Geração do primeiro coração campo-como progenitores cardíaca e Cardiomyocytes Ventricular, como de células-tronco pluripotentes humanas

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aqui nós descrevemos um método dimensionável, usando uma simples combinação de Activin A e mediada por lentivirus Id1-superexpressão, para gerar a primeiras progenitores cardíaca como campo de coração e cardiomyocytes ventricular, como de células estaminais pluripotentes humanas.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A geração de grandes quantidades de progenitores de cardíacas derivadas de células-tronco pluripotentes humanas funcional e cardiomyocytes de origem de campo definido de coração é um pré-requisito para terapias cardíacas baseada em célula e modelagem de doença. Recentemente mostramos que genes de identificação são necessárias e suficientes para especificar primeiros progenitores de campo do coração durante o desenvolvimento de vertebrados. Este protocolo de diferenciação aproveita esses achados e usa Id1 superexpressão em combinação com o Activin A como potentes especificando sugestões para produzir o primeiros progenitores de (FHF-L) de campo-como de coração. Importante, resultante de progenitores diferenciarem eficientemente (~ 70-90%) em ventricular, como cardiomyocytes. Aqui nós descrevemos um método detalhado para 1) gerar Id1-superexpressão hPSCs e 2) diferenciar quantidades escaláveis de progenitores de FHF-L cryopreservable e ventricular, como cardiomyocytes.

Introduction

Produção em larga escala de células-tronco pluripotentes humanas (hPSCs)-progenitoras cardíacas derivadas e cardiomyocytes é um pré-requisito para terapias baseadas em células-tronco1, doença de modelagem2,3 e a rápida caracterização do novo caminhos regulação cardíaca diferenciação4,5,6 e fisiologia7,8. Embora um número de estudos9,10,11,12,13,14,15 têm descrito anteriormente altamente eficiente protocolos de diferenciação cardíaca do hPSCs, nenhum abordou a origem do campo de coração dos cardiomyocytes resultante, apesar da identificação de diferenças significativas de moleculares entre a esquerda (primeiro campo do coração) e direita (segundo campo de coração) cardiomyocytes ventricular16 e a existência de cardiopatia congênita coração campo específico; ou seja, hipoplasia do coração esquerdo síndrome17 ou arritmogênica do ventrículo direito displasia18. Assim, a geração dos progenitores cardíacas e cardiomyocytes de origem de campo definido de coração de hPSCs está se tornando uma necessidade para aumentar a sua relevância como terapêutica e ferramentas de modelagem da doença.

Esse protocolo depende a superexpressão constitutiva de Id1, um recentemente identificados5 primeiro coração campo-especificando cue que, em combinação com A União, é necessário e suficiente para iniciar cardiogenesis em hPSCs. Notavelmente, Cunningham et al (2017) 5 mostrar que progenitores induzida por Id1 especificamente expressam primeiro campo de coração (HCN4, TBX5), mas não segundo marcadores de campo coração (SIX2, ISL1) como elas passam por diferenciação cardíaca. Além disso, os autores também mostram que os embriões de rato transgénico falta toda a família de identificação de genes (Id1-4), desenvolver sem formar primeiro coração campo cardíaca progenitores, enquanto mais progenitores cardíaca posterior e medial ( ainda pode formar o segundo campo de coração), assim, sugerindo que as proteínas do Id são essenciais para iniciar primeiro coração campo cardiogenesis na vivo. Convenientemente, progenitores Id1-induzida pode ser criopreservadas e diferenciar espontaneamente em cardiomyocytes exibindo ventricular-como características, incluindo a expressão de marcadores específicos ventricular (IRX4, MYL2) e ventricular, como potenciais de ação.

Aqui nós descrevemos um método simples e escalável para gerar primeiros progenitores cardíacas campo-como coração de (FHF-L) e ventricular, como cardiomyocytes de Id1 superexpressão hPSCs. Uma característica importante do presente protocolo é a possibilidade de desacoplar geração progenitoras cardíacas de produção casos subsequentes usando uma etapa de criopreservação conveniente. Em resumo, este protocolo detalha as etapas necessárias para (1) gerar Id1-superexpressão hPSCs, (2) gerar progenitoras cardíacas FHF-L de hPSCs, (3) cryopreserve resultante de progenitores e (4) retomar a diferenciação de progenitoras cardíacas FHF-L e gerar altamente enriquecido (> 70-90%) batendo ventricular, como cardiomyocytes.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. infecção e preparação de vírus Id1

  1. Gerar Id1 superexpressão lentivirus co transfecting pCMVDR8.74, pMD2.G e pCDH-EF1-Id1-PGK-PuroR (Addgene: plasmídeo #107735) em células HEK293T. Coletar partículas virais, filtrado, purificar de sobrenadante e armazenar a-80 ° C, como em Kitamura et al . (2003) 19. como alternativa, produzir Id1 lentivirus comercialmente enviando pCDH-EF1-Id1-PGK-PuroR para um vendedor de lentivirus-produzindo.
    Atenção: Por favor siga normas de Lentivirus segurança e protocolos de operação padrão.
    Nota: Importante: sendo o título de vírus ideal deveria ser pelo menos 108 -109 Transducing unidades/mL (TU/mL).
  2. Antes da infecção, revesti um poço de um prato bem 96 com 50 µ l de reagente de revestimento, normalmente uma mistura de gelatinosa da proteína secretada pelas células de sarcoma de rato Engelbreth-Holm-enxame (ver Tabela de materiais).
  3. Dissocia um poço de células-tronco pluripotentes cultivadas em um prato bem 6, adicionando 1 mL de PBS sem Ca2 + e Mg2 + e com 0,5 mM de EDTA.
    Nota: Tempo de dissociação varia de 3 a 10 min. Quando mais de 80% das células são separada da parte inferior da placa, vá para a etapa seguinte.
  4. Recolha a suspensão de células com pipeta estéril no tubo de centrífuga plástico de 15 mL.
  5. Neutralize o reagente de dissociação com 5 mL de PBS contendo Ca2 + e Mg2 +.
  6. Pellet de células por centrifugação (200 x g durante 3 minutos).
  7. Remover o sobrenadante e agite suavemente o tubo para desalojar a pelota.
  8. Ressuspender as células em 1 mL de mídia de células-tronco.
  9. Contar as células usando um contador de célula automatizada, seguindo as instruções do fornecedor.
  10. Células viáveis de placa 20.000 por revestido bem (placa de 96 poços) em 50 µ l de células-tronco meios suplementados com inibidor de percurso 2 µM RHO/ROCK (ver tabelas 1 e 2).
  11. Após 24h, monitorar para fixação de célula e substituir a mídia com 100 µ l células estaminais mídia suplementada com 2 inibidor da via RHO/ROCK µM e brometo de hexadimethrine de 6 ng/mL (ver tabelas 1 e 2), a 1 hora antes da infecção Lentivirus.
    Nota: As células devem ser firmemente presa à parte inferior da placa.
  12. Descongele o Id1-lentivirus no gelo.
  13. Adicione 3 µ l de lentivirus purificada por alvéolo (título do vírus deve ser entre 108 -109 TU/mL) e depois transferir a placa de volta para a incubadora de cultura celular (37 ° C, 5% de CO2, 20% O2).
  14. infecção pós-viral 24 h, adicionar 100 µ l de mídia fresco células-tronco de células infectadas.
  15. infecção pós-Lentivirus de 48 h, substituir vírus contendo mídia com 200 µ l de células-tronco fresco mídia suplementada com 1 puromicina µ g/mL.
  16. Atualize a mídia diariamente com 200 µ l de células-tronco mídia suplementada com 1 puromicina µ g/mL.
  17. Quando culturas alcançar 80% de confluência, dissocia as células usando 200 µ l de PBS sem Ca2 + e Mg2 + + 0,5 mM EDTA (para um bem de uma placa de 96 poços).
  18. Recolha a suspensão de células para um tubo de centrifugação.
  19. Neutralize o reagente de dissociação com 5 mL de PBS contendo Ca2 + e Mg2 +.
  20. Pellet de células por centrifugação (200 x g durante 3 minutos).
  21. Remover o sobrenadante e agite suavemente o tubo para desalojar a pelota.
  22. Ressuspender as células em 1 mL de células-tronco meios suplementados com inibidor de percurso 2 µM RHO/ROCK.
  23. Transferi todas as células (1 mL) para um bem de uma placa de 12 revestido.
  24. Após 24h, monitor para fixação de célula para a mídia bem e substituir com 1 mL de células-tronco mídia suplementado com inibidor de caminho de RHO/ROCK 2 µM e brometo de hexadimethrine de 6 ng/mL, a uma hora antes da transdução.
  25. Descongele o Id1-lentivirus no gelo.
  26. Adicione 5 µ l de vírus purificado por alvéolo (placa de 12).
  27. infecção pós-Lentivirus de 24 h, substituir vírus contendo mídia com 1 mL de células-tronco fresco mídia suplementada com 3 puromicina µ g/mL.
  28. 48 h pós infecção Lentivirus, substituir vírus contendo mídia com 1 mL de células-tronco fresco mídia suplementada com 6 puromicina µ g/mL.
  29. Quando culturas alcançar 80% de confluência, dissocia as células usando a 500 µ l de PBS sem Ca2 + e Mg2 + e com 0,5 mM EDTA (para um bem de uma placa de 12).
  30. Transferência de metade (250 μL) de suspensão de célula para um poço de um reagente de revestimento revestido 6 placa contendo 2 mL de células-tronco meios suplementados com inibidor de percurso 2 µM RHO/ROCK.
  31. A outra metade (250 μL) da amostra para a extração do RNA e qRT-PCR para determinar mediada por Lentivirus Id1 expressão níveis, como em Colas et al (2012) 4.
    Nota: Importante: se os níveis de expressão de RNAm de Id1 forem inferiores a 0.005 dobra de níveis de expressão de GAPDH (ver quadro 3 para iniciadores de qRT-PCR), repita o processo de infecção, como descrito acima até que os níveis de expressão de Id1 excederem o limite.

2. hPSCs manutençãoId1

  1. Cultura hPSCsId1 no poço 6-placas revestidas e crescer em 3 mL por poço de células-tronco meios suplementados com 6 puromicina µ g/mL.
  2. Quando hPSCsId1 alcançar 80% de confluência, células de passagem como agregados (relação de divisão de 1:6) usando o reagente de dissociação de enzima livre seguindo as orientações do fornecedor e crescem em 3 mL por poço de células-tronco meios suplementados com 6 puromicina µ g/mL.

3. preparação de hPSCsId1 para diferenciação

  1. Revesti uma placa de 12 com 500 µ l por alvéolo de reagente de revestimento.
  2. Quando hPSCsId1 alcançar 90% confluência dissociar as células, adicionando 1 mL de PBS sem Ca2 + e Mg2 + e com 0,5 mM EDTA por bem de 5 a 10 min. verificar processo de dissociação cada minuto, e uma vez 80% das células são dissociada da placa , prossiga para a próxima etapa.
  3. Recolha a suspensão de células para um tubo de centrifugação.
  4. Neutralize o reagente de dissociação com 5 mL de PBS contendo Ca2 + e Mg2 +.
  5. Pellet de células por centrifugação (200 x g durante 3 minutos).
  6. Remover o sobrenadante e agite suavemente o tubo para desalojar a pelota.
  7. Ressuspender as células em 2 mL de células-tronco meios suplementados com inibidor de percurso 2 µM RHO/ROCK.
  8. Contar as células usando um contador automatizado de células.
  9. Células de placa 300.000 por bem em 1 mL de células-tronco mídia suplementada com 2 µM RHO/ROCK via inibidor e 6 puromicina µ g/mL e placa de transferência em incubadora de cultura de tecidos.
  10. Atualize a mídia diariamente com 2 mL de células-tronco meios suplementados com 6 puromicina µ g/mL, até culturas alcançar confluência de 90%. Neste momento, iniciar a diferenciação cardíaca (próximo passo).

4. diferenciação de hPSCsId1 em coração primeiro campo como progenitores cardíaca (CPs FHF-L)

  1. No formato 12-placa, iniciar diferenciação (dia 0), substituindo células estaminais mídia com 1,5 mL de mídia de indução (tabela 1) complementadas com União um (100 ng/mL) (ver tabela 2 para recomendado volumes e Activin A concentrações de placa de diferentes formatos).
  2. No dia 1 (24 h após diferenciação é iniciada), substitua a mídia com 2 mL de meio de indução sem Activin A (por bem de uma placa de 12).
  3. No dia 3, substitua a mídia com 2 mL de meio de indução sem Activin A (por bem de uma placa de 12).
  4. No dia 5, coletar FHF-L CPs para Criopreservação (próximo passo).
    Nota: Importante: criopreservação é preferível, neste ponto, pois permite para desacoplar geração casos subsequentes produção e biobanco grandes lotes de células progenitoras cardíacas. Note que Alternativamente, dia 5 CPs FHF-L pode ser passado para uma placa recém revestida para continuar a diferenciação, por favor, consulte os passos 5.1 – 5.5 para CPs passFHF-L e vá para o passo 6.5 para diferenciação.

5. criopreservação de CPs FHF-L

  1. Aspire toda a mídia de poços contendo dia 5 CPs FHF-L e rapidamente adicione 1 mL de quente (37 ° C) 1 x enzima contendo o reagente de dissociação (ver Tabela de materiais). Coloque a placa na incubadora de cultura de tecidos.
  2. Após 1 minuto, agite a placa lado a lado na incubadora.
  3. Depois de 2 min (tempo total), retire a placa da incubadora e adicione 1 mL de mídia FBS de 10%.
  4. Delicadamente Pipetar as células acima e para baixo com uma pipeta de 5 mL para facilitar o desprendimento de células da placa.
  5. Recolher a suspensão de células de um centrifugador tubo e aglomerados de células por centrifugação a 200 x g, durante 3 min
  6. Re-suspenda centrifugado em 2 mL de reagente de criopreservação.
  7. Contar as células usando um contador automatizado de células.
  8. Adicionar o reagente de criopreservação (ver Tabela de materiais) em um volume suficiente para cryopreserve células na concentração desejada (tipicamente 5-10 x 106 células/mL).
  9. Transferência de células para frascos de criopreservação e colocar os frascos no resfriamento de dispositivo (1 ° C/min) e coloque o dispositivo de resfriamento no freezer-80 ° C durante a noite.
  10. Após 24 h, transferi frascos congelados com nitrogênio líquido para armazenamento a longo prazo.
    Nota: O protocolo pode ser pausado aqui.

6. FHF-L CP diferenciação em Cardiomyocytes Ventricular, como

  1. Transferi os frascos de FHF-L CPs congelado do dia 5 de armazenamento de nitrogênio líquido no recipiente de gelo seco.
  2. Colocar os frascos em banho de água a 37 ° C durante 2 a 3 min, até suspensão de células é derretido completamente.
    Nota: Importante: O processo de descongelação é sensível ao tempo. Expondo as células para a mídia de criopreservação para uma quantidade excessiva de tempo (ou seja, 10 min) irá diminuir a viabilidade celular.
  3. Transferência de células para 15 ou 50 mL tubo de centrifuga, dependendo do número de frascos descongelados.
  4. Dispense o gota a gota (5 gotas a cada 30 segundos) previamente aquecido (37 ° C) cardiogênico mídia (tabela 1) para a solução de célula. Continue esse processo até que uma mídia de criopreservação de 1:3: proporção de mídia cardiogênico é alcançada. Neste momento, aumentar a taxa de adição de mídia cardiogênico até um 01:10 meios de criopreservação: relação de mídia cardiogênico é alcançada.
    Nota: Importante: alterações de osmolaridade rápida irão aumentar a morte celular durante o processo de descongelação; Portanto, gota a gota adição de mídia cardiogênico como descrito acima é altamente recomendada.
  5. Centrifugue a célula de suspensão e aglomerados de células por centrifugação (200 x g durante 3 minutos).
  6. Remover o sobrenadante e delicadamente agite o tubo de centrifugação para desalojar centrifugado.
  7. Ressuspender as células com mídia cardiogênico suplementada com inibidor de percurso 2 µM RHO/ROCK.
    Nota: Viabilidade celular pode variar de degelo de degelo e, em geral, > 65% de viabilidade prevê chapeamento de boa eficiência.
  8. Diluída concentrada suspensão de células com mídia cardiogênico suplementada com 2 inibidor da via RHO/ROCK µM para obter a concentração desejada de célula para o chapeamento (ver tabela 2 para placa diferentes formatos).
    Nota: Importante: Note que a eficiência de diferenciação cardíaca pode declinar se células são semeadas muito escassamente.
  9. Células de sementes no prato.
  10. Manter a placa de cultura de tecidos capuz por 20 min antes de transferi-lo para incubadora de cultura de tecidos.
  11. No dia 6 de diferenciação, monitore acessório de celular.
    Nota: Progenitores cardíaco são criopreservadas no dia 5 da diferenciação. 24 h após o descongelamento das células seria no dia 6 de diferenciação.
    Nota: É comum a presença de células (mortas) flutuantes.
  12. No dia 7, Aspire 50% dos meios de comunicação e substituir por uma quantidade igual de mídia cardiogênico fresca.
    Nota: A adição de inibidor de via RHO/ROCK na mídia cardiogênico não é necessária após este ponto.
  13. Substitua 50% da mídia mídia cardiogênico todos os dias.
  14. Nota espontânea batendo que aparece entre dia 11 e dia 13.
  15. No dia 15, quantificar a eficiência cardíaca diferenciação por imunofluorescência usando DAPI (mancha de núcleo) e ACTC1 (marcador de pancardíaca).

7. passagem e manutenção dos Cardiomyocytes Ventricular, como

Nota: Por dia 14 – 16, uma monocamada de contrair espontaneamente cardiomyocytes ventricular-como deve ser obtida. Neste momento, sugere-se dissociam e re-placa cardiomyocytes fim de homogeneizar a cultura e impedir as células de desanexação da placa.

  1. Aspire toda a mídia de poços e rapidamente adicionar 1 mL de pré-aquecido (37 ° C) 1 x enzima contendo o reagente de dissociação.
    Nota: 1 x enzima contendo volumes de reagente de dissociação variam dependendo do formato da placa, mas deve cobrir completamente o fundo da superfície bem.
  2. Transferi a placa em uma incubadora de cultura de tecidos.
  3. Agite suavemente placa lado a lado cada 2min dentro da incubadora para acelerar o processo de desprendimento.
  4. Após 5 a 15 min, quando 80% a 100% das células são separada da parte inferior da placa, retirar a placa da incubadora e inibir a enzima contendo atividade de reagente de dissociação de 1x adicionando um volume igual de mídia FBS de 10%.
    Nota: O tempo de incubação com dissociação de enzima contendo 1 x para este processo pode variar de lotes para.
  5. Recolha a suspensão de células para um tubo de centrifugação.
  6. Suspensão de células se misturam com pipeta e contagem de células usando um contador automatizado de células.
  7. Diluir a suspensão de células, a concentração da célula desejada (ver tabela 2 para placa diferentes formatos) com mídia de manutenção suplementada com inibidor de percurso 2 µM RHO/ROCK.
  8. Após a semeadura cardiomyocytes na chapa, distribuir as células uniformemente e permitir que as células anexar para 10-20 min antes da transferência da placa para cultura de tecidos de incubadora.
  9. 24 h após a re-chapeamento, monitorar a recuperação e a fixação da célula.
    Nota: É comum a presença de células (mortas) flutuantes. 48-72 h após a re-chapeamento, casos devem retomar a contração espontânea.
  10. Para manter a cultura de casos, substitua 50% dos meios de comunicação com os meios de manutenção todos os dias até o uso de cardiomyocytes ventricular, como para as experiências subsequentes.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Geração de hPSCs Id1 linhas
hPSCs estão infectados com um lentivirus mediando Id1 superexpressão (Figura 1A). Uma vez que são gerados hPSCId1 , expressão do transgene é quantificada por qRT-PCR (Figura 1B). Apenas linhas hPSCId1 expressando Id1 mRNA em níveis superiores a 0,005 dobra do que de GAPDH devem ser usadas para diferenciação.

hPSCs Id1 Manutenção e preparação para D ifferentiation
Condições de cultura óptimas são necessários e crítico para sucesso primeiro coração diferenciação de campo-como progenitoras cardíacas(Figura 2). hPSCId1 culturas devem ser monitoradas diariamente por caule morfologia manutenção e proliferação contínua. Diferenciação deve ser iniciada quando chegar a colônias de células-tronco firmemente embaladas > confluência de 90% (Figura 2B). Se a diferenciação é iniciada antes da confluência ideal, morte celular é reforçada e eficiência de diferenciação pode declinar (Figura 2C). Da mesma forma, culturas overgrown irão executar mal (Figura 2D).

Geração de primeiro coração como campo cardíaca progenitores (CPs FHF-L) de hPSCs Id1
No dia 1 (iniciação de diferenciação de post de 24 h), as células devem ser monitoradas para observar a perda da morfologia do tronco (células aparecem mais planas e mais escura do que as células-tronco). Observe que a morte celular é comum durante o primeiro dia de diferenciação, mas confluência de célula deve ser mantida no > 75%(Figura 2). Se após 24 h de diferenciação, 50% ou mais da superfície coberta são perdido, as células devem ser descartadas.

No dia 3, diferenciando as células devem permanecer em cluster e tem preenchido as lacunas criadas durante as 24 horas iniciais período de tempo (Figura 2-F). Células planas, crescendo de forma independente são indicativas de condições de diferenciação de qualidade inferior.

No dia 4, diferenciação ideal deve mostrar a continuação da expansão e cobertura da placa.

No dia 5, as células são colhidas e criopreservadas. Diferenciações ideais devem resultar em aglomerados de células firmemente conectado com aparência homogênea morfologia (Figura 2G). Observe que aglomerados de baixa densidade de células planas marcam um resultado de diferenciação de qualidade inferior. Consulte a tabela 2 para o rendimento médio do dia 5 progenitores cardíacas por alvéolo em vários formatos de cultura.

Geração de Cardiomyocytes Ventricular, como de CPs FHF-L
Dia 5 FHF-L CPs são descongelados a placa formato dependente densidade descrita na tabela 2, a fim de maximizar o seu potencial de diferenciação cardíaca (Figura 3 e tabela 2). A viabilidade após o descongelamento precisa ser monitorado. Geralmente, viabilidade varia de 70 a 80%. Se a viabilidade for inferior a 60%, o rendimento dos cardiomyocytes seria afetado.

No dia 6 (24 h após retomar a diferenciação), deveria cobrir CPs FHF-L > 90% do que o disponível área de superfície e aparecem como uma única camada homogênea de células (Figura 3B). Confluência de baixa no dia 6 reduzirá a diferenciação de FHF-L CPs em cardiomyocytes.

Cardiomyocytes resultantes começa a bater por dia 11 – 13 de diferenciação (Figura 3C e 1 filme). Durante o processo de replating do dia 14-16, ver tabela 2 para o rendimento médio dos cardiomyocytes por alvéolo em vários formatos de cultura. Eficiência de diferenciação é tipicamente avaliada por imunofluorescência para cardíaca (ACTC1), fibroblástico (TAGLN) e marcadores endoteliais vasculares (CDH5) e nucleares marcadores (DAPI). Quantificação de linhagem é executada usando quantificação imaging e fluorescência automatizada, como na. Cunningham et al (2017) 5 (Figura 3D-E). Caracterização de subtipo de cardiomyocytes resultante é executada por qRT-PCR (Figura 3-F) e potencial de ação análise transiente usando imagem cinética e tensão de detecção das sondas (Figura 3G e filme 2). Quantificação de fluorescência para a sonda de tensão e análise de rastreamento de ação potencial resultante (Figura 3-H) é executada conforme descrito em McKeithan et al . (2017) 7.

Figure 1
Figura 1: geração de hPSCId1 linhas. (A) representação esquemática do hPSCs protocolo de geração deId1 . (B) exemplos de resultados de qRT-PCR mostrando níveis de mRNA Id1 representante gerados pela expressão mediada por Lentivirus de linhas distintas do hPSCId1 , incluindo uma linha de hESC e duas linhas de hPSC linhas. Linha tracejada representa o limiar de expressão Id1 , abaixo qual hPSCId1 linhas precisam se submeter a um ciclo adicional de infecção Id1-lentivirus. "p" indica o número de passagem. O número entre os parênteses indica o número de rodadas de Lentivirus Id1 infecção. Barras de erro representam o desvio padrão de experimentos realizados em triplicata. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: Geração do primeiro coração Field-Like cardíaca progenitores (FHF-L CPs) diferenciação de hPSCId1. (A) representação esquemática do protocolo de geração de FHF-L CP. Fotos de campo brilhante representante do hPSCId1 (dia 0) no ideal (B), sub confluente (setas amarelas indicam as regiões de vazia entre as células) (C) e excesso de confluencia densidades (D) . Fotos de brilhante-campo representativas de diferenciar hPSCId1 no dia 1, 3 e 5 respectivamente (E), (F), (G). Barra de escala = 100 µm. clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: geração de Ventricular, como casos de CPs FHF-L. (A) Representação esquemática do protocolo de geração de casos semelhantes a ventricular. (B) imagem de campo brilhante das células de diferenciação do 6º dia (um dia pós-descongelamento). (C) imagem de campo brilhante de uma cultura de espancamento do dia 12. (D) imagem de imunofluorescência representativas das culturas de dia 15 (formato de placa 384). ACTC1 marca cardiomyocytes, TAGLN: músculo de fibroblastos/liso, CDH5: vascular em células endoteliais e DAPI: núcleos (constantes o baixo-relevo). (E) quantificação de linhagem de 15 culturas de dia. Dados de qRT-PCR (F) tempo expressão do curso do dia 5 ao dia 25 de marcadores específicos ventricular (IRX4 e MYL2) e marcador de pancardíaca (MYL7). (G) rastreamento de potencial de ação representativa de cardiomyocytes ventricular, como no dia 25 de diferenciação. (H) ação potencial duração medições (APD50 e APD90) de resultante ventricular, como cardiomyocytes (n = 12). Barras de erro representam o desvio padrão de experimentos realizados em quatro exemplares (a menos que indicado em contrário). Barras de escala = 100 µm. RFU, unidade relativa de fluorescência. Clique aqui para ver uma versão maior desta figura.

Médio Base média Aditivo
Mídia de células-tronco mTesR1 n/a
Mídia de indução RPMI 1640 Medium B-27 suplemento isento de soro sem insulina, 1x
Mídia de indução RPMI 1640 Medium Puromicina, 6 µ g/ml
Mídia de indução RPMI 1640 Medium Penicilina-estreptomicina, 1x
Cardiogênico Media RPMI 1640 Medium B-27 suplemento isento de soro, 1 x
Cardiogênico Media RPMI 1640 Medium Penicilina-estreptomicina, 1x
Mídia de manutenção RPMI 1640 Medium B-27 suplemento isento de soro, 1 x
Mídia de manutenção RPMI 1640 Medium Substituição de soro de nocaute, 2%
Mídia de manutenção RPMI 1640 Medium Penicilina-estreptomicina, 1x

Tabela 1: Componentes de mídia (consulte tabela de materiais para aditivos e mídia de base).

384 bem 96 bem 12 bem 6 bem 100 mm 150 mm
Volume de revestimento (por bem) 10 Μ l 50 Μ l 500 Μ l 1 mL 5 mL 10 mL
Volume médio
(por bem)
100 Μ l 300 Μ l 2 mL 5 mL 12 mL 30 mL
Diferenciação dia 0 União uma concentração (ng/mL) 100 100 100 300
Progenitoras cardíacas
rendimento do dia 5
(células/poço)
1.0-1.2 x 105 2.5-3.0 x 105 1.0-1.5 x 107 2.0-3.0 x 107
Progenitoras cardíacas dia 5 replating ou descongelar densidade (células/poço) 2,0 x 104 7,5 x 105 4.5 x 106 8,0 x 106 2,2 x 107
Ventricular, como casos
rendimento do dia 14 – 16
(células/poço)
2.0 – 5.0 x 104 0.8-1.2 x 106 3.5 – 5.0 x 106 0.8-1.2 x 107 1.8-2.5 x 107
Ventricular, como casos replating densidade
(células/poço)
2.5 x 104 1.0 x 106 4.5 x 106 1.0 x 107 2,2 x 107

Tabela 2: Parâmetros de diferenciação escalável (revestimento volume, volume médio, concentração de Activin A, rendimentos, replating densidades).

Nome do gene Banco de genes de adesão Sequência de
GAPDH NM_001256799 F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
rato Id1 NM_010495 F: CCTAGCTGTTCGCTGAAGGC
R: CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 F: GGCTCCCCAGTTCTTGATGG
R: TAGACCGGGCAGTAGACCG
MYL2 NM_000432 F: TTGGGCGAGTGAACGTGAAAA
R: CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 F: GCCCAACGTGGTTCTTCCAA
R: CTCCTCCTCTGGGACACTC

Tabela 3: sequências da primeira demão de qRT-PCR.

Movie 1
Filme 1: gravação de campo brilhante (100 quadros/s) do dia 15 cardiomyocytes onde se podem observar as contrações espontâneas. Por favor clique aqui para ver este vídeo. (Botão direito do mouse para fazer o download.)

Movie 2
Movie 2: imagem cinética (100 quadros/s) de tensão sensível sonda fluorescente no dia 25 induzida por id1 ventricular, como cardiomyocytes. Por favor clique aqui para ver este vídeo. (Botão direito do mouse para fazer o download.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Para diferenciações bem sucedidas, certifique-se de acompanhar de perto as instruções listadas acima. Além disso, aqui destacamos parâmetros-chave que influenciam fortemente os resultados de diferenciação. Antes de iniciar uma diferenciação, devem ser observados os seguintes três parâmetros morfológicos: uma morfologia de tronco de hPSCsId1, uma alta compactação celular e uma confluência de alta (> 90%) da cultura no dia 0. A esse respeito, condições ideais de diferenciação são melhor criadas por chapeamento dissociado hPSCsId1 como células únicas e permitindo-lhes a forma firmemente aglomeradas monocamadas que crescem a confluência ~ 90% durante o curso de 2 a 3 dias. Por outro lado, se hPSCId1 culturas mostram célula pobre e morfologia de colônia, compactação de colônia baixa e a presença de grandes áreas de diferenciação dentro da cultura, diferenciação de FHF-L CP bem sucedida são improváveis.

Volume de mídia e Activin A concentrações são parâmetros críticos de diferenciação FHF-L CP e formato de placa-dependente (ver quadro 2). Também note que as concentrações de Activin A ideal podem variar dependendo do usado linha hPSC e pode exigir a otimização da concentração.

Níveis de mRNA Id1 em hPSCs são cruciais para promover eficientemente FHF-L CP Suboptimal Id1 níveis falhará produzir a diferenciação de FHF-L CP robusta e morte celular maciça de dia 1 de diferenciação será observado. A relação de expressão relativa de Id1- para -GAPDH deve exceder 0.005 para promover diferenciação eficiente. Seleção contínua usando doses mais elevadas de puromicina (6-10 µ g/mL) é recomendada a fim de manter altos níveis de expressão de Id1 Lentivirus mediada. Recomenda-se uma avaliação dos níveis de mRNA Id1 cada 10 passagens.

Chapeamento de densidades de dia 5 FHF-L CPsis também um parâmetro crítico para eficiência de diferenciação cardíaca. Se dia 5 CPs FHF-L são banhados em baixas densidades, diminuirá o rendimento cardíaco relativo. Densidades de chapeamento ideal estão listadas na tabela 2 e são placa de formato-dependente.

A principal limitação para este protocolo é o uso de Lentivirus mediada Id1 superexpressão para diferenciação de CP promoteFHF-L, que pode restringir o uso terapêutico dos progenitores resultantes e ventricular, como cardiomyocytes. Também, desde lentivírus podem integrar em sites que poderia potencialmente afetar hPSC manutenção e/ou potencial de desenvolvimento, stemness de hPSCsId1 colônias devem ser monitorizado através da avaliação da haste expressão gênica e observando sinais morfológicos de diferenciação. Observe que a superexpressão Id1 usando vetores não-Integrativa iria superar essa limitação e atualmente está sendo investigada em nosso laboratório.

Um recurso conveniente desse método é a simplicidade do protocolo de diferenciação como exige somente uma citocina, A União, para gerar CPs FHF-L de hPSCsId1. Em comparação, outros protocolos 9,10,11,12,13,14,15 requerem complexas sequências de combinações de citocinas e/ou pequenas moléculas a fim de promover e manter a diferenciação cardíaca. Além disso, este protocolo descreve exclusivamente uma etapa de criopreservação conveniente que permite para desacoplar geração FHF-L CP de produção casos subsequentes. Esta característica permite ao biobanco grandes lotes de FHF-L CPs e gerar rapidamente cardiomyocytes de progenitores congelados, como diferenciação cardíaca retoma do 5º dia após o descongelamento. Esta estratégia permite a ganhar 1 a 2 semanas de tempo em comparação com a diferenciação cardíaca partir de hPSCs. Além disso e o mais importante, este protocolo é o primeiro protocolo a data para gerar progenitoras cardíacas de origem de campo definido de coração, enquanto outros protocolos9,10,11,12 ,13,14,15 permanecem indefinidos a esse respeito.

Em resumo, este protocolo descreve um método robusto e escalável para produzir grandes quantidades (> 108– 109) de desenvolvente relevantes FHF-L CPs e ventricular, como cardiomyocytes. Por sua vez, células resultantes podem ser usadas para identificar novos caminhos regulamentares controlando diferenciação cardíaca e fisiologia e para regenerativa e doença para fins de modelagem.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Agradecemos a membros do laboratório de Colas para discussões úteis e resenhas críticas do manuscrito. Este estudo foi suportado pelo NIH/NIEHS R44ES023521-02 e CIRM DISC2-10110 concede ao Dr. Colas.

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics