Generación del primer corazón campo-como progenitores cardiaca y Ventricular como cardiomiocitos desde células madre humanas pluripotentes

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aquí describimos un método escalable, con una simple combinación de activina A y mediada por el lentivirus Id1-sobreexpresión, para generar progenitores cardiacos primera de corazón como campo y ventricular como cardiomiocitos desde células madre humanas pluripotentes.

Cite this Article

Copy Citation | Download Citations

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La generación de grandes cantidades de progenitores cardiaca derivadas de células madre pluripotentes humanas funcionales y cardiomiocitos de origen de campo de corazón definidos es un requisito previo para celular cardiacas terapias y modelos de enfermedad. Recientemente hemos demostrado que los genes de Id son necesarios y suficientes para especificar los primeros progenitores de campo de corazón durante el desarrollo de vertebrados. Este protocolo de diferenciación aprovecha estos resultados y utiliza Id1 sobreexpresión en combinación con la activina A como potentes señales especifica para producir los primeros progenitores de (FHF-L) de campo como de corazón. Importante, progenitores que resulta distinguen eficientemente (~ 70-90%) en cardiomiocitos ventriculares como. Aquí describimos un método detallado para 1) generar hPSCs overexpressing Id1 y 2) diferenciar cantidades escalables de progenitores de FHF-L cryopreservable y cardiomiocitos ventriculares como.

Introduction

Producción a gran escala de las células madre pluripotent humanas (hPSCs)-derivados progenitores cardíacos y cardiomiocitos es un requisito previo para terapias basadas en células madre1, modelo2,3 y la caracterización rápida de la enfermedad nuevos caminos que regulan diferenciación cardiaca4,5,6 y fisiología7,8. Aunque un número de estudios9,10,11,12,13,14,15 han descrito previamente altamente eficiente protocolos de diferenciación cardiaca de hPSCs, ninguna ha abordado el origen de campo de corazón de cardiomiocitos resultante, a pesar de la identificación de diferencias moleculares entre izquierda (primer campo del corazón) y derecha (segundo campo del corazón) cardiomiocitos ventriculares16 y la existencia de enfermedades cardíacas congénitas corazón campo específico; es decir, corazón izquierdo hipoplásico síndrome17 o arritmogénica displasia ventricular correcta18. Así, la generación de progenitores cardíacos y cardiomiocitos de origen de campo de corazón definidos de hPSCs se está convirtiendo en una necesidad para aumentar su relevancia como terapéuticas y herramientas de modelado de la enfermedad.

Este protocolo se basa en la sobre-expresión constitutiva de Id1, un recientemente identificado5 primer corazón campo especificando localización que en combinación con la activina A, es necesario y suficiente para iniciar la cardiogenesis en hPSCs. En particular, Cunningham et al. (2017) 5 muestran que progenitores Id1-inducida específicamente expresan primer campo del corazón (HCN4, TBX5) pero no segundo marcadores de campo de corazón (SIX2, ISL1) como sufren diferenciación cardiaca. Además, los autores muestran también que desarrollar embriones de ratón transgénico que carece de toda la familia de identificación de los genes (Id1-4), sin formar primer corazón campo cardiaco progenitores, mientras más medial y posterior de progenitores cardíacos ( segundo campo del corazón) puede todavía formar, tal modo sugiriendo que Id proteínas son esenciales para iniciar el primer corazón campo cardiogenesis en vivo. Convenientemente, progenitores Id1-inducida puede ser criopreservados y diferenciarse espontáneamente en cardiomiocitos mostrando ventricular-como características, incluyendo la expresión de marcadores específicos de ventricular (IRX4, MYL2) y ventricular como los potenciales de acción.

Aquí describimos un método simple y escalable para generar primeros progenitores cardiacos (FHF-L) de corazón como campo y cardiomiocitos ventriculares como de hPSCs expresando Id1. Una característica importante de este protocolo es la posibilidad de desacoplar la generación progenitora cardiaca de la producción de cardiomiocitos posterior usando un paso conveniente de criopreservación. En Resumen, este protocolo detalles de las medidas necesarias para (1) generar hPSCs overexpressing Id1, (2) generar progenitores cardiacos FHF-L de hPSCs, (3) progenitores resultantes de criopreservar y (4) reanudar la diferenciación cardiacas progenitoras de FHF-L y generar altamente enriquecido (> 70-90%) superando a cardiomiocitos ventriculares como.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. infección y la preparación de Virus Id1

  1. Generar Id1 expresando lentivirus por transferencia Co pCMVDR8.74, pMD2.G y pCDH-EF1-Id1-PGK-PuroR (Addgene: plásmido 107735 #) en las células HEK293T. Recoger partículas virales, filtrar, purificar del sobrenadante y almacenar a-80 ° C como en Kitamura et al. (2003) 19. producir alternativamente, Id1 lentivirus comercialmente enviando pCDH-EF1-Id1-PGK-PuroR a un proveedor de productores de lentivirus.
    PRECAUCIÓN: Siga lentivirales normativas y protocolos de operación estándar.
    Nota: Importante: título de virus óptima debe estar por lo menos 108 109 Transducing unidades/mL (TU/mL).
  2. Antes de la infección, aplicar un pocillo de una placa bien 96 con 50 μl de reactivo de la capa, típicamente una mezcla de proteína gelatinosa secretada por células de sarcoma de ratón de Engelbreth-Holm-Swarm (véase Tabla de materiales).
  3. Disociar el bien de las células de vástago pluripotent cultivado en una placa bien 6 añadiendo 1 mL de PBS sin Ca2 + y Mg2 + y con 0,5 mM de EDTA.
    Nota: Tiempo de disociación varía de 3 a 10 min. Cuando más del 80% de las células son separado de la parte inferior de la placa, proceder al siguiente paso.
  4. Recoger la suspensión celular con pipeta estéril en tubo de centrífuga de plástico de 15 mL.
  5. Neutralizar el reactivo de disociación con 5 mL de PBS que contenga Ca2 + y Mg2 +.
  6. Pellet de células por centrifugación (200 x g durante 3 min).
  7. Eliminar el sobrenadante y chasquear suavemente el tubo para desalojar la pelotilla.
  8. Resuspenda las células en 1 mL de medio de células madre.
  9. Contar las células usando un contador de células automatizado siguiendo las instrucciones del proveedor.
  10. Células viables de placa 20.000 por cubierto bien (placa de 96 pocillos) en 50 μl de células madre medios suplementados con 2 inhibidor de camino de RHO/ROCK μm (ver tablas 1 y 2).
  11. Después de 24 h, monitor para el accesorio de celular y reemplazar medios con 100 μl célula de vástago medios suplementada con 2 μm RHO/ROCK vía inhibidor y bromuro de hexadimethrine de 6 ng/mL (ver cuadros 1 y 2), una h antes de la infección lentivirales.
    Nota: Las células deben estar firmemente sujetas en la parte inferior de la placa.
  12. Descongelar el Id1-lentivirus en hielo.
  13. Agregar 3 μl de lentivirus purificada por pozo (título del virus debe estar entre 108 109 TU/mL) y luego transferir la placa a incubadora de cultivo celular (37 ° C, 5% CO2, 20% O2).
  14. infección post-viral 24 h, añadir 100 μl de células frescas de medios a las células infectadas.
  15. infección post lentivirales de 48 h, reemplazar virus que contienen los medios de comunicación con 200 μL de células frescas medios suplementados con 1 puromicina μg/mL.
  16. Actualizar los medios de comunicación diariamente con 200 μL de células madre medios suplementados con 1 puromicina μg/mL.
  17. Cuando las culturas llegan a 80% de confluencia, disociar las células con 200 μL de PBS sin Ca2 + y Mg2 + + 0,5 mM EDTA (para un pozo de una placa de 96 pocillos).
  18. Recoger la suspensión de células en un tubo de centrífuga.
  19. Neutralizar el reactivo de disociación con 5 mL de PBS que contenga Ca2 + y Mg2 +.
  20. Pellet de células por centrifugación (200 x g durante 3 min).
  21. Eliminar el sobrenadante y chasquear suavemente el tubo para desalojar la pelotilla.
  22. Resuspenda las células en 1 mL de células madre medios suplementados con 2 inhibidor de camino de RHO/ROCK μm.
  23. Transferencia de todas las células (1 mL) a un revestido de una placa de 12 pozos.
  24. Después de 24 h, monitor para la fijación de células a los medios bien y reemplazar con 1 mL de medios de comunicación de la célula de vástago complementado con inhibidor de la vía de 2 μm RHO/ROCK y bromuro de hexadimethrine de 6 ng/mL, una h antes de la transducción de señales.
  25. Descongelar el Id1-lentivirus en hielo.
  26. Añadir 5 μl de virus purificado por pozo (placa de 12 pozos).
  27. infección post lentivirales de 24 h, reemplazar virus que contienen los medios de comunicación con 1 mL de medio fresco células complementado con 3 puromicina μg/mL.
  28. 48 horas post infección lentivirales, reemplazar virus que contienen los medios de comunicación con 1 mL de células frescas medios suplementados con 6 puromicina μg/mL.
  29. Cuando las culturas llegan a 80% de confluencia, disociar las células con 500 μl de PBS sin Ca2 + y Mg2 + y con 0,5 mM EDTA (para un pozo de una placa de 12 pozos).
  30. Transferencia de la mitad (250 μL) de la suspensión celular en un pozo de un reactivo de capa cubierta placa de 6 pozos que contienen 2 mL de células madre medios suplementados con 2 inhibidor de camino de RHO/ROCK μm.
  31. Use la otra mitad (250 μL) de la muestra para la extracción de RNA y qRT-PCR para determinar lentivirales mediada Id1 niveles de expresión, como en Colas et al. (2012) 4.
    Nota: Importante: si niveles de expresión de mRNA de Id1 están menores que 0.005 veces de niveles de expresión de la GAPDH (ver tabla 3 para imprimaciones de qRT-PCR), repita el proceso de infección descrita hasta superan los niveles de la expresión de Id1 el umbral.

2. hPSCsId1 mantenimiento

  1. HPSCsId1 en placas de pocillos 6 revestidas de la cultura y crezca en 3 mL por pocillo de la célula de vástago medios suplementada con 6 puromicina μg/mL.
  2. Cuando hPSCsId1 llegar a 80% de confluencia, las células de paso como agregados (1:6 split ratio) con reactivo de disociación enzima libre siguiendo las instrucciones del proveedor y crecen en 3 mL por pocillo de la célula de vástago medios suplementada con 6 puromicina μg/mL.

3. preparación de hPSCsId1 para la diferenciación

  1. Cubrir una placa de 12 pozos con 500 μl por pocillo del reactivo de capa.
  2. Cuando hPSCsId1 alcanzar 90% confluencia disociar las células añadiendo 1 mL de PBS sin Ca2 + y Mg2 + y con 0,5 mM EDTA bien durante 5 – 10 minutos Compruebe proceso disociación cada minuto, y una vez que el 80% de las células son disociado de la placa , proceder al siguiente paso.
  3. Recoger la suspensión de células en un tubo de centrífuga.
  4. Neutralizar el reactivo de disociación con 5 mL de PBS que contenga Ca2 + y Mg2 +.
  5. Pellet de células por centrifugación (200 x g durante 3 min).
  6. Eliminar el sobrenadante y chasquear suavemente el tubo para desalojar la pelotilla.
  7. Resuspenda las células en 2 mL de células madre medios suplementados con 2 inhibidor de camino de RHO/ROCK μm.
  8. Contar las células usando un contador de células automatizado.
  9. Células de la placa 300.000 por bien en 1 mL de células madre medios suplementados con 2 μm RHO/ROCK vía inhibidor y 6 puromicina μg/mL y placa de transferencia en incubadora de cultivo de tejidos.
  10. Actualizar los medios de comunicación diariamente con 2 mL de células madre medios suplementados con puromicina μg/mL 6 culturas hasta el 90% de confluencia. En este punto, iniciar la diferenciación cardiaca (siguiente paso).

4. diferenciación de hPSCsId1 en primer corazón campo-como progenitores cardiacos (CPs FHF-L)

  1. Para el formato de placa de 12 pozos, iniciar la diferenciación (día 0) mediante la sustitución de los medios de comunicación de la célula de vástago con 1,5 mL de medio de inducción (tabla 1) complementado con activina (100 ng/mL) (ver tabla 2 para recomienda volúmenes y Activin A concentraciones de placa diferentes formatos).
  2. El día 1 (24 h después de iniciada la diferenciación), sustituir los medios de comunicación con 2 mL de medio de inducción sin activina A (por pozo de una placa de 12 pozos).
  3. El día 3, sustituir los medios de comunicación con 2 mL de medio de inducción sin activina A (por pozo de una placa de 12 pozos).
  4. El día 5, recoger L FHF CPs para la criopreservación (siguiente paso).
    Nota: Importante: criopreservación se prefiere en este punto, ya que permite desacoplar la generación cardiacas progenitoras de cardiomiocitos posteriores lotes gran producción y Biobanco de células. Tenga en cuenta que como alternativa, día 5 CPs de FHF-L puede pasar a una placa recién revestida al continuar la diferenciación, por favor, consulte los pasos 5.1 – 5.5 a CPs passFHF-L y luego proceder a paso 6.5 para la diferenciación.

5. crioconservación de FHF-L CPs

  1. Aspirar todos los medios de los pozos que contienen día 5 L FHF CPs y rápidamente agregue 1 mL de caliente (37 ° C) 1 x reactivo de disociación que contiene la enzima (véase Tabla de materiales). Coloque la placa en la incubadora de cultivo de tejidos.
  2. Después de 1 minuto, agitar la placa en la incubadora de un lado a otro.
  3. Después de 2 minutos (tiempo total), extraiga la placa de la incubadora y añadir 1 mL de 10% FBS medios.
  4. Suavemente pipetear las células arriba y abajo con una pipeta de 5 mL para facilitar el desprendimiento de células de la placa.
  5. Recoger la suspensión de células a las células de tubo y de pellets de una centrífuga por centrifugación a 200 x g durante 3 min
  6. Resuspenda el precipitado de células en 2 mL de reactivo de criopreservación.
  7. Contar las células usando un contador de células automatizado.
  8. Añadir reactivo de criopreservación (véase Tabla de materiales) en un volumen suficiente para criopreservar las células de concentración deseada (normalmente 5-10 x 106 células/mL).
  9. Transferir las células a frascos de criopreservación y colocar los frascos en refrigeración dispositivo (1 ° C/min) y coloque el dispositivo de enfriamiento en el congelador de-80 ° C durante la noche.
  10. Después de 24 h, transferencia viales congelados en nitrógeno líquido para el almacenamiento a largo plazo.
    Nota: El protocolo se puede detener aquí.

6. FHF-L CP diferenciación en cardiomiocitos ventriculares como

  1. Transferencia frascos de día 5 L FHF CPs congelado de almacenamiento de nitrógeno líquido en recipiente de hielo seco.
  2. Colocar frascos en baño de agua de 37 ° C durante 2 a 3 minutos, hasta que la suspensión celular es descongelado por completo.
    Nota: Importante: el proceso de descongelación es sensible al tiempo. Exponer los medios de criopreservación de las células de una cantidad excesiva de tiempo (es decir, 10 min) disminuirá la viabilidad de las células.
  3. Transferir las células a 15 o 50 mL tubo de centrífuga, dependiendo del número de viales descongelados.
  4. Dispense gota a gota (5 gotas cada 30 segundos) precalentado (37 ° C) cardiogénico los medios de comunicación (tabla 1) a la solución de la célula. Continúe este proceso hasta una media de criopreservación de 1:3: cociente de medios cardiogénico es alcanzado. En este punto, aumentar la tasa de adición de medios cardiogénico hasta un 1:10 medios de criopreservación: relación medios cardiogénico se alcanza.
    Nota: Importante: cambios de osmolaridad rápido aumentará la muerte celular durante el proceso de descongelación; por lo tanto, adición gota a gota de medios cardiogénicas como se describe anteriormente es altamente recomendable.
  5. Centrifugar las células suspensión y pellet celular por centrifugación (200 x g durante 3 min).
  6. Eliminar el sobrenadante y flick suavemente el tubo de la centrífuga para remover el sedimento celulares.
  7. Resuspender las células con cardiogénicas medios suplementados con 2 inhibidor de camino de RHO/ROCK μm.
    Nota: Viabilidad de las células puede variar de deshielo al deshielo y, en general, > 65% viabilidad predice galjanoplastia de buena eficiencia.
  8. Diluido concentrado suspensión celular con cardiogénicas medios suplementados con 2 inhibidor de vía RHO/ROCK de μm para obtener la concentración deseada de la célula para placas (ver tabla 2 para placa diferentes formatos).
    Nota: Importante: tenga en cuenta que eficiencia diferenciación cardiaca puede disminuir si se siembran las células demasiado escaso.
  9. Células de la semilla en la placa.
  10. Mantenga la placa en la campana de cultivo de tejidos por 20 min antes de transferirla a incubadora de cultivo de tejidos.
  11. El día 6 de diferenciación, monitor accesorio celular.
    Nota: Progenitores cardiacos son congelados el día 5 de la diferenciación. 24 h después de descongelar las células sería el día 6 de la diferenciación.
    Nota: Es común la presencia de células (muertas) flotantes.
  12. En el día 7, Aspire el 50% de los medios de comunicación y sustituir por una cantidad igual de fresca media cardiogénico.
    Nota: La adición de inhibidor de la RHO/ROCK camino a los medios de comunicación cardiogénico no es necesaria, después de este punto.
  13. Reemplazar el 50% de los medios de comunicación con medios cardiogénicas cada otro día.
  14. Nota espontánea a aparece entre el día 11 y 13.
  15. El día 15, cuantificar la eficiencia cardiaca diferenciación por inmunofluorescencia usando DAPI (tinción de núcleo) y ACTC1 (marcador cardíaco de pan).

7. aprobación y mantenimiento de los cardiomiocitos ventriculares como

Nota: Día 14 – 16, debe obtenerse una capa monomolecular de contraer espontáneamente cardiomiocitos ventriculares como. En este punto, se sugiere disociar y volver a cardiomiocitos con el fin de homogeneizar la cultura y evitar que las células de extracción de la placa de la placa.

  1. Aspirar todos los medios de los pozos y rápidamente agregar 1 mL de precalentado (37 ° C) 1 x reactivo de disociación que contiene la enzima.
    Nota: 1 x volúmenes de reactivo de disociación que contiene la enzima varían dependiendo del formato de la placa, pero debe cubrir completamente la parte inferior de la superficie del pozo.
  2. Transferir la placa a una incubadora de cultivo de tejidos.
  3. Agite suavemente la placa de lado a lado cada 2 min dentro de la incubadora para acelerar el proceso de separación.
  4. Después de 5 – 15 min, 80% a 100% de las células son separado de la parte inferior de la placa, retire la placa de la incubadora e inhibir 1 x actividad de reactivo de disociación que contiene enzima mediante la adición de un volumen igual de medio de 10% FBS.
    Nota: Tiempo de incubación con la disociación que contiene enzima de x 1 para este proceso varía de lote a lote.
  5. Recoger la suspensión celular a un tubo de centrífuga.
  6. Mezcle la suspensión celular con pipeta y conteo de las células usando un contador de células automatizado.
  7. Diluir la suspensión celular de concentración de células deseada (véase tabla 2 para placa diferentes formatos) con los medios de mantenimiento suplementados con 2 inhibidor de camino de RHO/ROCK μm.
  8. Después de la siembra los cardiomiocitos en la placa, distribuya las células y permite a las células a conectar durante 10 – 20 min antes de transferir la placa a incubadora de cultivo de tejidos.
  9. 24 horas después de volver a platear, seguimiento de recuperación y adjunto de la celular.
    Nota: Es común la presencia de células (muertas) flotantes. 48 – 72 h después de volver a la galjanoplastia, cardiomiocitos deben reanudar la contracción espontánea.
  10. Para mantener la cultura de cardiomiocitos, reemplazar el 50% de los medios de comunicación con los medios de mantenimiento cada dos días hasta la utilización de cardiomiocitos ventriculares como para experimentos posteriores.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Generación de hPSCs Id1 líneas de
hPSCs están infectados por un lentivirus mediar Id1 sobreexpresión (figura 1A). Una vez que se generan hPSCId1 , expresión del transgen se cuantifica por qRT-PCR (figura 1B). HPSCId1 líneas expresan mRNA Id1 en niveles mayores que 0.005 veces el de GAPDH sólo deben utilizarse para la diferenciación.

hPSCs Id1 Mantenimiento y preparación para D ifferentiation
Condiciones de cultivo óptimas son necesarios críticos para éxito primera diferenciación del campo-como progenitora cardiaca (figura 2A) del corazón. hPSCId1 culturas deben vigilarse diariamente para mantenimiento de morfología del tallo y la continua proliferación. Diferenciación debe iniciarse cuando células apretadas colonias alcanzan > 90% de confluencia (figura 2B). Si la diferenciación se inicia antes de la confluencia óptima, muerte de la célula es mayor y eficiencia diferenciación puede disminuir (figura 2C). Del mismo modo, culturas overgrown interpretará mal (figura 2D).

Generación del primer corazón cardiaca como campo de progenitores (CPs FHF-L) de hPSCs Id1
El día 1 (iniciación de diferenciación 24 h post), las células deben ser vigiladas para observar la pérdida de la morfología del tallo (células aparecen más y más oscuro que las células madre). Observe que la muerte celular es común durante el primer día de la diferenciación, sino confluencia celular debe mantenerse en > 75% (figura 2E). Si después de 24 h de la diferenciación, el 50% o más de la superficie cubierta se pierde, las células deben ser descartadas.

El día 3, diferenciación de las células deben permanecer agrupadas y han llenado vacíos creados durante las 24 h inicial período de tiempo (figura 2F). Células planas creciendo independientemente son indicativas de condiciones subóptimas de diferenciación.

El día 4, diferenciación óptima debe mostrar la continua expansión y cobertura de la placa.

El día 5, las células son cosechadas y criopreservadas. Diferenciaciones óptimo deben resultar en racimos de célula sellada con aspecto de morfología homogénea (figura 2G). Tenga en cuenta que los racimos de células planas baja densidad marcan un resultado subóptimo de la diferenciación. Consulte la tabla 2 para el rendimiento promedio de día 5 progenitores cardiacos por pozo en varios formatos de la cultura.

Generación de cardiomiocitos ventriculares como de FHF-L CPs
Día 5 L FHF CPs son descongelados en placa formato dependiente densidades descritas en la tabla 2, para maximizar su potencial de diferenciación cardiaca (figura 3 y tabla 2). La viabilidad después de descongelar necesita ser monitoreada. En general, viabilidad oscila entre 70-80%. Si la viabilidad es inferior al 60%, se vería afectada la producción de cardiomiocitos.

El día 6 (24 h después de reasumir la diferenciación), debe cubrir L FHF CPs > 90% de la superficie y aparecen como una sola capa homogénea de las células (figura 3B). Bajo confluencia el día 6 reducirá diferenciación L FHF CPs en cardiomiocitos.

Cardiomiocitos resultantes empiezan a batir por día 11 – 13 de diferenciación (figura 3C y 1 película). Durante el proceso replating día 14 – 16, consulte la tabla 2 para el rendimiento promedio de cardiomiocitos por pozo en varios formatos de la cultura. Eficiencia de diferenciación es evaluado típicamente por inmunofluorescencia para cardiaco (ACTC1), fibroblastos (TAGLN) y marcadores endoteliales vasculares (CDH5) y marcadores nucleares (DAPI). Cuantificación de linaje se realiza mediante la cuantificación de la proyección de imagen y de la fluorescencia automatizada, como en Cunningham et al. (2017) 5 (D-Ede lafigura 3). Caracterización del subtipo de cardiomiocitos que se realiza por qRT-PCR (figura 3F) y análisis transitorio del potencial de acción usando proyección de imagen de cinética y voltaje detección de sondas (figura 3G y película 2). Cuantificación de la fluorescencia de la sonda de tensión y análisis de trazas de potencial de acción resultante (figura 3H) se realiza como se describe en McKeithan et al. (2017) 7.

Figure 1
Figura 1: generación de hPSCId1 líneas. (A) representación esquemática de la hPSCs protocolo de generación deId1 . (B) ejemplos de niveles de mRNA Id1 representativos lentivirales mediada por la expresión de distintas líneas de hPSCId1 incluyendo una línea de células y dos líneas de líneas de hPSC generados resultados qRT-PCR. Línea punteada representa el umbral de expresión de Id1 , debajo de que hPSCId1 líneas necesitan someterse a un ciclo adicional de la infección por lentivirus de Id1. "p" indica el número de paso. El número en paréntesis indica el número de rondas de infección Id1 lentivirales. Barras de error representan la desviación estándar de los experimentos llevados a cabo por triplicado. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: Generación del primer corazón Field-Like cardiaca progenitores (FHF-L CPs) diferenciación de hPSCId1. (A) representación esquemática del Protocolo de generación de FHF-L CP. Fotos de campo brillante representante de hPSCId1 (día 0) óptima (B), sub-confluente (puntas de flecha amarillas indican las regiones vacías entre las células) densidad (D) (C) y confluentes sobre. Cuadros representativos de campo claro de diferenciar hPSCId1 en día 1, 3 y 5 respectivamente (E) (F), (G). Barra de escala = 100 μm. haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: generación de cardiomiocitos ventriculares como de CPs FHF-L. (A) Representación esquemática de lo cardiomiocitos ventriculares como protocolo de generación. Imagen de campo brillante (B) de las células de diferenciación día 6 (un día post-descongelamiento). (C) imagen de campo claro de una cultura de la paliza de día 12. (D) imagen inmunofluorescencia representativas de las culturas día 15 (formato de la placa de 384 pocillos). ACTC1 marca cardiomiocitos, TAGLN: músculo liso y fibroblastos, CDH5: las células endoteliales vasculares y DAPI: núcleos (se muestra en el recuadro). (E) cuantificación de linaje de 15 culturas día. Datos de qRT-PCR (F) tiempo de expresión del curso del día 5 al día 25 de marcadores específicos de ventricular (IRX4 y MYL2) y marcador de pan-cardiaco (MYL7). (G) potencial de acción representativos rastro de cardiomiocitos ventriculares-como en el día 25 de diferenciación. (H) potencial de acción duración las mediciones (APD50 y90de la APD) de cardiomiocitos ventriculares como resultante (n = 12). Barras de error representan la desviación estándar de los experimentos llevados a cabo por cuadruplicado (a menos que se indique lo contrario). Barras de escala = 100 μm. RFU, unidad de fluorescencia relativa. Haga clic aquí para ver una versión más grande de esta figura.

Medio Medio de base Aditivo
Medios de comunicación de la célula de vástago mTesR1 n / a
Medios de inducción RPMI 1640 Medium B-27 suplemento libre de suero sin insulina, 1 x
Medios de inducción RPMI 1640 Medium Puromicina, 6 μg/ml
Medios de inducción RPMI 1640 Medium Penicilina-estreptomicina, 1 x
Los medios de comunicación cardiogénico RPMI 1640 Medium B-27 suplemento libre de suero, 1 x
Los medios de comunicación cardiogénico RPMI 1640 Medium Penicilina-estreptomicina, 1 x
Medios de mantenimiento RPMI 1640 Medium B-27 suplemento libre de suero, 1 x
Medios de mantenimiento RPMI 1640 Medium Nocaut en reemplazo de suero, 2%
Medios de mantenimiento RPMI 1640 Medium Penicilina-estreptomicina, 1 x

Tabla 1: Componentes de los medios de comunicación (véase tabla de materiales para medios de base y aditivos).

384 bien 96 pozo 12 bien 6 bien 100 mm 150 mm
Volumen de la capa (por bien) 10 ΜL 50 ΜL 500 ΜL 1 mL 5 mL 10 mL
Volumen medio
(por bien)
100 ΜL 300 ΜL 2 mL 5 mL 12 mL 30 mL
Diferenciación día 0 activin una concentración (ng/mL) 100 100 100 300
Progenitoras cardiacas
rendimiento día 5
(células/pocillo)
1,0 – 1,2 x 105 2.5-3.0 x 105 1.0-1.5 x 107 2.0 – 3.0 x 107
Progenitoras cardiacas día 5 replating o descongelando densidad (células/pocillo) 2.0 x 104 7.5 x 105 4.5 x 106 8.0 x 106 2.2 x 107
Cardiomiocitos ventriculares como
rendimiento día 14 – 16
(células/pocillo)
2.0-5.0 x 104 0.8 – 1.2 x 106 3.5 – 5.0 x 106 0.8 – 1.2 x 107 1.8 – 2.5 x 107
Cardiomiocitos ventriculares como replating densidad
(células/pocillo)
2.5 x 104 1.0 x 106 4.5 x 106 1.0 x 107 2.2 x 107

Tabla 2: Parámetros de diferenciación escalable (volumen de la capa, volumen medio, concentración de activina A, rendimientos, replating densidades).

Nombre gen Adhesión del Banco de genes Secuencia de
GAPDH NM_001256799 F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
ratón Id1 NM_010495 F: CCTAGCTGTTCGCTGAAGGC
R: CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 F: GGCTCCCCAGTTCTTGATGG
R: TAGACCGGGCAGTAGACCG
MYL2 NM_000432 F: TTGGGCGAGTGAACGTGAAAA
R: CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 F: GCCCAACGTGGTTCTTCCAA
R: CTCCTCCTCTGGGACACTC

Tabla 3: secuencias de la cartilla de qRT-PCR.

Movie 1
Película 1: grabación de campo brillante (100 cuadros/s) del día 15 cardiomiocitos que se pueden observar contracciones espontáneas. Por favor haga clic aquí para ver este video. (Clic derecho para descargar)

Movie 2
Película 2: cinética la proyección de imagen (100 cuadros/s) de la sonda fluorescente sensible al voltaje en día 25 id1-inducida los cardiomiocitos ventriculares como. Por favor haga clic aquí para ver este video. (Clic derecho para descargar)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Para diferenciaciones exitosas, asegúrese de seguir de cerca las instrucciones mencionadas anteriormente. Además, aquí se destacan los parámetros fundamentales que influyen fuertemente en los resultados de la diferenciación. Antes de iniciar una diferenciación, deben observarse los siguientes tres parámetros morfológicos: una morfología del tallo de hPSCsId1, una alta compactación celular y una confluencia alta (> 90%) de la cultura en el día 0. En ese sentido, mejor se crean condiciones de diferenciación óptima de galjanoplastia disociada hPSCsId1 como células individuales y permitiéndoles forma estrechamente agrupan monocapas que crecen a la confluencia de ~ 90% durante el transcurso de 2 a 3 días. Por el contrario, si hPSCId1 culturas muestran pobre celular y morfología de las colonias, Colonia baja compactación y la presencia de grandes áreas de diferenciación dentro de la cultura, diferenciación acertada de FHF-L CP es poco probable.

Volumen de los medios de comunicación y concentraciones de activina A son parámetros críticos de la FHF-L CP diferenciación y formato dependiente de la placa (ver tabla 2). También tenga en cuenta que concentraciones de activina A óptima pueden variar dependiendo de línea hPSC y puede requerir la optimización de la concentración.

Niveles de mRNA de Id1 en hPSCs son cruciales para promover eficientemente FHF-L CP subóptima Id1 niveles dejará de producir diferenciación de FHF-L CP robusta y se observa muerte celular masiva por día 1 de diferenciación. La relación de la expresión relativa de Id1- a -GAPDH debe exceder 0.005 para promover diferenciación eficiente. Selección continua con dosis más altas de puromicina (6 – 10 μg/mL) se recomienda para mantener altos niveles de expresión de Id1 lentivirales mediada. Una evaluación de los niveles de mRNA de Id1 se recomienda cada 10 pasajes.

Densidades del día 5 la galjanoplastia FHF-L CPsis también un parámetro crítico para la eficacia de diferenciación cardiaca. Si día 5 L FHF CPs se platean en bajas densidades, disminuirá la producción cardiaca relativa. Densidad óptima de la galjanoplastia se enumeran en la tabla 2 y es placa dependiente del formato.

La principal limitación de este protocolo es el uso de sobreexpresión de Id1 lentivirales mediada a la diferenciación de CP promoteFHF-L que puede restringir el uso terapéutico de progenitores resultantes y cardiomiocitos ventriculares como. También, puesto que lentivirus pueden integrar en sitios que podría potencialmente afectar hPSC mantenimiento o potencial de desarrollo, troncalidad de hPSCsId1 colonias deben ser vigilado por evaluar vástago de expresión génica y la observación de signos morfológicos de diferenciación. Nota que overexpressing Id1 utilizando vectores no Integrativa superar esta limitación y está siendo investigado actualmente en nuestro laboratorio.

Una característica conveniente de este método es la simplicidad del Protocolo de diferenciación ya que sólo requiere de una citoquina, Activin A, para generar L FHF CPs de hPSCsId1. En comparación, otros protocolos 9,10,11,12,13,14,15 requieren secuencias complejas combinaciones de citoquinas o moléculas pequeñas con el fin de promover y mantener la diferenciación cardiaca. Además, este protocolo describe únicamente un paso conveniente de criopreservación que permite desacoplar la generación de FHF-L CP de la producción de cardiomiocitos posterior. Esta función permite a los lotes grandes de Biobanco de FHF-L CPs y para rápidamente generar cardiomiocitos de progenitores congelados, como diferenciación cardiaca se reanuda desde el día 5 al descongelar. Esta estrategia permite para obtener 1 a 2 semanas de tiempo en comparación con diferenciación cardiaca a partir hPSCs. Además y lo más importante, este protocolo es el protocolo primero de fecha para generar progenitores cardiacos de origen de campo de corazón definido, mientras que otros protocolos9,10,11,12 ,13,14,15 siendo indefinido en ese sentido.

En Resumen, este protocolo describe un método robusto y escalable para producir grandes cantidades (> de8– 10 109) relevantes para el desarrollo de FHF-L de CPs y cardiomiocitos ventriculares como. A su vez, las células resultantes pueden utilizarse para identificar nuevos caminos reguladoras control de diferenciación cardiaca y fisiología y Regenerativa y modelado de efectos de la enfermedad.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Agradecemos a los miembros del laboratorio de Colas para discusiones útiles y crítica del manuscrito. Este estudio fue apoyado por NIH/NIEHS R44ES023521-02 y CIRM DISC2-10110 otorga al Dr. Colas.

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics