (नाभिक दाग) और ACTC1 (पान-कार्डिएक मार्कर) का उपयोग कर इम्यूनोफ्लोरेसेंस द्वारा हृदय विभेदक क्षमता बढ़ाता है ।

7. पासिंग और वेंट्रिकुलर के रखरखाव की तरह Cardiomyocytes

नोट: 14 दिन तक-16, अनायास करार वेंट्रिकुलर की एक monolayer-तरह cardiomyocytes प्राप्त किया जाना चाहिए । इस बिंदु पर, यह अलग कर देना और री-प्लेट cardiomyocytes करने के लिए सुझाव दिया है ताकि संस्कृति homogenize और कोशिकाओं को प्लेट से अलग करने से रोकें ।

  1. कुओं से सभी मीडिया महाप्राण और जल्दी से पूर्व गर्म (३७ डिग्री सेल्सियस) 1x एंजाइम युक्त पृथक्करण एजेंट के 1 मिलीलीटर जोड़ें ।
    नोट: 1x एंजाइम युक्त पृथक्करण एजेंट संस्करणों प्लेट प्रारूप के आधार पर बदलती हैं, लेकिन पूरी तरह से अच्छी सतह के नीचे कवर करना चाहिए ।
  2. एक ऊतक संस्कृति मशीन में स्थानांतरण प्लेट ।
  3. धीरे प्लेट पक्ष को मशीन के अंदर हर 2 मिनट के लिए टुकड़ी की प्रक्रिया में तेजी लाने के लिए हिला ।
  4. 5 के बाद-15 मिनट, जब कोशिकाओं के १००% करने के लिए ८०% प्लेट के नीचे से अलग कर रहे हैं, मशीन से प्लेट हटाने और 10% FBS मीडिया की एक बराबर मात्रा जोड़कर 1x एंजाइम युक्त पृथक्करण एजेंट गतिविधि को बाधित ।
    नोट: इस प्रक्रिया के लिए 1x एंजाइम युक्त पृथक्करण के साथ मशीन समय बैच के लिए बैच से अलग हो जाएगा ।
  5. एक केंद्रापसारक ट्यूब करने के लिए सेल निलंबन ले लीजिए ।
  6. एक स्वचालित सेल काउंटर का उपयोग कर प्लास्टिक और गिनती कोशिकाओं के साथ मिक्स सेल निलंबन ।
  7. वांछित सेल एकाग्रता के लिए सेल निलंबन पतला (2 µ एम RHO/रॉक मार्ग अवरोधक के साथ पूरक रखरखाव मीडिया के साथ अलग प्लेट प्रारूपों के लिए तालिका 2 देखें) ।
  8. प्लेट पर cardiomyocytes बोने के बाद, समान रूप से कोशिकाओं को वितरित करने और कोशिकाओं ऊतक संस्कृति मशीन के लिए प्लेट स्थानांतरित करने से पहले 10-20 मिनट के लिए संलग्न करने के लिए अनुमति देते हैं ।
  9. फिर से चढ़ाना, सेल लगाव और वसूली की निगरानी के बाद 24 एच ।
    नोट: अस्थायी (मृत) कोशिकाओं की उपस्थिति आम है. 48-72 एच के बाद पुनः चढ़ाना, cardiomyocyte सहज संकुचन फिर से शुरू करना चाहिए ।
  10. cardiomyocyte संस्कृति को बनाए रखने के लिए, रखरखाव मीडिया के साथ वेंट्रिकुलर के बाद के प्रयोगों के लिए cardiomyocytes की तरह का उपयोग करें जब तक हर दूसरे दिन मीडिया के ५०% की जगह ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

hPSCs की पीढ़ी Id1 लाइनें
hPSCs एक lentivirus मध्यस्थता Id1 (चित्रा 1) से संक्रमित हैं । एक बार hPSCId1 उत्पन्न होते हैं, transgene अभिव्यक्ति qRT-पीसीआर (चित्रा 1बी) द्वारा quantified है । केवल hPSCId1 Id1 mRNA से अधिक स्तर पर व्यक्त करने के लिए GAPDH के ०.००५ गुना से अधिक अंतर के लिए इस्तेमाल किया जाना चाहिए लाइनों ।

hPSCs Id1 रखरखाव और डी के लिए तैयारी ifferentiation
इष्टतम संस्कृति की स्थिति के लिए आवश्यक और महत्वपूर्ण है हृदय जनक भेदभाव की तरह सफल पहले दिल क्षेत्र के लिए (चित्रा 2) । hPSCId1 संस्कृतियों स्टेम आकृति विज्ञान रखरखाव और सतत प्रसार के लिए दैनिक निगरानी की जानी चाहिए । विभेद शुरू किया जाना चाहिए जब कसकर पैक स्टेम सेल कालोनियों तक पहुंचने > 90% प्रवाह (चित्रा 2बी) । अगर भेदभाव इष्टतम प्रवाह से पहले शुरू की है, सेल मौत बढ़ाया है और भिंनता दक्षता (2 चित्रासी) गिरावट आ सकती है । इसी तरह, ऊंचा संस्कृतियों खराब प्रदर्शन करेंगे (चित्रा 2डी) ।

हृदय Progenitors (FHF-एल सीपीएस) की तरह पहले दिल क्षेत्र की पीढ़ी hPSCs Id1
1 दिन (24 एच पद भेदभाव दीक्षा), कोशिकाओं स्टेम आकृति विज्ञान के नुकसान का निरीक्षण करने के लिए निगरानी की जानी चाहिए (कोशिकाओं चापलूसी और स्टेम सेल से गहरा दिखाई देते हैं) । ध्यान दें कि कोशिका मृत्यु भेदभाव के पहले दिन के दौरान आम है, लेकिन सेल संगम पर बनाए रखा जाना चाहिए > 75% (चित्रा 2) । यदि भिंनता के 24 घंटे के बाद, ५०% या अधिक कवर सतह क्षेत्र खो जाता है, तो कक्षों को छोड़ दिया जाना चाहिए ।

3 दिन पर, अंतर कोशिकाओं संकुल रहना चाहिए और प्रारंभिक 24 घंटे की अवधि (चित्रा 2एफ) के दौरान बनाया अंतराल भरा है । फ्लैट कोशिकाओं को स्वतंत्र रूप से बढ़ रही है इष्टतम भेदभाव की स्थिति का संकेत कर रहे हैं ।

4 दिन पर, इष्टतम भेदभाव जारी विस्तार और थाली के कवरेज दिखाना चाहिए ।

5 दिन पर, कोशिकाओं को काटा और cryopreserved हैं । इष्टतम विभेदों सजातीय आकृति विज्ञान उपस्थिति (चित्रा 2जी) के साथ कसकर जुड़े सेल समूहों में परिणाम होना चाहिए । ध्यान दें कि फ्लैट कोशिकाओं के कम घनत्व समूहों एक इष्टतम भेदभाव परिणाम निशान । विभिन्न संस्कृति प्रारूपों में अच्छी तरह से प्रति दिन 5 कार्डियक progenitors की औसत उपज के लिए तालिका 2 देखें ।

वेंट्रिकुलर की पीढ़ी-FHF से Cardiomyocytes की तरह-L सीपीएस
5 दिन FHF-एल सीपीएस प्लेट प्रारूप में गल-निर्भर घनत्व तालिका 2में वर्णित है, क्रम में उनके हृदय विभेद की क्षमता को अधिकतम करने के लिए (चित्रा 3और 2 तालिका) । गल के बाद व्यवहार्यता पर नजर रखने की जरूरत है । आम तौर पर, व्यवहार्यता पर्वतमाला से 70-80% । यदि व्यवहार्यता ६०% से कम है, cardiomyocytes की उपज प्रभावित होगा ।

6 दिन (अंतर शुरू करने के बाद 24 ज), FHF-एल सीपीएस > उपलब्ध सतह क्षेत्र के 90% कवर और कोशिकाओं की एक समरूप एकल परत के रूप में प्रकट होना चाहिए (चित्रा 3बी) । कम 6 दिन पर संगम cardiomyocytes में FHF-एल सीपीएस भेदभाव कम हो जाएगा ।

परिणाम cardiomyocytes शुरू करने के लिए 11 दिन से हरा-भेदभाव के 13 (चित्रा 3सी और फिल्म 1) । दिन के दौरान 14-16 पुनर्चढ़ाना प्रक्रिया, विभिंन संस्कृति स्वरूपों में cardiomyocytes प्रति अच्छी तरह से औसत उपज के लिए तालिका 2 देखें । भेदभाव दक्षता आम तौर पर हृदय (ACTC1), fibroblast (TAGLN) और संवहनी endothelial मार्करों (CDH5) और परमाणु (DAPI) मार्करों के लिए इम्यूनोफ्लोरेसेंस द्वारा मूल्यांकन किया जाता है । वंश ठहराव स्वचालित इमेजिंग और प्रतिदीप्ति ठहराव का उपयोग कर, के रूप में Cunningham एट अल में किया जाता है । (२०१७) 5 (चित्रा 3डी ई) । परिणामस्वरूप cardiomyocytes के उपप्रकार लक्षण वर्णन qRT-पीसीआर (चित्रा 3एफ) और कार्रवाई संभावित क्षणिक विश्लेषण काइनेटिक इमेजिंग और वोल्टेज संवेदन जांच का उपयोग (चित्रा 3जी और फिल्म 2) द्वारा किया जाता है । प्रतिदीप्ति ठहराव वोल्टेज की जांच के लिए और जिसके परिणामस्वरूप कार्रवाई संभावित ट्रेस विश्लेषण (चित्रा 3एच) McKeithan एट अल में वर्णित के रूप में किया जाता है । (२०१७) 7.

Figure 1
चित्रा 1: hPSCId1 लाइनोंकी पीढ़ी (A) hPSCsId1 जनरेशन प्रोटोकॉल का योजनाबद्ध प्रस्तुतिकरण । (ख) एक hPSC लाइन और Id1 लाइनों की दो पंक्तियों सहित hESChPSC की अलग लाइनों से lentiviral-मध्यस्थता अभिव्यक्ति द्वारा उत्पन्न प्रतिनिधि Id1 mRNA स्तर दिखा qRT-पीसीआर परिणामों के उदाहरण. डैश्ड रेखा Id1 व्यंजक थ्रेशोल्ड का प्रतिनिधित्व करती है, जो नीचे hPSCId1 रेखाओं को Id1-lentivirus संक्रमण के एक अतिरिक्त चक्र से गुजरने की आवश्यकता होती है । "p" बीतने संख्या इंगित करता है । कोष्ठक में संख्या Id1-lentiviral संक्रमण के दौरों की संख्या को इंगित करती है. त्रुटि पट्टियां तपसिल में निष्पादित प्रयोगों के मानक विचलन का प्रतिनिधित्व करती हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: पहले दिल क्षेत्र की पीढ़ी-कार्डिएक Progenitors की तरह (FHF-एल सीपीएस) hPSCId1से भेदभाव। (क) FHF-एल सीपी जनरेशन प्रोटोकॉल का योजनाबद्ध प्रतिनिधित्व. प्रतिनिधि उज्ज्वल क्षेत्र hPSCId1 (दिन 0) इष्टतम पर (ख), उप-धाराप्रवाह (पीला ऐरोहेड कोशिकाओं के बीच शूंय क्षेत्रों का संकेत) (ग) और अधिक-धाराप्रवाह (डी) घनत्व । प्रतिनिधि उज्ज्वल-hPSCId1 अंतर के क्षेत्र चित्र दिन में 1, 3 और 5 क्रमशः (E), (F), (G) । स्केल बार = १०० µm. कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें

Figure 3
चित्रा 3: FHF-एल सीपीएस से वेंट्रिकुलर की तरह Cardiomyocyte की पीढ़ी (क) वेंट्रिकुलर की तरह cardiomyocyte जनरेशन प्रोटोकॉल का योजनाबद्ध प्रतिनिधित्व । (ख) दिन 6 विभेद कोशिकाओं के उज्ज्वल क्षेत्र छवि (एक दिन के बाद गल) । (ग) एक दिन 12 धड़कन संस्कृति की उज्ज्वल क्षेत्र छवि । (घ) दिन 15 संस्कृतियों (३८४-खैर प्लेट प्रारूप) के प्रतिनिधि इम्यूनोफ्लोरेसेंस छवि । ACTC1 marks cardiomyocytes, TAGLN: fibroblasts/चिकनी मांसपेशी, CDH5: संवहनी endothelial कोशिकाओं, और DAPI: नाभिक (इनसेट में दिखाया गया है) । (ङ) दिन १५ संस्कृतियों का वंश ठहराव. (च) qRT-पीसीआर डाटा समय पाठ्यक्रम अभिव्यक्ति दिन से 5 वेंट्रिकुलर-विशिष्ट मार्करों (IRX4 और MYL2) और पैन कार्डियक मार्कर (MYL7) के दिन 25 करने के लिए । (छ) भेदभाव के दिन 25 में वेंट्रिकुलर की तरह cardiomyocytes से प्रतिनिधि कार्रवाई संभावित ट्रेस । (H) परिणामी वेंट्रिकुलर-जैसे cardiomyocytes (n = 12) के लिए कार्रवाई संभावित अवधि माप (APD५० और APD९०) । त्रुटि पट्टियां quadruplicate में निष्पादित प्रयोगों के मानक विचलन का प्रतिनिधित्व करती है (जब तक अंयथा नोट न किया गया हो) । स्केल बार्स = १०० µm. RFU, सापेक्ष प्रतिदीप्ति इकाई । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

मध्यम आधार मध्यम Additive
स्टेम सेल मीडिया mTesR1 n/a
प्रेरण मीडिया RPMI १६४० मध्यम B-27 सीरम-इंसुलिन के बिना नि: शुल्क अनुपूरक, 1x
प्रेरण मीडिया RPMI १६४० मध्यम Puromycin, 6 µ g/ml
प्रेरण मीडिया RPMI १६४० मध्यम पेनिसिलिन-Streptomycin, 1x
फुलाव मिडिया RPMI १६४० मध्यम B-27 सीरम-नि: शुल्क अनुपूरक, 1x
फुलाव मिडिया RPMI १६४० मध्यम पेनिसिलिन-Streptomycin, 1x
रखरखाव मीडिया RPMI १६४० मध्यम B-27 सीरम-नि: शुल्क अनुपूरक, 1x
रखरखाव मीडिया RPMI १६४० मध्यम पीटा सीरम प्रतिस्थापन, 2%
रखरखाव मीडिया RPMI १६४० मध्यम पेनिसिलिन-Streptomycin, 1x

तालिका 1: मीडिया घटक (आधार मीडिया और additives के लिए सामग्री की तालिका देखें) ।

३८४ अच्छी तरह से ९६ अच्छी तरह से 12 कुआं 6 वेल १०० एमएम १५० एमएम
कोटिंग मात्रा (प्रति अच्छी तरह से) 10 µ l ५० µ l ५०० µ l 1 मिलीलीटर 5 मिलीलीटर 10 मिलीलीटर
मध्यम मात्रा
(प्रति कुआं)
१०० µ l ३०० µ l 2 मिलीलीटर 5 मिलीलीटर 12 मिलीलीटर 30 एमएल
विभेद दिन 0 activin एकाग्रता (एनजी/ १०० १०० १०० ३००
कार्डियक जनक
दिन 5 घनमीटर
(कक्ष/
१.० – १.२ x 105 २.५ – ३.० x 105 1.0-1.5 x 107 २.० – ३.० x 107
कार्डिएक जनक दिन 5 पुनर्चढ़ाना या गल घनत्व (कोशिकाओं/ २.० x 104 ७.५ x 105 ४.५ x 106 ८.० x 106 २.२ x 107
वेंट्रिकुलर-जैसे cardiomyocyte
१४ दिवस-१६ घनमीटर
(कक्ष/
२.० – ५.० x 104 ०.८ – १.२ x 106 ३.५ – ५.० x 106 ०.८ – १.२ x 107 १.८ – २.५ x 107
वेंट्रिकुलर-cardiomyocyte पुनर्चढ़ाना घनत्व की तरह
(कक्ष/
२.५ x 104 १.० x 106 ४.५ x 106 १.० x 107 २.२ x 107

तालिका 2: स्केलेबल भेदभाव मापदंडों (कोटिंग मात्रा, मध्यम मात्रा, Activin एक एकाग्रता, पैदावार, घनत्व चढ़ाना) ।

जीन नाम जीन बैंक प्रवेश अनुक्रम
GAPDH NM_001256799 च: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
माउस Id1 NM_010495 च: CCTAGCTGTTCGCTGAAGGC
R: CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 च: GGCTCCCCAGTTCTTGATGG
R: TAGACCGGGCAGTAGACCG
MYL2 NM_000432 च: TTGGGCGAGTGAACGTGAAAA
R: CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 च: GCCCAACGTGGTTCTTCCAA
R: CTCCTCCTCTGGGACACTC

तालिका 3: qRT-पीसीआर प्राइमरी जुगाड़ ।

Movie 1
फिल्म 1: उज्ज्वल क्षेत्र रिकॉर्डिंग (१०० फ्रेम्स/दिन के 15 cardiomyocytes जहां सहज संकुचन देखा जा सकता है । कृपया इस वीडियो को देखने के लिए यहां क्लिक करें । (डाउनलोड करने के लिए राइट-क्लिक करें.)

Movie 2
मूवी 2: काइनेटिक इमेजिंग (१०० फ्रेंस/25 id1-प्रेरित वेंट्रिकुलर-cardiomyocytes की तरह दिन में वोल्टेज के प्रति संवेदनशील फ्लोरोसेंट जांच । कृपया इस वीडियो को देखने के लिए यहां क्लिक करें । (डाउनलोड करने के लिए राइट-क्लिक करें.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

सफल भेदभाव के लिए, बारीकी से ऊपर सूचीबद्ध निर्देशों का पालन करने के लिए सुनिश्चित करें । इसके अलावा, यहां हम प्रमुख मापदंडों पर प्रकाश डाला है कि दृढ़ता से भेदभाव परिणाम प्रभाव । एक भेदभाव शुरू करने से पहले, निंनलिखित तीन रूपात्मक मानकों को देखा जाना चाहिए: hPSCsId1, एक उच्च सेलुलर संकुचन और एक उच्च संगम की एक स्टेम आकृति विज्ञान (> 90%) 0 दिन में संस्कृति । उस संबंध में, इष्टतम भेदभाव की स्थिति सर्वश्रेष्ठ एकल कोशिकाओं के रूप में असंबद्ध hPSCsId1 चढ़ाना द्वारा बनाई गई है और उंहें कसकर संकुल monolayers कि 2 से 3 दिनों के दौरान ~ ९०% संगम को विकसित फार्म की अनुमति । इसके विपरीत, यदि hPSCId1 संस्कृतियों गरीब सेल और कॉलोनी आकृति विज्ञान, कम कॉलोनी संकुचन और संस्कृति के भीतर भेदभाव के बड़े क्षेत्रों की उपस्थिति दिखाने के लिए, सफल FHF-L CP भेदभाव की संभावना नहीं है ।

मीडिया मात्रा और Activin एक सांद्रता FHF-एल सीपी भेदभाव और प्लेट प्रारूप के महत्वपूर्ण मापदंडों पर निर्भर है ( 2 तालिकादेखें) । यह भी ध्यान दें कि इष्टतम Activin एक सांद्रता इस्तेमाल hPSC लाइन के आधार पर भिंन हो सकते है और एकाग्रता अनुकूलन की आवश्यकता हो सकती है ।

hPSCs में Id1 mRNA स्तरों को कुशलतापूर्वक FHF-l धय को बढ़ावा देने के लिए महत् वपूर्ण हैं । Id1 स्तर मजबूत FHF का उत्पादन करने के लिए असफल हो जाएगा-एल सीपी भेदभाव और बड़े पैमाने पर सेल मौत विभेद के 1 दिन से मनाया जाएगा । Id1-टू-GAPDH के सापेक्ष अभिव्यक्ति अनुपात कुशल विभेद को बढ़ावा देने के लिए ०.००५ से अधिक होना चाहिए । puromycin (6-10 µ g/एमएल) की उच्च खुराक का उपयोग जारी चयन lentiviral मध्यस्थता Id1 अभिव्यक्ति के उच्च स्तर को बनाए रखने के क्रम में सिफारिश की है. हर 10 मार्ग Id1 mRNA स्तरों का मूल्यांकन अनुशंसित है ।

चढ़ाना घनत्व के दिन 5 FHF-L CPsis भी हृदय विभेदक दक्षता के लिए एक महत्वपूर्ण पैरामीटर । यदि 5 दिन FHF-एल सीपीएस कम घनत्व पर चढ़ाया जाता है, रिश्तेदार हृदय उपज में कमी होगी । इष्टतम चढ़ाना घनत्व तालिका 2 में सूचीबद्ध है और प्लेट प्रारूप-निर्भर हैं ।

इस प्रोटोकॉल के लिए मुख्य सीमा promoteFHF-एल सीपी भेदभाव जो परिणामस्वरूप progenitors और वेंट्रिकुलर-cardiomyocytes की तरह के चिकित्सीय उपयोग को सीमित कर सकते है के लिए lentiviral-मध्यस्थता Id1 का उपयोग है । इसके अलावा, के बाद से lentiviruses साइटों है कि संभवतः hPSC रखरखाव और/या विकास की क्षमता को प्रभावित कर सकता है पर एकीकृत कर सकते हैं, hPSCsId1 कालोनियों के उपजी स्टेम जीन अभिव्यक्ति का मूल्यांकन और रूपात्मक संकेत देख द्वारा निगरानी की जानी चाहिए भेदभाव. ध्यान दें कि गैर-एकीकृत वैक्टर का उपयोग कर Id1 व्यक्त इस सीमा को दूर करेगा और वर्तमान में हमारी प्रयोगशाला में जांच की जा रही है ।

इस विधि की एक सुविधाजनक सुविधा भिंनता प्रोटोकॉल की सादगी के रूप में यह केवल एक cytokine, Activin एक की आवश्यकता है, hPSCsId1से FHF-एल सीपीएस उत्पंन करने के लिए । इसकी तुलना में, अन्य प्रोटोकॉल 9,10,11,12,13,14,15 साइटोकिंस के संयोजनों के जटिल दृश्यों की आवश्यकता होती है और/ छोटे अणुओं को बढ़ावा देने और हृदय विभेद को बनाए रखने के लिए । इसके अलावा, इस प्रोटोकॉल अद्वितीय एक सुविधाजनक cryopreservation कदम है जो FHF-एल सीपी जनरेशन बाद cardiomyocyte उत्पादन से जोड़ा सक्षम बनाता है वर्णन करता है । यह सुविधा FHF-एल सीपीएस के बड़े बैचों को बैंक के लिए सक्षम बनाता है और जल्दी से जमे हुए progenitors से cardiomyocytes उत्पंन करने के लिए, हृदय भेदभाव के रूप में गल पर 5 दिन से शुरू । इस रणनीति के रूप में समय के 1 से 2 सप्ताह लाभ के रूप में hPSCs से हृदय भेदभाव शुरू करने की तुलना में अनुमति देता है । इसके अलावा, और सबसे महत्वपूर्ण बात, इस प्रोटोकॉल तिथि करने के लिए पहली प्रोटोकॉल को परिभाषित हृदय क्षेत्र मूल के कार्डियक progenitors उत्पंन है, जबकि अंय प्रोटोकॉल9,10,11,12 ,13,14,15 उस संबंध में अनिर्धारित रहते हैं ।

संक्षेप में, यह प्रोटोकॉल बड़ी मात्रा में उत्पादन करने के लिए एक मजबूत और स्केलेबल विधि को रेखांकित करता है (> 108– 109) विकास-प्रासंगिक FHF-L सीपीएस और वेंट्रिकुलर-like cardiomyocytes । बदले में, परिणामी कोशिकाओं को हृदय विभेद और शरीर विज्ञान को नियंत्रित करने के लिए उपंयास विनियामक रास्ते की पहचान करने के लिए इस्तेमाल किया जा सकता है, और अपक्षयी और रोग मॉडलिंग प्रयोजनों के लिए ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

हम उपयोगी चर्चा और पांडुलिपि के महत्वपूर्ण समीक्षा के लिए कोला लैब के सदस्यों को धंयवाद । इस अध्ययन में NIH/NIEHS R44ES023521-02 और सीआईआरएम DISC2-10110 अनुदान के लिए डा. रखवाए द्वारा समर्थित था ।

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics