Generation av första hjärtat fält-liknande hjärt stamfäder och ventrikulära-liknande hjärtmuskelcellerna från mänskliga pluripotenta stamceller

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Här beskriver vi en skalbar metod, med en enkel kombination av Activin A och lentivirus-medierad Id1-överuttryck, för att generera första hjärtat fält-liknande hjärt stamfäder och ventrikulära-liknande hjärtmuskelcellerna från mänskliga pluripotenta stamceller.

Cite this Article

Copy Citation | Download Citations

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Generering av stora mängder funktionella mänskliga pluripotenta stamceller-derived hjärt stamfäder och hjärtmuskelceller definierade hjärtat fältet ursprung är en förutsättning för cellbaserade hjärt terapier och sjukdom modellering. Vi har nyligen visat att Id gener är både nödvändigt och tillräckligt att ange första hjärtat fältet föräldraparets under ryggradsdjur utveckling. Denna differentiering-protokollet utnyttjar dessa fynd och använder Id1 överuttryck i kombination med Activin A som potent ange ledtrådar för att producera första hjärtat fält-liknande (FHF-L) stamfäder. Ännu viktigare, differentieras resulterande föräldraparets effektivt (~ 70 – 90%) till ventrikulära-liknande hjärtmuskelcellerna. Här beskriver vi en detaljerad metod för att 1) generera Id1-överuttryck hPSCs och 2) skilja skalbara mängder cryopreservable FHF-L stamfäder och ventrikulära-liknande hjärtmuskelcellerna.

Introduction

Storskalig produktion av mänskliga pluripotenta stamceller (hPSCs)-härledda hjärt stamfäder och hjärtmuskelcellerna är en förutsättning för stamceller-baserade behandlingar1, sjukdom modellering2,3 och snabba karakterisering av nya vägar reglerar hjärt differentiering4,5,6 och fysiologi7,8. Även om ett antal studier9,10,11,12,13,14beskrivit,15 tidigare högeffektiva hjärt differentiering protokoll från hPSCs, har ingen tagit upp hjärtat fältet ursprung resulterande hjärtmuskelceller, trots identifiering av betydande molekylära skillnader mellan vänster (första hjärtat fält) och höger (andra hjärtat field) ventrikulär hjärtmuskelcellerna16 och förekomsten av hjärtat branschvisa medfödda hjärtsjukdomar; dvs, hypoplastisk vänster hjärta syndrom17 eller Högerkammarfunktion höger kammare dysplasi18. Således generationen av hjärt stamfäder och hjärtmuskelceller av definierade hjärtat fältet ursprung från hPSCs blir en nödvändighet för att öka deras relevans som terapeutiska och sjukdom modelleringsverktyg.

Protokollet bygger på den konstituerande överuttryck av Id1, en nyligen identifierade5 första hjärtat fält-ange cue som i kombination med Activin A, är både nödvändig och tillräcklig för att inleda cardiogenesis i hPSCs. Noterbart Cunningham et al. (2017) 5 Visa att Id1-inducerad föräldraparets särskilt uttrycka första hjärtat fältet (HCN4, TBX5) men inte andra hjärtat Fältmarkörer (SIX2, ISL1) som de genomgår hjärt differentiering. Dessutom visar författarna också att transgena möss embryon saknas hela Id familjen av gener (Id1-4), utveckla utan att bilda första hjärtat fältet hjärt progenitorceller, medan fler mediala och bakre hjärt stamfäder ( andra hjärtat fältet) kan fortfarande bilda, tyder därmed på att ID-proteiner är nödvändigt att inleda första hjärtat fältet cardiogenesis i vivo. Bekvämt, Id1-inducerad föräldraparets kan förvaras i fryst tillstånd och spontant differentieras till hjärtmuskelcellerna visar ventrikulära-liknande egenskaper, inklusive ventrikulär-specifika markörer (IRX4, MYL2) uttryck och ventrikulär-liknande handlingspänningar.

Här beskriver vi en enkel och skalbar metod för att generera första hjärtat fält-liknande (FHF-L) hjärt stamfäder och ventrikulära-liknande hjärtmuskelcellerna från Id1 överuttryck av hPSCs. Ett viktigt inslag i detta protokoll är möjligheten att avskilja hjärt stamceller generation från efterföljande hjärtmuskelcellen produktion med hjälp av ett praktiskt frysförvaring steg. Sammanfattningsvis, detta protokoll Detaljer nödvändiga åtgärder för att (1) generera Id1-överuttryck hPSCs, (2) generera FHF-L hjärt stamfäder från hPSCs, (3) frysa resulterande stamfäder och (4) återuppta FHF-L hjärt stamceller differentiering och generera höganrikat (> 70 – 90%) slog ventrikulära-liknande hjärtmuskelcellerna.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Id1 Virus förberedelse och infektion

  1. Generera Id1 överuttryck lentivirus genom samarbete transfecting pCMVDR8.74, pMD2.G och pCDH-EF1-Id1-PGK-PuroR (Addgene: plasmid #107735) i HEK293T celler. Samla in viruspartiklar, filtrat, rena från supernatanten och förvaras vid-80 ° C som i Kitamura o.a. (2003) 19. Alternativt producera Id1 lentivirus kommersiellt genom att skicka pCDH-EF1-Id1-PGK-PuroR till en lentivirus-producerande leverantör.
    Varning: Följ lentiviral säkerhetsföreskrifter och standarddrift protokoll.
    Obs: Viktigt: Optimal virus titer bör vara minst 108 109 Transducing enheter/mL (TU/mL).
  2. Före infektion, coat en väl 96 väl platta med 50 µl beläggning reagens, vanligtvis en geléartad protein blandning utsöndras av Engelbreth-Holm-Swarm mus sarkom celler (se Tabell för material).
  3. Separera en brunn av pluripotenta stamceller som odlas i en 6 väl plattan genom att tillsätta 1 mL PBS utan Ca2 + och Mg2 + och med 0,5 mM EDTA.
    Obs: Dissociation tid varierar från 3 – 10 min. När mer än 80% av cellerna är fristående från botten av plattan, Fortsätt till nästa steg.
  4. Samla cellsuspension med steril Pipettera i 15 mL plast centrifugrör.
  5. Neutralisera dissociation reagens med 5 mL PBS-innehållande Ca2 + och Mg2 +.
  6. Pellet celler genom centrifugering (200 x g för 3 min).
  7. Ta bort supernatanten och knacka försiktigt röret för att rubba pelleten.
  8. Resuspendera cellerna i 1 mL av stamceller media.
  9. Räkna celler med en automatisk cell räknare efter leverantörens anvisningar.
  10. Plattan 20.000 viabla celler per behandlad väl (plattan med 96 brunnar) i 50 µL av stamceller media kompletteras med 2 µM RHO/ROCK pathway inhibitor (se tabellerna 1 och 2).
  11. Efter 24 h, övervaka för cell fastsättning och ersätta media med 100 µl stamceller media kompletteras med 2 µM RHO/ROCK pathway inhibitor och 6 ng/mL hexadimethrine metylbromid (se tabellerna 1 och 2), en h före lentiviral infektion.
    Obs: Celler bör sättas fast botten av plattan.
  12. Tina Id1-lentivirus på is.
  13. Tillsätt 3 µL av renat lentivirus per brunn (virus titer bör vara mellan 108 109 TU/mL), och sedan överföra plattan tillbaka till cellen kultur inkubator (37 ° C, 5% CO2, 20% O2).
  14. 24 h efter virusinfektion, tillsätt 100 µL av färska stamceller media till infekterade celler.
  15. 48 h efter lentiviral infektion, Ersätt virus som innehåller media med 200 µL av färska stamceller media kompletteras med 1 µg/mL puromycin.
  16. Uppdatera media dagligen med 200 µL av stamceller media kompletteras med 1 µg/mL puromycin.
  17. När kulturer når 80% konfluens, separera celler med 200 µL av PBS utan Ca2 + och Mg2 + + 0,5 mM EDTA (för en brunn av en plattan med 96 brunnar).
  18. Samla in cellsuspension i ett centrifugrör.
  19. Neutralisera dissociation reagens med 5 mL PBS-innehållande Ca2 + och Mg2 +.
  20. Pellet celler genom centrifugering (200 x g för 3 min).
  21. Ta bort supernatanten och knacka försiktigt röret för att rubba pelleten.
  22. Resuspendera cellerna i 1 mL av stamceller media kompletteras med 2 µM RHO/ROCK pathway inhibitor.
  23. Överföra alla celler (1 mL) till en belagd väl av en 12-bra platta.
  24. Efter 24 h, monitor för cell fastsättning till brunnen och ersätta mediet med 1 mL av stamceller media kompletteras med 2 µM RHO/ROCK pathway inhibitor och 6 ng/mL hexadimethrine metylbromid, en h före transduktion.
  25. Tina Id1-lentivirus på is.
  26. Tillsätt 5 µL av renat virus per brunn (12-well platta).
  27. 24 h efter lentiviral infektion, Ersätt virus som innehåller media med 1 mL färsk stamceller media kompletteras med 3 µg/mL puromycin.
  28. 48 h efter lentiviral infektion, ersätta virus som innehåller media med 1 mL färsk stamceller media kompletteras med 6 µg/mL puromycin.
  29. När kulturer når 80% konfluens, separera celler med 500 µL av PBS utan Ca2 + och Mg2 + och med 0,5 mM EDTA (för ett väl 12-well platta).
  30. Överföra hälften (250 µL) av cellsuspensionen till en brunn ett beläggning reagens belagda 6-väl plåt innehållande 2 mL stamceller media kompletteras med 2 µM RHO/ROCK pathway inhibitor.
  31. Använd den andra hälften (250 µL) av provet för RNA-extraktion och qRT-PCR för att fastställa lentiviral-medierad Id1 uttryck nivåer, liksom Colas o.a. (2012) 4.
    Obs: Viktigt: om Id1 mRNA-uttrycksnivåerna är lägre än 0,005 fold GAPDH uttryck nivåer (se tabell 3 för qRT-PCR primers), upprepa infektionsprocessen som beskrivs ovan tills Id1 uttrycksnivåerna överstiger den tröskelvärdet.

2. hPSCsId1 underhåll

  1. Kultur hPSCsId1 i 6 väl-plattorna och växa i 3 mL per brunn av stamceller media kompletteras med 6 µg/mL puromycin.
  2. När hPSCsId1 når 80% konfluens, passage celler som aggregat (1:6 delningsfaktorn) med hjälp av enzym-fri dissociation reagens efter leverantörens riktlinjer och växa i 3 mL per brunn av stamceller media kompletteras med 6 µg/mL puromycin.

3. förberedelse av hPSCsId1 för differentiering

  1. Coat en 12-well platta med 500 µL per brunn beläggning reagens.
  2. När hPSCsId1 nå 90% konfluens separera celler genom att tillsätta 1 mL PBS utan Ca2 + och Mg2 + och med 0,5 mM EDTA per brunn för 5 – 10 min. Kontrollera dissociation processen varje minut, och en gång 80% av cellerna dissocieras från plattan , Fortsätt till nästa steg.
  3. Samla in cellsuspension i ett centrifugrör.
  4. Neutralisera dissociation reagens med 5 mL PBS-innehållande Ca2 + och Mg2 +.
  5. Pellet celler genom centrifugering (200 x g för 3 min).
  6. Ta bort supernatanten och knacka försiktigt röret för att rubba pelleten.
  7. Resuspendera cellerna i 2 mL stamceller media kompletteras med 2 µM RHO/ROCK pathway inhibitor.
  8. Räkna celler med en automatisk cell räknare.
  9. Plattan 300 000 celler per brunn i 1 mL av stamceller media kompletteras med 2 µM RHO/ROCK pathway inhibitor och 6 µg/mL puromycin och överföring plattan i vävnadsodling inkubator.
  10. Uppdatera media dagligen med 2 mL stamceller media kompletteras med 6 µg/mL puromycin tills kulturer når 90% konfluens. Vid denna punkt, initiera hjärt differentiering (nästa steg).

4. differentiering av hPSCsId1 in första hjärtat fält-liknande hjärt stamfäder (FHF-L CPs)

  1. För 12-well platta format, initiera differentiering (dag 0) genom att ersätta stamceller media med 1,5 mL induktion media (tabell 1) kompletteras med Activin (100 ng/mL) (se tabell 2 för rekommenderat volymer och Activin A koncentrationer för olika platta format).
  2. Dag 1 (24 h efter differentiering initieras), ersätta media med 2 mL av induktion media utan Activin A (per brunn 12-well platta).
  3. Dag 3, ersätta media med 2 mL av induktion media utan Activin A (per brunn 12-well platta).
  4. Dag 5, samla FHF-L CPs för frysförvaring (nästa steg).
    Obs: Viktigt: frysförvaring föredras vid denna punkt, eftersom det gör det möjligt för att avskilja hjärt stamceller generation från efterföljande hjärtmuskelcellen produktion och biobank stora partier av celler. Som alternativt dag 5 FHF-L CPs kan föras till en färsk belagd plåt att fortsätta differentiering, se steg 5.1 – 5.5 till passFHF-L CPs och fortsätt sedan till steg 6,5 för differentiering.

5. Frysförvaring av FHF-L CPs

  1. Aspirera alla medier från brunnar som innehåller dag 5 FHF-L CPs och snabbt tillsätt 1 mL varm (37 ° C) 1 x enzym-innehållande dissociation reagens (se Tabell för material). Placera plattan i vävnadsodling inkubatorn.
  2. Efter 1 min, skaka plåt sida till sida i inkubatorn.
  3. Efter 2 min (total tid), ta bort plattan från inkubatorn och tillsätt 1 mL 10% FBS media.
  4. Försiktigt Pipettera celler upp och ner med en 5 mL Pipettera att underlätta cell lossnar från plåten.
  5. Samla cellsuspension till en Centrifugera röret och pellet celler genom centrifugering vid 200 x g i 3 min
  6. Återsuspendering cellpelleten i 2 mL frysförvaring reagens.
  7. Räkna celler med en automatisk cell räknare.
  8. Lägg till frysförvaring reagens (se Tabell för material) på en tillräcklig volym för att frysa cellerna på önskad koncentration (vanligen 5 – 10 x 106 celler/mL).
  9. Överföra celler till frysförvaring injektionsflaskor och placera injektionsflaskor i kylning enhet (1 ° C/min) och placera kylapparaten i-80 ° C frys över natten.
  10. Efter 24 h, överföra frysta injektionsflaskor till flytande kväve för långtidsförvaring.
    Obs: Protokollet kan pausas här.

6. FHF-L CP differentiering till ventrikulära-liknande hjärtmuskelcellerna

  1. Överföra dag 5 FHF-L CPs frysta injektionsflaskor från flytande kväve lagring i torris behållare.
  2. Placera injektionsflaskor i 37 ° C vattenbad för 2 till 3 min, tills cellsuspension är tinat helt.
    Obs: Viktigt: upptining processen är tidskänsliga. Utsätta celler till frysförvaring media för en överdriven mängd tid (dvs. 10 min) minskar cellernas viabilitet.
  3. Överföra celler till 15 eller 50 mL centrifugrör, beroende på antalet upptinade injektionsflaskor.
  4. Dosera droppvis (5 droppar varje 30 sekunder) före värmde (37 ° C) kardiogen media (tabell 1) till cell lösning. Fortsätt med detta tills en 1:3 frysförvaring media: kardiogen media baserat nås. Vid denna punkt, öka kardiogen media tillägg hastigheten tills en 1:10 frysförvaring media: kardiogen media baserat nås.
    Obs: Viktigt: snabba osmolaritet förändringar kommer att öka celldöd under upptining processen; Därför rekommenderas droppvis tillägg av kardiogen media som beskrivs ovan.
  5. Centrifugera cell fjädring och pellet celler genom centrifugering (200 x g för 3 min).
  6. Ta bort supernatanten och knacka försiktigt centrifugrör rubba cellpelleten.
  7. Resuspendera cellerna med kardiogen media kompletteras med 2 µM RHO/ROCK pathway inhibitor.
    Obs: Cellviabiliteten kan variera från islossning till Tina och, i allmänhet, > 65% viabilitet förutspår bra plätering effektivitet.
  8. Späd koncentrerad cellsuspension med kardiogen media kompletteras med 2 µM RHO/ROCK pathway inhibitor att erhålla önskad cellkoncentrationen för plätering (se tabell 2 för olika platta format).
    Obs: Viktigt: Observera att hjärt differentiering effektivitet kan sjunka om celler är seedade alltför glest.
  9. Utsäde celler på tallrik.
  10. Hålla plattan i vävnadsodling huven i 20 min innan den överförs till vävnadsodling inkubator.
  11. På dag 6 av differentiering, övervaka cell fastsättning.
    Obs: Hjärt stamfäder är fryst tillstånd på dag 5 av differentiering. 24 h efter upptining cellerna skulle vara på dag 6 av differentiering.
    Obs: Förekomsten av flytande (döda) celler är vanligt.
  12. Dag 7, sug ut 50% av media och ersätta med en lika stor mängd färska kardiogen media.
    Obs: Tillägg av RHO/ROCK pathway inhibitor till kardiogen media är inte nödvändigt efter denna tidpunkt.
  13. Byt ut 50% av media med kardiogen media varannan dag.
  14. Observera spontana slog som visas mellan dag 11 och dag 13.
  15. På dag 15, kvantifiera hjärt differentiering effektivitet genom immunofluorescens använder DAPI (nucleus fläcken) och ACTC1 (pan-kardiell markör).

7. passerar och underhåll av ventrikulära-liknande hjärtmuskelcellerna

Obs: Vid dag 14 – 16, en enskiktslager av spontant upphandlande ventrikulära-liknande hjärtmuskelcellerna bör uppnås. Vid denna punkt, föreslås det att dissociera och åter tallrik hjärtmuskelcellerna för att homogenisera kulturen och förhindra celler från lossa från plåten.

  1. Sug ut alla medier från brunnar och snabbt tillsätt 1 mL före värmde (37 ° C) 1 x enzym-innehållande dissociation reagens.
    Obs: 1 x enzym-innehållande dissociation reagens volymer varierar beroende på plattan format, men bör helt täcka botten av väl ytan.
  2. Över plattan till en vävnadskultur inkubator.
  3. Skaka försiktigt platta sida till sida varje 2 min släpper inkubatorn påskynda avlossning.
  4. Efter 5 – 15 min, när 80% till 100% av cellerna är fristående från botten av plattan, avlägsna plattan från inkubatorn och hämma 1 x enzym-innehållande dissociation reagens aktivitet genom att lägga till en lika stor volym av 10% FBS media.
    Obs: Inkubationstiden med 1 x enzym-innehållande dissociation för denna process kommer att variera från sats till sats.
  5. Samla cellsuspension till ett centrifugrör.
  6. Blanda cellsuspension med Pipettera och räkna celler som använder en automatiserad cell räknare.
  7. Späd cellsuspension till önskad cell koncentration (se tabell 2 för olika platta format) med underhållsmassmedia kompletteras med 2 µM RHO/ROCK pathway inhibitor.
  8. Efter sådd hjärtmuskelceller på plattan, fördela cellerna jämnt och låta cellerna att bifoga för 10 – 20 min innan du överför plattan till vävnadsodling inkubator.
  9. 24 h efter åter plätering, övervaka cell fastsättning och återhämtning.
    Obs: Förekomsten av flytande (döda) celler är vanligt. 48 – 72 timmar efter åter plätering, hjärtmuskelcellen bör återuppta spontan kontraktion.
  10. För att bibehålla hjärtmuskelcellen kultur, ersätta 50% av media med underhållsmassmedia varannan dag tills användning av ventrikulära-liknande hjärtmuskelcellerna för efterföljande experiment.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Generation av hPSCs Id1 linjer
hPSCs är infekterad med ett lentivirus som medla Id1 överuttryck (figur 1A). När hPSCId1 genereras, kvantifieras transgenens uttryck av qRT-PCR (figur 1B). Endast hPSCId1 rader uttrycka Id1 mRNA på nivåer som är större än 0,005 hudveck som för GAPDH bör användas för differentiering.

hPSCs Id1 Underhåll och förberedelse för D ifferentiation
Optimala odlingsbetingelser är nödvändiga och viktiga för framgångsrik första hjärta fält-liknande hjärt stamceller differentiering (figur 2A). hPSCId1 kulturer bör övervakas dagligen för stem morfologi underhåll och kontinuerlig spridning. Differentiering bör initieras när tätt packade stamceller kolonier når > 90% konfluens (figur 2B). Om differentiering inleds före optimal konfluens, celldöd förstärks och differentiering effektivitet försämras (figur 2C). Likaså utför igenvuxna kulturer dåligt (figur 2D).

Generation av första hjärtat fält-liknande hjärt stamfäder (FHF-L CPs) från hPSCs Id1
Dag 1 (24 h post differentiering initiering), bör celler övervakas för att observera förlust av stamceller morfologi (celler visas plattare och mörkare än stamceller). Observera att celldöd är vanligt under första dagen av differentiering, men cellen sammanflödet bör bibehållas på > 75% (figur 2E). Om efter 24 h av differentiering, 50% eller mer av täckt yta är förlorat, kasseras celler.

Dag 3, särskiljande cellerna bör förbli klustrade och har fyllt luckorna som skapats under de första 24 h tid (figur 2F). Platta celler växer självständigt är indikativa för suboptimala differentiering villkor.

På dag 4, bör optimal differentiering Visa fortsatt expansion och täckning av plattan.

Dag 5, celler skördas och fryst tillstånd. Optimal differentieringar bör resultera i tätt anslutna cell kluster med homogena morfologi utseende (figur 2G). Observera att låg densitet kluster av platta celler Markera ett suboptimalt differentiering resultat. Se tabell 2 för den genomsnittliga avkastningen i dag 5 hjärt föräldraparets per brunn i olika kultur format.

Generation av ventrikulära-liknande hjärtmuskelcellerna från FHF-L CPs
Dag 5 FHF-L CPs är tinade vid plattan format-beroende tätheter beskrivs i tabell 2, för att maximera deras potentiella kardiella differentiering (figur 3A och tabell 2). Livskraft efter upptining måste övervakas. I allmänhet lönsamhet varierar mellan 70 – 80%. Om lönsamheten är lägre än 60%, skulle avkastningen av hjärtmuskelceller påverkas.

Dag 6 (24 h efter återuppta differentiering), FHF-L CPs bör omfatta > 90% av de tillgängliga yta och visas som ett homogent skikt av celler (figur 3B). Låg sammanflödet på dag 6 kommer att minska FHF-L CPs differentiering in hjärtmuskelcellerna.

Resulterande hjärtmuskelcellerna börja slå genom dag 11 – 13 differentiering (figur 3C och film 1). Under dag 14 – 16 replating processen, se tabell 2 för den genomsnittliga avkastningen i hjärtmuskelcellerna per brunn i olika kultur format. Differentiering effektivitet bedöms vanligtvis genom immunofluorescens för hjärt (ACTC1), fibroblast (TAGLN) och vaskulär endotelial markörer (CDH5) och kärnkraft (DAPI) markörer. Lineage kvantifiering utförs med hjälp av automatiserad bildbehandling och fluorescens kvantifiering, liksom Cunningham et al. (2017) 5 (figur 3D-E). Undertyp karakterisering av resulterande hjärtmuskelcellerna utförs av qRT-PCR (figur 3F) och aktionspotential övergående analys med kinetic imaging och spänning avkänning sonder (figur 3G och Movie 2). Fluorescens kvantifiering för spänning sonden och resulterande aktionspotential spåranalys (figur 3H) utförs enligt beskrivningen i McKeithan et al. (2017) 7.

Figure 1
Figur 1: Generation av hPSCId1 linjer. (A) Schematisk bild av hPSCs protokoll för generering avId1 . (B) exempel på qRT-PCR-resultat visar representativa Id1 mRNA nivåer som genereras av lentiviral-medierade uttryck från distinkta rader hPSCId1 inklusive en hESC rad och två rader av hPSC linjer. Streckad linje representerar Id1 uttrycket tröskel, nedanför vilken hPSCId1 linjer behöver genomgå en ytterligare cykel av Id1-lentivirus infektion. ”p” anger passage. Siffran i parentesen anger antalet omgångar av Id1-lentiviral infektion. Felstaplar representera standardavvikelsen för experiment som utförs i tre exemplar. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: Generation av första hjärtat Field-Like hjärt stamfäder (FHF-L CPs) differentiering från hPSCId1. (A) schematisk representation av protokollet FHF-L CP generation. Representativa ljusa fält bilder av hPSCId1 (dag 0) vid optimal (B), sub konfluenta (gula pilspetsar ange ogiltiga regionerna mellan celler) (C) och över konfluenta (D) tätheter. Representativa ljusa fält bilder att differentiera hPSCId1 dag 1, 3 och 5 respektive (E), (F), (G). Skalstapeln = 100 µm. vänligen klicka här för att visa en större version av denna siffra.

Figure 3
Figur 3: Generation av ventrikulära-liknande hjärtmuskelcellen från FHF-L CPs. (A) Schematisk bild av ventrikulära-liknande hjärtmuskelcellen generation protokollet. (B) ljusa fältet bild av dag 6 differentiering cellerna (en dag efter upptining). (C) ljusa fältet bild av en dag 12 slå kultur. (D) representativa immunofluorescens bild av dag 15 kulturer (plattan med 384 brunnar-format). ACTC1 markerar hjärtmuskelceller, TAGLN: fibroblaster/glatt muskulatur, CDH5: vaskulära endotelceller och DAPI: kärnor (visas i infällt). (E) härstamning kvantifiering av dag 15 kulturer. (F) qRT-PCR data gång kursen uttryck från dag 5 till dag 25 av ventrikulära-specifika markörer (IRX4 och MYL2) och pan-kardiell markör (MYL7). (G) representativ aktionspotential spår från ventrikulära-liknande hjärtmuskelceller på dag 25 av differentiering. (H) aktionspotential Spellängd mätningar (APD50 och APD90) av resulterande ventrikulära-liknande hjärtmuskelcellerna (n = 12). Felstaplar representera standardavvikelsen för experiment som utförs i fyra exemplar (om inget annat anges). Skala barer = 100 µm. RFU, relativa fluorescens enhet. Klicka här för att se en större version av denna siffra.

Medium Bas medium Tillsats
Stem Cell Media mTesR1 ej tillämpligt
Induktion Media RPMI 1640 Medium B-27 Serum-fri tillägg utan insulin, 1 x
Induktion Media RPMI 1640 Medium Puromycin, 6 µg/ml
Induktion Media RPMI 1640 Medium Penicillin-Streptomycin, 1 x
Kardiogen Media RPMI 1640 Medium B-27 Serum-fri tillägg, 1 x
Kardiogen Media RPMI 1640 Medium Penicillin-Streptomycin, 1 x
Underhållsmassmedia RPMI 1640 Medium B-27 Serum-fri tillägg, 1 x
Underhållsmassmedia RPMI 1640 Medium KnockOut Serum Replacement, 2%
Underhållsmassmedia RPMI 1640 Medium Penicillin-Streptomycin, 1 x

Tabell 1: Media-komponenter (se tabell av material för base media och tillsatser).

384 väl 96 väl 12 väl 6 väl 100 mm 150 mm
Beläggning volym (per brunn) 10 ΜL 50 ΜL 500 ΜL 1 mL 5 mL 10 mL
Medelhög volym
(per brunn)
100 ΜL 300 ΜL 2 mL 5 mL 12 mL 30 mL
Differentiering dag 0 activin en koncentration (ng/mL) 100 100 100 300
Hjärt stamceller
dag 5 avkastning
(celler/Ja)
1,0 – 1,2 x 105 2,5 – 3,0 x 105 1,0-1,5 x 107 2.0 – 3.0 x 107
Hjärt stamceller dag 5 replating eller upptining densitet (celler per brunn) 2.0 x 104 7,5 x 105 4,5 x 106 8,0 x 106 2,2 x 107
Ventrikelflimmer-liknande hjärtmuskelcellen
dag 14 – 16 avkastning
(celler/Ja)
2.0 – 5,0 x 104 0,8 – 1,2 x 106 3.5 – 5,0 x 106 0,8 – 1,2 x 107 1,8-2,5 x 107
Ventrikelflimmer-liknande hjärtmuskelcellen replating densitet
(celler/Ja)
2,5 x 104 1,0 x 106 4,5 x 106 1,0 x 107 2,2 x 107

Tabell 2: Skalbar differentiering parametrar (beläggning volym, medelhög volym, Activin A koncentration, avkastning, replating tätheter).

Gen namn Genbanken anslutning Sekvens
GAPDH NM_001256799 F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
mus Id1 NM_010495 F: CCTAGCTGTTCGCTGAAGGC
R: CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 F: GGCTCCCCAGTTCTTGATGG
R: TAGACCGGGCAGTAGACCG
MYL2 NM_000432 F: TTGGGCGAGTGAACGTGAAAA
R: CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 F: GCCCAACGTGGTTCTTCCAA
R: CTCCTCCTCTGGGACACTC

Tabell 3: qRT-PCR primer sekvenser.

Movie 1
Film 1: ljusa fält inspelning (100 bildrutor/s) av dag 15 hjärtmuskelceller där spontana sammandragningar kan observeras. Vänligen klicka här för att se denna video. (Högerklicka för att ladda ner.)

Movie 2
Movie 2: Kinetic imaging (100 bildrutor/s) för spänningskänsliga fluorescerande probe i dag 25 id1-inducerad ventrikulära-liknande hjärtmuskelcellerna. Vänligen klicka här för att se denna video. (Högerklicka för att ladda ner.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

För framgångsrika differentieringar, se till att noga följa instruktionerna ovan. Dessutom här lyfter vi fram viktiga parametrar som starkt påverkar differentiering utfall. Innan du börjar en differentiering, följande tre morfologiska parametrar bör följas: en stam morfologi av hPSCsId1, en hög cellulära packning och en hög sammanflödet (> 90%) av kulturen på dag 0. I detta avseende optimal differentiering villkor skapas bäst av plätering dissocierade hPSCsId1 som enstaka celler och ger dem möjlighet att bilda tätt klustrade enskiktslager som växer till ~ 90% sammanflödet under 2 till 3 dagar. Omvänt, om hPSCId1 kulturer visar dålig cell och kolonin morfologi, låg kolonin kompaktering och förekomsten av stora områden av differentiering inom kulturen, framgångsrika FHF-L CP differentiering är osannolikt.

Mediavolymen och Activin A koncentrationer är kritiska parametrarna för FHF-L CP differentiering och platta format-beroende (se tabell 2). Också Observera att optimal Activin A koncentrationerna kan variera beroende på använt hPSC linje och kan kräva koncentration optimering.

Id1 mRNA nivåer i hPSCs är avgörande för att effektivt främja FHF-L CP. suboptimala Id1 nivåer kommer att misslyckas att producera robusta FHF-L CP differentiering och massiva celldöd av dag 1 av differentiering kommer att iakttas. Den relativa uttryck Id1- till -GAPDH måste överstiga 0,005 för att främja effektiv differentiering. Fortsatt urval använder högre doser av puromycin (6 – 10 µg/mL) rekommenderas för att bibehålla höga nivåer av lentiviral-medierad Id1 uttryck. En utvärdering av Id1 mRNA nivåer rekommenderas varje 10 passager.

Plätering tätheter av dag 5 FHF-L CPsis också en kritisk parameter för hjärt differentiering effektivitet. Om dag 5 FHF-L CPs är klädd vid låga tätheter, relativa hjärt avkastningen kommer att minska. Optimal plätering tätheter listas i tabell 2 och är platta format-beroende.

Den största begränsningen för detta protokoll är användningen av lentiviral-medierad Id1 överuttryck till promoteFHF-L CP differentiering som kan begränsa den terapeutiska användningen av resulterande stamfäder och ventrikulära-liknande hjärtmuskelcellerna. Också, eftersom lentiviruses kan integrera på platser att kan potentiellt påverka hPSC underhåll eller utvecklingspotentialen, stemness av hPSCsId1 kolonierna bör övervakas genom att utvärdera hejda genuttryck och observera morfologiska tecken på differentiering. Observera att överuttryck Id1 använder icke-integrativ vektorer skulle övervinna denna begränsning och undersöks för närvarande i vårt laboratorium.

En praktisk funktion av denna metod är enkelheten i protokollet differentiering som det endast krävs en cytokin, Activin A, generera FHF-L CPs från hPSCsId1. I jämförelse, andra protokoll 9,10,11,12,13,14,15 kräver komplexa sekvenser av kombinationer av cytokiner och/eller små molekyler för att främja och upprätthålla hjärt differentiering. Dessutom beskriver detta protokoll unikt ett bekvämt frysförvaring steg som gör det möjligt för att avskilja FHF-L CP generation från efterföljande hjärtmuskelcellen produktion. Denna funktionen gör till biobank stora partier av FHF-L CPs och snabbt generera hjärtmuskelcellerna från frysta stamfäder, som hjärt differentiering återställs från dag 5 efter upptining. Denna strategi kan få 1 till 2 veckors tid jämfört med start hjärt differentiering från hPSCs. Dessutom, och viktigast av allt, är detta protokoll det första protokollet till datum att generera hjärt föräldraparets definierade hjärtat fältet ursprung, medan andra protokoll9,10,11,12 ,13,14,15 förblir odefinierad i detta hänseende.

I sammanfattning, här protokollet beskriver en robust och skalbar metod för att producera stora mängder (> 108– 109) av utvecklingsstörda-relevanta FHF-L CPs och ventrikulära-liknande hjärtmuskelcellerna. I sin tur resulterande celler kan användas för att identifiera nya föreskrivande vägar styra hjärt differentiering och fysiologi, och för regenerativ och sjukdom modellering ändamål.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Vi tackar medlemmar av Colas lab för bra diskussioner och kritiska omdömen om manuskriptet. Denna studie stöddes av NIH/NIEHS R44ES023521-02 och CIRM disk2-10110 beviljar för Dr. Colas.

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics