הערכת הכדאיות של קונסורציום חיידקי סינתטי על הממשק מארח-חיידק במעיים במבחנה

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

אינטראקציות מארח-חיידק מעיים היו העריכו באמצעות גישה מוזרה שילוב קהילה אוראלי סינתטי במבחנה במערכת העיכול עיכול, דגם של האפיתל המעי הדק. אנו מציגים שיטה שבה ניתן להתאים כדי להעריך את התא הפלישה של גורמי מחלה, biofilms מינים רב, או אפילו כדי לבדוק את השרידות של פרוביוטיקה ניסוחים.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Calatayud Arroyo, M., Van de Wiele, T., Hernandez-Sanabria, E. Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface. J. Vis. Exp. (137), e57699, doi:10.3791/57699 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

יחסי הגומלין בין המארח microbiota יש כבר הכיר זמן רב, בהרחבה. הפה דומה סעיפים נוספים מערכת העיכול, כפי microbiota תושב מתרחשת ומונע colonisation על ידי חיידקים אקסוגני. ואכן, נמצאו יותר מ-600 מינים של חיידקים בחלל הפה, אדם יחיד יכול לשאת סביב 100 שונים בכל עת. הפה בעל היכולת לדבוק גומחות שונים של המערכת האקולוגית אוראלי, ובכך הופכת משולב בתוך הקהילות מיקרוביאלי תושב, ואת עדיפה עם צמיחה, הישרדות. עם זאת, הזרם של חיידקים לתוך הבטן במהלך בליעה הוצע להפריע את יתרת microbiota הבטן. למעשה, אוראלי מינהל gingivalis פ מוזז קומפוזיציה חיידקי ב ileal microflora. השתמשנו קהילה סינתטיים כמו ייצוג מופשטת של המערכת האקולוגית הטבעית דרך הפה, להבהיר את הישרדות ואת הכדאיות של חיידקים אוראלי חשופים לתנאי המעבר מדומה במערכת העיכול. ארבע עשרה מינים היו שנבחרו, נתון במבחנה הרוק, קיבה, תהליכי העיכול במעיים, הציג מודל תא multicompartment המכיל תאים קאקו-2 ו- HT29-MTX להדמיית בטן האפיתל הרירית. מודל זה שימש כדי לפענח את ההשפעה של החיידקים נבלע על תאים מחזור enterohepatic. באמצעות קהילות סינטטי מאפשר בקירות וצפיות הפארמצבטית. לפיכך, מתודולוגיה זו ניתן להתאים להערכת הכדאיות הפתוגן ושינויים הבאים הקשורים לדלקת, קיבולת קולוניזציה של תערובות פרוביוטיקה, בסופו של דבר, פוטנציאל בקטריאלי להשפיע על מחזור הדם presystemic.

Introduction

בני אדם cohabit עם חיידקים, אשר נמצאים באותו מקום כמו תאים אנושיים1. לפיכך, חשוב קריטיים להשיג הבנה מקיפה microbiome האנושית. חלל הפה הוא סביבה ייחודית בכך הוא מחולק במספר בתי גידול קטן יותר, ובכך המכיל מגוון רחב של חיידקים, biofilms במיקומים שונים אלה. להיות פתוח המערכת האקולוגית, מינים מסוימים בפה יכול להיות המבקרים ארעית. עם זאת, מיקרואורגניזמים מסוימים ליישב מיד לאחר הלידה וצורת מאורגן biofilms2. אלה מצויים על פני השיניים מעל האתר חניכיים, הבקיע subgingival, הלשון, משטחים הרירית, שיניים תותבות, סתימות3. חיידקים ניתן נוכח גם כמו flocs, תאים פלנקטוניים לומן של תעלת השן, או intermixed עם רקמת נמק מוך או הושעה בשלב הנוזלים.

יש קרוס פעיל, רציף-דיבורים בין התאים המארחים את תושב microbiota4. חיידקים תקשורת בתוך ובין מינים, רק אחוז קטן של colonizers טבעי יכול לדבוק רקמות, ואילו חיידקים אחרים לצרף אלה colonizers הראשי. למשל, תא-תא איגוד בין מיקרואורגניזמים הוא מפתח עבור שילוב colonizers משני biofilms אוראלי, ובניית רשתות מורכבות של תאי חיידקים שמעצבת4. בסביבות 70% של אגרגטים חיידקי דגימת רוק בלבד נוצרות על ידי Porphyromonas sp., סטרפטוקוקוס sp., Prevotella sp., Veillonella sp. לא מזוהה Bacteroidetes. פ nucleatum הוא הקולוניאליסט ביניים subgingival biofilm, אגרגטים עם colonizers מאחר gingivalis פ, denticola ט, ו- Tannerella forsythia, אשר אינם מעורבים חניכיים5. בנוסף, סטרפטוקוקוס מיטיס תופסת בתי גידול הרירית והן שיניים, בעוד sanguinis ס ו ס gordonii מעדיפים ליישב שיניים3. לפיכך, sanguinis ס קיים החותכות והתחתון הולכי על ארבע, בעוד Actinomyces naeslundii נמצא anteriors העליון6.

בנוסף, microbiome ילידים ממלאת תפקיד בשמירה על בריאות האדם2. תושב microbiota משתתף בחינוך המערכת החיסונית, מניעת התרחבות הפתוגן. התנגדות colonisation זו מתרחשת כיוון החיידק מקורי עשוי להיות טוב יותר מתאימים הצמדת משטחים, יעיל יותר ב metabolising זמין חומרים מזינים לצמיחה. למרות זנים פרוביוטיקה לשרוד את המעבר במערכת העיכול, להישאר פעילה, התמדתו של חיידקים autochthonous בלע ממיקום העליון של מערכת העיכול לא מלא תואר. לכן, אנחנו חשופים של קהילה מלאכותית, נציג של המערכת האקולוגית אוראלי, לתנאי המעבר מדומה במערכת העיכול. הכדאיות של תאים חיידקיים הוערכה באמצעות דגם multicompartment דמוי האפיתל הבטן. סימולטורים בטן הנוכחיים מציעים הפארמצבטית מתאימים מבחינת ניתוח של הקהילה חיידקים luminal7. עם זאת, אדהזיה חיידקי ואינטראקציה מארח-חיידק בנפרד מטופלות, כמו שילוב של שורות תאים עם קהילות מיקרוביאלי הוא מאתגר8. לעומת זאת, אנו מציגים מסגרת המספקת הסבר מכניסטית פוטנציאלי של אירועים מוצלחים קולוניזציה דיווחו על הממשק בטן. אכן, מודל זה במשותף ניתן עם דגם בטן סטטי כדי להעריך את ההשפעה של קהילות חיידקים על איתות משטח המארח.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. זנים, תרבות תנאים

הערה: הקהילה אוראלי סינתטי הולחן על ידי זנים בדרך כלל נוכח אוראלי microbiome3.

  1. להשיג זנים הבאים מ אמריקה סוג תרבות אוסף (בקרת האוויר): Aggregatibacter actinomycetemcomitans (בקרת האוויר 43718), Fusobacterium nucleatum (בקרת האוויר 10953), Porphyromonas gingivalis (בקרת האוויר 33277), Prevotella הדממה: (בקרת האוויר 25611), סטרפטוקוקוס mutans (בקרת האוויר 25175), סטרפטוקוקוס sobrinus (בקרת האוויר 33478), Actinomyces naeslundii (בקרת האוויר 51655), סטרפטוקוקוס גורדוני (בקרת האוויר 49818), Actinomyces דביק (בקרת האוויר 15987) ו סטרפטוקוקוס מיטיס (בקרת האוויר 49456).
  2. לרכוש Veillonella parvula לייבניץ המכון הגרמני-DSMZ אוסף של מיקרואורגניזמים, תרביות תאים (DSM 2007), סטרפטוקוקוס sanguinis מאוסף חיידקים BCCM/LMG (LMG 14657) ולהשתמש סטרפטוקוקוס salivarius מתח טוב-R9ו סטרפטוקוקוס oralis10.

2. פיתוח של נציג הקהילה התקדמות של Microbiome הפה

הערה: ליצור קהילה סינתטיים כדי לדמות את קיבולת אדהזיה פוטנציאליים של חיידקים אוראלי האפיתל בטן במבחנה . לגדול חיידקים על פלטות אגר דם בתוספת 5 μg/mL המין menadione μg/mL 1, 5% defibrinated סטרילי הסוס דם, כמתואר ב. הרננדז-Sanabria et al. (2017) 11. בקצרה:

  1. להמיס 100 מ ג של המין ב 2 מ של 1 M NaOH, להוסיף 100 מ של מים מזוקקים בלוק. לאחסן במיכל חשוך. לחטא דרך מסנן מיקרומטר 0.22 לפני הוספת בינוני.
  2. להמיס 100 מ ג של menadione ב- 20 מ של 96% אתנול. לחטא דרך מסנן מיקרומטר 0.22 לפני הוספת בינוני.
  3. להכנת 1 ליטר של דם אגר בינוני (ראה טבלה של חומרים) על פי הוראות היצרן אוטוקלב. ומצננים לפני הוספת הדם הסוס ותוספי. מערבבים ויוצקים את הצלחות.
  4. להכין את המוח אינפוזיה הלב ששונה (BHI) מרק כפי שדווחה בעבר12. מוסיפים 5 μg/mL של המין μg/mL 1 של menadione לאחר autoclaving.
  5. לוותר על 9 מ של המדיום הנגייט צינורות וסגור עם פקק גומי, כובע של אלומיניום. לרוקן את הצינורות עם N2/CO2 (90% / 10%).
  6. לאחזר 1 מ"ל של מדיום אנאירובית עם מזרק ולמקם אותו בצינור microcentrifuge 1.5 mL. לבחור מושבות יחיד של כל מין חיידקית, resuspend בטווח הבינוני, לחזור למחלקת BHI ששונה אנאירובית. תקופת דגירה של 48 שעות-37 מעלות צלזיוס, למעט ס' salivarius, אשר חייב להיות מודגרות במשך 24 שעות ביממה.
  7. אם יש צורך, לאשר את הטוהר של התרבויות לפני בניית הקהילה סינתטי. בקצרה:
    1. לחלץ את הדנ א של התרבויות נוזלי כמו. הרננדז-Sanabria et al. (2010) 13 ומגבירים את הגן rRNA מטוסי אף-16 באמצעות תחל את 27F (AGAGTTTGATYMTGGCTCAG), 1492R (TACGGYTACCTTGTTACGACT), ואת התוכנית הבאה: 5 דקות ב 95 מעלות צלזיוס, מחזורים של 95 מעלות צלזיוס במשך 1 דקה, 55 ° C 1 דקות, וכן 72 ° C עבור 1.5 דקות, ואחריו צעד סיומת הסופי של 5 דקות-72 מעלות צלזיוס.
    2. לטהר את המוצר PCR עם פרסומת קיט (ראה טבלה של חומרים), ההוראות של היצרן.
    3. לבצע את התגובה רצף של המוצרים מטוהרים ב 10 μL הנפח הכולל המכילה 0.5 μL של לצבוע (ראה טבלה של חומרים), pmol 3.2 של פריימר M13f (CGCCAGGGTTTTCCCAGTCACGAC), μL 2.0 של 5 x מאגר רצף, ו- 20 ng של תבנית, באמצעות מערכת רצף מסחרי עם קיט (ראה טבלה של חומרים).
      הערה: היו לנו הליך זה ביצע מסחרית.
    4. לבצע חיפוש הפיצוץ על כל הרצף (http://blast.ncbi.nlm.nih.gov/Blast.cgi) כדי לקבוע את טקסון ידוע הקרוב ביותר ולהשוות עם הרצף של זן המקורי באמצעות הכלי מקוון המסווג RDP (http://rdp.cme.msu.edu/), את סינה יישור שירות (https://www.arb-silva.de/aligner/).
  8. למדוד את מספר הנייד בסוף הדגירה, באמצעות cytometry זרימה SYBR Green/Propidium יודיד הכתם כפי שמתואר. הרננדז-Sanabria et al. (2017) 11. לדלל את התרבויות כ 105 תאים מ ל-1, שימוש שונה BHI.
  9. להוסיף 1 מ"ל של ס' מיטיס לתוך 75 מיליליטר BHI אנאירובית, דגירה עד שלב נייח (6 שעות). בעקבות, לאסוף 0.75 מ של כל זן מדולל ושילוב בתנאים אנאירוביים.
  10. ברגע בכל התרבויות יש מספר, לקחת 1 מ"ל של המיקרוקוסמוס, והוסף 75 מ של BHI. דגירה הקהילה סינתטי תחת 10% CO2, 10% H2, 80% N2 ב 48 שעות ב 37 ° C ו- 200 סל ד (ראה טבלה של חומרים).
  11. מודדים את צפיפות התאים כמו 2.8. לפני הצגת הקהילה למודל של התא. הרכב הקהילה יכול להידרש עם כמותיים PCR בזמן אמת, באמצעות תחל את, חישול טמפרטורות טבלה 1. Slomka et al. (2017) 10. בנוסף, משתמשים מטוסי אף-16 rRNA ג'ין אמפליקון רצף כדי לספק מידע על חברי הראשונית13,נוכח14. גם זהות, מאשרים פרוטוקול, השתמש cDNA כתבנית כדי לציין את החיידקים באופן פעיל תעתיק חלבונים ולאחר להשתמש DNA כתבנית כדי לחשוף נוכחות/היעדרות של הזנים.

3. שיטות תרבית תאים גנרל

הערה: לקבלת היבטים כלליים של תרבית תאים, המחברים עיין מאסטר וסטייסי (2007)15. להשיג את שורות תאים בשימוש מתוך אירופה אוסף של מאומתים תרביות תאים (קאקו-2 ECACC 86010202, 12040401 ECACC HT29-MTX-E12, בריאות הציבור אנגליה, בריטניה). ניתן לרכוש ריאגנטים עבור תרבית תאים (ראה טבלה של חומרים), אלא אם צוין אחרת.

  1. תחזוקה, passaging של שורות תאים קאקו-2 ו- HT29-MTX
    הערה: תאים קאקו-2 ו- HT29-MTX גדלים באופן שגרתי ב- 25 ס מ2 תרביות רקמה מבחנות המכילות DMEM שהושלם בינוני (טבלה 1). התאים הם trypsinized כאשר הנהרות 60-70%.
    1. הסר את המדיום תרבות תא המבחנות. לשטוף פעמיים עם 5 מ של PBS ללא Ca++/Mg++.
    2. להוסיף 2 מ של פתרון 0.5 מ ג/ליטר של טריפסין, 0.22 g/L אתילן diamine ב tetraacetic חומצה (EDTA). להפיץ את הפתרון טריפסין מהזזה בעדינות את הבקבוק. הסר 1.5 מ של הפתרון טריפסין, דגירה. הבקבוק ב 37 מעלות צלזיוס למשך 10 דקות.
    3. בדוק במיקרוסקופ אם התאים הם צמודי קרקע מפני השטח את הבקבוק. תקופת דגירה של 5 דקות נוספות, אם יש צורך.
    4. הוסף 5 מ של התא שהושלם תרבות המדיה הבקבוק כדי להשבית את טריפסין. Pipet למעלה ולמטה כדי לקבל השעיה הומוגנית תא בודד.
    5. . מיד, לקחת את µL 50 aliquot של התליה תא ומערבבים עם פתרון סטרילי Trypan blue 0.4% ביחס 1:1 (v/v) עבור תאים קאקו-2 או 1:5 v/v עבור HT29-MTX. לערבב pipetting, טען לתא הספירה (ראה טבלה של חומרים).
    6. לספור את התאים קיימא (תאים לבנים בהירים) תחת המיקרוסקופ (ראה הוראות היצרן).
    7. זרע בבקבוקון חדש-צפיפות של 4 x 105 תאים/cm2 ו- 1 x 104 תאים/cm2, עבור קאקו-2 ו- HT29-MTX, בהתאמה.
      הערה: (1) קאקו-2 תאים להבדיל ויוצרים צמתי צר פעם להגיע confluency. חשוב מאוד להימנע נגמר-confluency לפני trypsinization. צמיחת יתר של תאים בתוך הבקבוק יכול לגרום כשל ניתוק התא לאחר trypsinization ו/או לתא גושים. (2) HT29-MTX שהתאים המייצרים ריר תאים עם פעילות מטבולית גבוהה16. תכונות אלה עלול לגרום לחומצי התקשורת התרבות תאים, מהיר במיוחד אם התאים נמצאים בצפיפות גבוהה. ניתן להוסיף מאגר HEPES המדיום התרבות התא (טבלה 1) כדי לשמור על רמת ה-pH בין 7 ו- 7.2. אם ה-pH יורדת, בינוני ניתן להחליף כאשר confluency הוא פחות מ- 50%. עם זאת, אם confluency > 50%, התרבות התא חייבים להתפצל.

4. הרכבה של מודל Multicompartment תא המדמה את ממשק מארח-חיידק בבטן

הערה: להשלים את תרבות משותפת בבארות כפול קאמרית (קוטר 24 מ"מ, נקבוביות בגודל 0.4 μm; ראה טבלה של חומרים).

  1. להוסיף 1.5 מ של התא מלא תרבות המדיה תא הפסגה ו- 2 מ"ל עד הבסיס. תקופת דגירה מראש של 20 – 30 דקות להשיג אפילו חלוקת התליה תא כאשר זריעה.
  2. Trypsinize התרבות התא של קאקו-2 ו- HT29-MTX כמתואר בסעיף 3. ההליך trypsinization חייב להיות במעקב במדויק כדי להשיג חלוקה הומוגנית של שתי שורות תאים, ההשעיה תא בודד, ללא גושים.
  3. לספור את התאים קיימא כפי שמתואר 3.1.8.
  4. להתאים את צפיפות התאים אל 6.5 x 10 תאים/ס מ4 2 ב שיעור 90/10 של קאקו-2/HT29-MTX תאים.
  5. Homogenize את המתלים תא ולהוסיף האחסון המתאימים של קאקו-2 ו- HT29-MTX תאים במיכל סטרילי שמולאו מראש עם תא שהושלם תרבות המדיה. הסר התקשורת מראש incubated מן הצד הפסגה של התא על ידי השאיפה.
  6. בעדינות לערבב התליה תא על-ידי pipetting, ולהעביר 1.5 mL תא הפסגה של התוספות קאמרית. ההליך זריעה דורש המגון מתמדת של התליה תא, כמו התאים נוטים משקעים. בהתאם, את החוויה של המשתמש לבין מהירות עבודה התליה תא חייב להיות מעורב לאחר dispensing 1 – 3 בארות.
  7. להעביר צלחות ואחורה בעדינות וימינה כדי משמאל לימין (5 – 10 פעמים) כדי להשיג אפילו על התפשטות של תאים בתוך הבאר. להעביר חממה וחזור על התנועה של הלוחות.
  8. לשמור על תרבות משותפת של קאקו-2/HT29-MTX תאים במשך 15 ימים, מרעננים התאים הבזליים, הפסגה כל יומיים עם DMEM שהושלם. לאחר תקופה זו, התקשורת התרבות התא ניתן לשנות DMEM שהושלם ללא פתרון אנטיביוטיקה/antimycotic.
  9. לשמור על המערכת עד 20 – 21 ימים שלאחר זריעה על-ידי רענון המדיום כל יומיים.
  10. למדוד את תקינות מחסום האפיתל לפני שמתחילים וזמינותו, באמצעות המערכת התנגדות חשמלית (ראה טבלה של חומרים), ביצוע ההוראות היצרן.
    1. להבטיח כי TEER ציוד טעונה במלואה (> 24 שעות ביממה) לפני תחילת המדידות.
    2. נתק את הציוד TEER אספקת החשמל ואת מכסה בשקית פלסטיק אוטוקלב. תעשה חור בשקית כדי להציג את האלקטרודה ולחבר יציאת קלט על המונה. תרסיס עם 70% אתנול/מים (v/v) לפני היכרות עם ציוד TEER אל הארון זרימה.
    3. לחטא האלקטרודה, לטבול את הטיפים אלקטרודה ב-70% אתנול/מים (v/v) לפתרון 15 דקות אפשר לאוויר יבש עבור שטיפה ס' 15 האלקטרודה בתקשורת התרבות תאים טרום ומחוממת.
    4. . קח את התאים מתוך החממה ולאפשר תאים להגיע לטמפרטורת החדר בתוך הזרם בארון.
    5. ודא כי מד הוא מתנתק ןעטמה. הגדר את המתג במצב אוהם, סובבו הכוח לעבור על.
    6. למדוד את ההתנגדות תא במועט האלקטרודה ועם הטיפ קצר יותר, הוסף הטיפ עוד מהבאר. לשמור את האלקטרודה בזווית של 90 מעלות תותב הלוח.

5. הישרדות חיידקי בעקבות במבחנה תנאי המעבר במערכת העיכול

הערה: להכין מדומה מערכת העיכול נוזלים בעקבות הפרוטוקול של. Minekus et al. (2014) 17, עם השינויים המתוארים להלן. להכין את כל דילולים במים הנדסה גנטית. מסנן-לעקר כל הפתרונות דרך מסנן מיקרומטר 0.22, בצע את ההליך עיכול בתנאים סטריליים.

  1. עיכול אוראלי:
    1. מקום 3 מ"ל של הקהילה חיידקי בשפופרת סטרילי 50 מ ל, מערבבים עם 3 מ"ל של נוזל הרוק מדומה (SSF), המכיל (ב mmol L-1): אשלגן כלורי, 15.1; 2פו ח'4, 3.7; NaHCO3, 6.8; 2(H2O) MgCl6, 0.5, CO (NH4)3, 0.06; HCl, 1.1; CaCl2(H2O)2, 0.75. הוסף 75 U/mL של α-עמילאז רוק אנושי מסוג IX-A ו- 2 g/L mucin מן הקיבה חזירי מסוג II כדי SSF.
    2. דגירה את התערובת למשך 2 דקות, 37 ° C, ו 100 סל"ד. לאסוף מדגם 2 mL עבור הפקת דנ א, כימות cytometry זרימה (S1).
  2. עיכול קיבה:
    1. להוסיף 4 מ ל נוזל סימולציה קיבה (בפורמט אס), המכיל (ב mmol L-1): אשלגן כלורי, 6.9; 2פו ח'4, 0.9; NaHCO3, 25; NaCl, 47.2; 2(H2O) MgCl6, 0.1, CO (NH4)3, 0.5; HCl, 15.6; CaCl2(H2O)2, 0.075. בנוסף, בפורמט אס הכיל 2 g/L של mucin מן הקיבה חזירי מסוג II.
    2. למדוד את רמת ה-pH ולהתאים את ה-pH 3 עם 1 M HCl, במידת הצורך. דגירה-37 ° C ו 100 סל"ד. לאסוף דגימה 2 מ"ל (S2).
  3. עיכול המעי הדק:
    1. להוסיף 4 מ ל נוזל סימולציה מעיים (SIF) המכיל (ב mmol L-1): אשלגן כלורי, 6.8; 2פו ח'4, 0.8; NaHCO3, 85; NaCl, 38.4; 2(H2O) MgCl6, 0.33; HCl, 8.4; 2(H2O) CaCl2, 0.3; את הצינור לעיכול.
    2. להתאים את ה-pH 7 עם 1 M NaOH, במידת הצורך. דגירה-37 ° C ו 100 סל"ד. לאסוף דגימה 2 מ"ל (S3).

6. היכולת מושבת חיידקים בעקבות במבחנה תנאי המעבר במערכת העיכול

  1. צנטריפוגה 2 מ"ל של עיכול המעי הדק, 10 דקות ב x 2,650 גרם.
  2. הסר את תגובת שיקוע ומערבבים בגדר חיידקי עם 5 מ של DMEM שהושלם ללא אנטיביוטיקה, antimycotic.
  3. כתם ולכמת תאים שלמים/פגום באמצעות cytometer של זרימה (ראה טבלה של חומרים), כפי שתואר על ידי. הרננדז-Sanabria et al. (2017) 11.
  4. להתאים את צפיפות תא ל 105 קיימא תאים למ"ל דילול ב DMEM שהושלם ללא אנטיביוטיקה, antimycotic.
  5. להסיר את המדיום הפסגה של מערכת transwell ולהוסיף 1.5 מ של המתלה חיידקי. תרבות משותפת המערכת עבור 2 h בתנאים תרבות תא כללי (37 מעלות צלזיוס, 95% לחות, 5% CO2).
    הערה: הפעם ניתן להרחיב עד 48 שעות, בהתאם פרוטוקול נסיוני הנדרש. התרבות שותף יכול להישמר ב חממה שונה מזה המשמש עבור תחזוקה שגרתית התא, כדי למנוע את contaminations.
  6. למדוד את הערכים TEER לאחר דגירה, כדי להעריך את התקינות של המכשול אפיתל כמתואר ב- 4.11.
  7. לאחר סיום זמן הדגירה, להסיר מדיה הפסגה, ולאסוף 0.5 mL עבור ניתוחים נוספים (S4). Subsample של התקשורת יכול לשמש עבור ובחינת הכדאיות תא על-ידי assay לקטט דהידרוגנאז (LDH) (ראה טבלה של חומרים), ביצוע ההוראות היצרן.
  8. להוסיף 0.5 מ ל 10 מ מ N-אסטילסיסטיין HBSS (NAC-מאגר) כדי solubilize את הריר מיוצר על ידי HT29-MTX וכדי לשחזר חיידקים מודבקת. דגירה הלוחות ב 37 ° C עבור h 1, תחת עצבנות (135 סל ד, ראה טבלה של חומרים).
  9. לשחזר את NAC-HBSS בשפופרת microcentrifuge (S5) ולשטוף פעמיים את התאים עם 1 מ ל DPBS.
  10. להוסיף 0.5 מ של 0.5% טריטון X-100 (w/v) על גבי monolayers, לשבש את התאים על ידי pipetting, לשחזר את הנוזל ואת מערבולת 1 הגבלת מהירות הוא חיוני למנוע נזק תאי חיידקים עם הנוזל.
  11. Centrifuge את התאים עבור 5 דקות ב x 2,650 גרם, ולהפריד את תגובת שיקוע (S6) ולא בגדר (S7).

7. דגימת

הערה: לנתח את הדוגמאות שנאספו (S1-S7) כדי להעריך את הכדאיות חיידקי והצמדות פוטנציאליים לתאי המעי, בעקבות של עיכול מדומה במערכת העיכול.

  1. חיידקי הכדאיות: להעביר דגימות S1-S5 פעמיים בעזרת מיקרומטר 0.45 ואת לכמת תאים חיידקיים באמצעות צביעת תא חי/מת flow cytometry, כמצוין בשלב 2.811.
  2. הדבקה אפשרית: להכין דילולים טורי (-1 ל- 8) עבור S1-S6, µL 10 ב דם אגר צובעות ושינית BHI צלחות. דגירה ב 37 מעלות צלזיוס בתנאים אנאירוביים במשך 24-48 ה צלחת באותו אמצעי אחסון של S7 מדולל.
    1. זיהוי taxonomical של חיידקים מודבקת:
      1. לבחור מושבות בודדות עם לולאה תרבות, resuspend כל אחד 10 µL של נוקלאז ללא מים. לאסוף 4 µL של השעיה זה ולהשתמש בו כתבנית עבור ה-PCR הגברה של הגן rRNA מטוסי אף-16 באמצעות צבעי יסוד התנאים המתוארים 2.7.1.
      2. לבצע רצף בעקבות פרוטוקול 2.7.3 ולאחר אימות של הרצף באמצעות ההליך הכלול 2.7.4.
  3. האם בבדיקות במורד הזרם כגון הכולל הפקת דנ א, qPCR כמת ו/או מטוסי אף-16 rRNA אמפליקון רצף, החילוץ-RNA transcriptomic פרופיל כרצונכם נוספות.
    הערה: כימות cytometry זרימה בוצעה מיד לאחר דגימה. בתור פקד עבור תאים permeabilized-ממברנה, שימש מדגם נחשפים 70 מעלות צלזיוס למשך 3 דקות. רעש רקע הוערכה על ידי מדידת עם cytometry זרימה של מערכת העיכול נוזלים או דגימות המתקבל המודל התרבות התא ללא חיידקים. כל מדגם נמדדה דולר.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

פרוטוקול זה מוביל הדור של מודל מתאים שחקרתי את הישרדות ואת הכדאיות של חיידקים אוראלי חשופים לתנאי המעבר מדומה במערכת העיכול. הסעיפים של תאים שלמים של זנים בודדים הוא כ 108 תאים מ ל-1 לפני הקמת הקהילה סינתטי, בעוד המיקרוקוסמוס התקדמות הכיל מעל 90% של התאים קיימא במהלך הקמת (הקהילה איור 1A ו 1B). בהתבסס על כימות חי/מת, הכדאיות חיידקי פוחתת לאחר כל שלב העיכול (איור 2). זו יכולה להיות תוצאה של חומצה pH במהלך המעבר קיבה ושל של מלחי מרה הכלול את הנוזלים עיכול של המעי הדק, כפי שקורה בתנאים פיזיולוגיים. הכדאיות במהלך המעבר דרך מערכת העיכול מערכת העיכול גם בתוך vitro וגם ויוו תלויים וריאציות בסביבה (למשל, האכיל לעומת התענה תנאים), או אפילו על תהליכים של הגנה על חיידקים (נבג היווצרות או ציפויים המעית).

זרימה cytometric ספירות יש להשוות עם פקדים מתאימים, כגון חום-נהרג חיידקים או רקע דגימות, לביצוע מדויק תא קיימא כימות18. התנאים הקשים של העיכול הקיבה והמעי הדק ניתן לעבור חיידקים לתאים קיימא אך הלא-culturable, אשר הם חיידקים לחיות לא גדלים או לחלק. מסיבה זו, צלחת ספירות נבדלים תא קיימא ספירת שהושג עם cytometry זרימה. לדוגמה, באיור 3, התאים קיימא התאוששה הממשק הרירית הם בצבעי כחול בעלילה cytometry זרימה. עם זאת, הצמיחה לא נצפתה כאשר הדוגמיות ריר הללו היו מצופים (תוצאות לא מוצג).

השבר שבו חיידקים הראה שיעור גבוה יותר של הקיום הוא ההריסות הסלולר (S7), התגלה על ידי הצלחת לספור (איור 4). המספר של המושבות עשוי להיות משתנה, אך נוכחות של חיידקים פעילים סמויה נמצא בדגימות פחות מדולל.

Figure 1
איור 1: התא הכדאיות של החיידק להלחין הקהילה מיקרוביאלי התקדמות בתחילת במבחנה עיכול במערכת העיכול. (א) בת קיימא תא ספירת (יומן יחידות) לכמת על ידי cytometry מכתים והזרימה חיים/מוות (הממוצע ± סטיית התקן, n = 3). (B) מגרש cytometry זרימה נציג הקהילה מיקרוביאלי התקדמות לאחר 48 שעות של תרבות משותפת. הנקודות מייצגים ירוק, אדום ושחור קיימא, פגום, רקע או שאינו מסווג חיידקים, בהתאמה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: תא הכדאיות של החיידקים לאחר עיכול במערכת העיכול מדומה- העמודות מייצגות את מספר התאים קיימא (יומן יחידות) לאחר במדרגות העיכול במעיים דרך הפה, הקיבה, קטן (הממוצע ± סטיית התקן, n = 3). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: עלילה ייצוגית של תאים חיידקיים קיימא הרירית לאטמוספרה. נקודות אדומות מייצגים את הנקודות רקע וכחול התאים קיימא. Flow cytometry תנאים הוקמו בהתבסס על האביזרים. et al. (2016) 19. הרירית היו בטחונות מדולל (v/v) ודוגמאות צבעונית עם Sybr Green/Propidium יודיד למשך 15 דקות, 100 µL מדגם נמדדה ב FL1: 533/30 ננומטר, FL2: 585/40 ננומטר, FL3: > 670 nm מסירה ארוכה, ו- FL4: 675/25 ננומטר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: המושבה יוצרי יחידות (CFU) גדלים מן ההריסות הסלולר ב ששינה BHI צלחות. משכפל ביולוגי שלושה שימשו וזמינותו אדהזיה חיידקי, משכפל טכני שלוש בוצעו עבור כימות CFU. שתי צלחות שכפל המכיל-1 ל-6 דילולים של ההריסות תא (S7) מוצגים באיור. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

תרבית תאים חסיד / השעיה Culturing בינוני תוספי תזונה כללי תוספי מזון ספציפיים הכפלת זמן המודל הפסיכוסקסואלי # שלב תנאים
קאקו-2 (ECACC 86010202) חסיד של Dulbecco ששינה נשר בינוני (DMEM) עם גלוקוז 4.5 g/L סרום שור עוברית מוחלש (10% v/v)
פניצילין (100 U/mL) *
סטרפטומיצין (0.1 mg/mL) *
שהוא גוסס (0.0025 mg/mL) *
Glutamax (4 מ מ)
הלא חיוני חומצות אמינו (1% v/v)
פירובט (1 מ)
65-72 h 95% לחות ו-10% CO2
CO2 מיכלים (ראה טבלה של חומרים)
HT29-MTX (ECACC 12040401) חסיד HEPES (1 מ) 20 – 24 h
* אנטיביוטיקה, תבחיני הוסרו מהתקשורת התרבות התא 2 ימים לפני שמתחילים את מבחני.

טבלה 1: תיאור של התא וקווי התקשורת ההרכב עבור תחזוקה התרבות התא.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Microbiome אוראלי הוא רכיב מפתח בבריאות האדם שדווחו לאחרונה על-ידי מחברים מספר20,21. ממצאים קודמים מראים כי הבליעה של רוק המכיל המון גדול של חיידקים יכולים להשפיע על המערכת האקולוגית מיקרוביאלית של המעי הדק, אשר הוא אחד האתרים המרכזיים עבור המערכת החיסונית תחול. השילוב של מודל סטטי עיכול במערכת העיכול העליונה עם ממשק מארח מיוצג על ידי תאים אפיתל, מפריש ריר המעי, שימש כדי לפענח את ההשפעה של הרכיב מיקרוביאלי במחשב המארח.

מודלים במבחנה הם כלים בסיסיים עבור מחקר, המאפשרות מחקרים מכניסטית והשגת הידע רקע נועדה לצמצם, להפוך את היעד יעיל יותר, ו טוב יותר ויוו מחקרים. מסיבה זו, חיוני להבטיח טוהר, הכדאיות, גדילה אופטימלית של תרבויות axenic לפני הקמת הקהילה מיקרוביאלי סינתטי. אנו ממליצים להעריך את הכדאיות ואת הרכב של קהילות חיידקי לפני חשיפה תרביות תאים, כדי למנוע הטיה בניתוח. מספר גבוה של חיידקים פגום עלול לעכב את הידבקות, עוד יותר להשפיע על השלמות של המודל תא. בנוסף, השימוש של מקור אמין של שורות תאים יצמצם תא קו לפציעות, זיהום, ביאור המסכן, שיפור הפארמצבטית ניסיוני22.

כולל תאים המייצרים ריר מאפשר דמיון המעי הדק, כמו ריר, mucins לספק קו ההגנה הראשון של מערכת העיכול23. בנוסף, השכבה הרירית מתאים colonisation חיידקי, המאפשר characterising תחבורה דו צדדיים של מטבוליטים חיידקי. יתר על כן, תנאי מדומה במערכת העיכול להגביר יכולת הדבקה של זנים לקטובצילוס paracasei קאקו-2 ו- mucin24, המשנה את הרלוונטיות של שילוב תהליכי העיכול במודל שלנו.

שיפורים נוספים במודל שיוכל לשלב רכיב המערכת החיסונית המארח, כפי שנבדקו בעבר25. עם זאת, מערכות תרבות משותפת הנוכחי של תאי אפיתל ואת המערכת החיסונית לא היו בשימוש עבור יישומים אינטראקציה מארח-חיידק (למשל, הערכה של תרכובות ביו מזון או פרוביוטיקה), אשר עשוי להצביע על מערכות אלה אולי חוסר הפארמצבטית25.

מחקרים קודמים עם קאקו-2, HT29-MTX או תרבויות המשנה העריכו את הידבקות של פרוביוטיקה או זנים פתוגניים ל תאים בתרבית של26,27. באמצעות יחידה כתמים או אסוציאציות של מיקרואורגניזמים כמה עשוי לספק סקירה מוגבלת על. החיידק המארח אינטראקציות, אינה מייצגת המורכבות מערכת העיכול. למרות השימוש של קהילות מיקרוביאלית טבעית יכול להיות נציג נוסף של התרחיש ויוו , הם קשים כדי לאפיין וכדי ללמוד. לעומת זאת, המתודולוגיה שלנו מציעה הזדמנות להעריך אינטראקציות מארח-חיידק מרובים, באמצעות מיקרוקוסמוס נציג ומורכבת. השימוש של קהילה מוגדרת מיקרוביאלי סינטטי מאפשר לדור של מערכת עם מורכבות מופחתת28. שינויים בקהילה יכול להיות תוצאה של התנאים microenvironmental בהקשר של ניסויים בודדים. לפיכך, הרכיב מיקרוביאלית של מודל זה ניתן בקלות לשנות למעלה או למטה בשביל לפרק את השפעת הסביבה ככוח סלקטיבי. לבסוף, דגימה נגישות ערבויות נוספות הטזה של הפעילות פונקציונליים של תאים אנושיים והן לקהילה מיקרוביאלי המשויך.

בשנים האחרונות, פותחו במבחנה דגמים חדשים המבוססים על טכנולוגיית תא צורב. Organoids הן תרביות תאים 3D משלבות כמה מן התכונות העיקריות של הרקמה העיקרית מייצגים. למרות organoids מעיים מערכת ליד-פיזיולוגיים של לומדים מבוגרים גזע תאים ורקמות, מודל כזה יש גם מספר מגבלות. Organoids מעיים יש שימוש מוגבל ב הדומה תגובות דלקתיות זיהום או סמים, כשהם חסרים תאים חיסוניים. בנוסף, organoids הם הטרוגנית לגבי הכדאיות, גודל, צורה, הפגיעה פנוטיפ ההקרנה ובעיבוד התקינה מורכבים. למרות המגבלה של שורות תאים מונצחים עבור במבחנה דוגמנות של רקמות בריאה, השימוש של שורות תאים מאופיין היטב ויציב גם מציע יתרונות כמו הדיר, הפארמצבטית ועלות נמוכה. יתרונות אלה מאפשרים להקרנה בו זמנית של מספר תנאים, אך השימוש translational הנתונים במחלוקת. ראשי תאים עשוי להיות נציג נוסף של ויוו פיזיולוגיה; עם זאת, הם יש השתנות בין-אישית גבוהה, לא מאופיינים באופן מלא, הטרוגניות, ויש להם מוגבל משך הזמן. גורמים אלו הם חיסרון להכללת תנאים מרובים או משכפל ב assay אחד.

כמו שילוב של שורות תאים עם קהילות מיקרוביאלי מורכב עשוי לייצג אתגר, התמקדנו על פיתוח מודל הדיר הדירים עם גמישות גבוהה ותחולה במעבדות עם מכשור התא הבסיסי, עד נציג נוסף מודלים הפך זמין גם כואבים. אנחנו העריכו את הפונקציונליות של קהילות שונות חיידקי באמצעות מודלים multicompartment אלה, למשל, להערכת התנהגות פרוביוטיקה במערכת העיכול העליונה ועל ההשפעה xenobiotic characterising הממשק הבטן. לכן, אנו מציעים מודל זה כבסיס עבור מבחני נוסף עם מגוון רחב של מוצרי פרוביוטיקה, סמים או תרכובות מזון, בתוך מערכת אקולוגית הרלוונטיים ומוגדר במבחנה .

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף

Acknowledgments

המחברים להכיר בהכרת תודה התמיכה הכספית מקרן מחקר פלנדריה מרתה Calatayud ארויו (FWO פוסט-דוקטורט במלגת-12N2815N). אמה הרננדז-Sanabria הוא בחור דוקטורט הנתמך על-ידי פלנדריה חדשנות ויזמות (Agentschap voor Innovatie הדלת Wetenschap en Technologie, IWT).

Materials

Name Company Catalog Number Comments
STRAINS
Aggregatibacter actinomycetemcomitans American Type Culture Collection ATCC 43718
Fusobacterium nucleatum American Type Culture Collection ATCC 10953
Porphyromonas gingivalis American Type Culture Collection ATCC 33277
Prevotella intermedia American Type Culture Collection ATCC 25611
Streptococcus mutans American Type Culture Collection ATCC 25175
Streptococcus sobrinus American Type Culture Collection ATCC 33478
Actinomyces viscosus American Type Culture Collection ATCC 15987
Streptococcus salivarius  TOVE-R
Streptococcus mitis American Type Culture Collection ATCC 49456
Streptococcus sanguinis BCCM/LMG Bacteria Collection LMG 14657
Veillonella parvula Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures DSM 2007
Streptococcus gordonii American Type Culture Collection ATCC 49818
CELL LINES
Caco-2 cells European Collection of Authenticated Cell Cultures 86010202
HT29-MTX cells European Collection of Authenticated Cell Cultures 12040401
REAGENTS AND CONSUMABLES
Brain Heart Infusion (BHI) broth Oxoid CM1135
Blood Agar 2 Oxoid CM0055 Blood Agar medium
Menadione Sigma M9429
Hemin Sigma H9039
5% sterile defibrinated horse blood E&O Laboratories Ltd, P030
InnuPREP PCRpure Kit Analytik Jena 845-KS-5010250 PCR purification kit
Big Dye Applied Biosystems 4337454 Dye for sequencing
ABI Prism BigDye Terminator v3.1 cycle sequencing kit Applied Biosystems 4337456
SYBR Green I Invitrogen S7585
Propidium Iodide Invitrogen P1304MP
T25 culture flasks uncoated, cell-culture treated, vented, sterile VWR 734-2311
Trypsin-EDTA solution Sigma-Aldrich T3924-100ML
Trypan Blue solution
0.4%, liquid, sterile-filtered
Sigma-Aldrich T8154 
PBS Gibco 14190250
DMEM cell culture media, with GlutaMAX and Pyruvate Life technologies 31966-047
Corning Transwell polyester membrane cell culture inserts Sigma-Aldrich CLS3450-24EA
Mucin from porcine stomach Type II   Sigma-Aldrich M2378
Inactivated fetal bovine serum Greiner Bio One 758093
Antibiotic-Antimycotic (100X) Gibco 15240062
Triton X 100 for molecular biology Sigma-Aldrich T8787 
DPBS without calcium, magnesium Gibco 14190-250
Pierce LDH Cytotoxicity Assay Kit Thermo Fisher Scientific 88953
Corning HTS Transwell-24 well, pore size 0.4 µm Corning Costar Corp 3450
Nuclease-free water Serva Electrophoresis 28539010
EQUIPMENT
Neubauer counting chamber improved Carl Roth T729.1
BD Accuri C6 Flow cytometer BD Biosciences 653118
PowerLyzer 24 Homogenizer MoBio 13155
T100 Thermal Cycler BioRad 186-1096
Flush system Custom made -
InnOva 4080 Incubator Shaker New Brunswick Scientific 8261-30-1007 Shaker for 2.10
Memmert CO2 incubator Memmert GmbH & Co. ICO150med
Millicell ERS (Electrical Resistance System) EMD Millipore, Merck KGaA MERS00002
Millipore Milli-Q academic, ultra pure water system Millipore, Merck KGaA -
Shaker (ROCKER 3D basic) IKA 4000000 Shaker for 6.10

DOWNLOAD MATERIALS LIST

References

  1. Sender, R., Fuchs, S., Milo, R. Revised estimates for the number of human and bacteria cells in the body. PLoS Biology. 14, e1002533 (2016).
  2. Kelly, D., King, T., Aminov, R. Importance of microbial colonization of the gut in early life to the development of immunity. Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis. 58-69 (2007).
  3. Aas, J. A., Paster, B. J., Stokes, L. N., Olsen, I., Dewhirst, F. E. Defining the normal bacterial flora of the oral cavity. Journal of Clinical Microbiology. 43, 5721-5732 (2005).
  4. Marsh, P. D., Head, D. A., Devine, D. A. Dental plaque as a biofilm and a microbial community-Implications for treatment. Journal of Oral Biosciences. 57, 185-191 (2015).
  5. Socransky, S. S., Haffajee, A. D., Cugini, M. A., Smith, C., Kent, R. L. Microbial complexes in subgingival plaque. Journal of Clinical Periodontology. 25, 134-144 (1998).
  6. Haffajee, A. D., et al. Subgingival microbiota in healthy, well-maintained elder and periodontitis subjects. Journal of Clinical Periodontology. 25, 346-353 (1998).
  7. Venema, K. Microbial metabolites produced by the colonic microbiota as drivers for immunomodulation in the host. The FASEB Journal. 27, (2013).
  8. Marzorati, M., et al. The HMI (TM) module: A new tool to study the Host-Microbiota Interaction in the human gastrointestinal tract in vitro. BMC Microbiology. 14, 133 (2014).
  9. Tanzer, J. M., Kurasz, A. B., Clive, J. Competitive displacement of mutans streptococci and inhibition of tooth-decay by Streptococcus-Salivarius Tove-R. Infection and Immunity. 48, 44-50 (1985).
  10. Slomka, V., et al. Nutritional stimulation of commensal oral bacteria suppresses pathogens: the prebiotic concept. Journal of Clinical Periodontology. 44, 344-352 (2017).
  11. Hernandez-Sanabria, E., et al. In vitro increased respiratory activity of selected oral bacteria may explain competitive and collaborative interactions in the oral microbiome. Frontiers in Cellular and Infection Microbiology. 7, 235 (2017).
  12. Alvarez, G., Gonzalez, M., Isabal, S., Blanc, V., Leon, R. Method to quantify live and dead cells in multi-species oral biofilm by real-time PCR with propidium monoazide. AMB Express. 3, (2013).
  13. Ehsani, E., et al. Initial evenness determines diversity and cell density dynamics in synthetic microbial ecosystems. Scientific Reports. 8, 340 (2018).
  14. Hernandez-Sanabria, E., et al. Correlation of particular bacterial PCR-denaturing gradient gel electrophoresis patterns with bovine ruminal fermentation parameters and feed efficiency traits. Applied and Environmental Microbiology. 76, 6338-6350 (2010).
  15. Masters, J. R., Stacey, G. N. Changing medium and passaging cell lines. Nature Protocols. 2, 2276-2284 (2007).
  16. Calatayud, M., Velez, D., Devesa, V. Metabolism of inorganic arsenic in intestinal epithelial cell lines. Chemical Research in Toxicology. 25, 2402-2411 (2012).
  17. Minekus, M., et al. A standardised static in vitro digestion method suitable for food - an international consensus. Food & Function. 5, 1113-1124 (2014).
  18. Berney, M., Hammes, F., Bosshard, F., Weilenmann, H. U., Egli, T. Assessment and interpretation of bacterial viability by using the LIVE/DEAD BacLight kit in combination with flow cytometry. Applied and Environmental Microbiology. 73, 3283-3290 (2007).
  19. Props, R., Monsieurs, P., Mysara, M., Clement, L., Boon, N. Measuring the biodiversity of microbial communities by flow cytometry. Methods in Ecology and Evolution. 7, 1376-1385 (2016).
  20. Yamashita, Y., Takeshita, T. The oral microbiome and human health. Journal of Oral Science. 59, 201-206 (2017).
  21. Wade, W. G. The oral microbiome in health and disease. Pharmacological Research. 69, 137-143 (2013).
  22. Yu, M., et al. A resource for cell line authentication, annotation and quality control. Nature. 520, 307 (2015).
  23. Pelaseyed, T., et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunological Reviews. 260, 8-20 (2014).
  24. Bengoa, A. A., et al. Simulated gastrointestinal conditions increase adhesion ability of Lactobacillus paracasei strains isolated from kefir to Caco-2 cells and mucin. Food Research International. 103, 462-467 (2018).
  25. Kleiveland, C. R., et al. The Impact of Food Bioactives on Health: in vitro and ex vivo models. Verhoeckx, K., et al. Springer International Publishing. 197-205 (2015).
  26. Laparra, J. M., Sanz, Y. Comparison of in vitro models to study bacterial adhesion to the intestinal epithelium. Letters in Applied Microbiology. 49, 695-701 (2009).
  27. Gagnon, M., Berner, A. Z., Chervet, N., Chassard, C., Lacroix, C. Comparison of the Caco-2, HT-29 and the mucus-secreting HT29-MTX intestinal cell models to investigate Salmonella adhesion and invasion. Journal of Microbiological Methods. 94, 274-279 (2013).
  28. Großkopf, T., Soyer, O. S. Synthetic microbial communities. Current Opinion in Microbiology. 18, 72-77 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics