इन विट्रो आंत मेजबान-सूक्ष्म जीव इंटरफेस पर एक सिंथेटिक बैक्टीरियल कंसोर्टियम की व्यवहार्यता का आकलन

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

आंत मेजबान-सूक्ष्म जीव बातचीत एक उपंयास एक सिंथेटिक मौखिक समुदाय के संयोजन दृष्टिकोण का उपयोग कर मूल्यांकन किया गया, इन विट्रो जठरांत्र पाचन में , और छोटी आंत उपकला का एक मॉडल । हम एक तरीका है कि रोगजनकों और बहु प्रजातियों के सेल आक्रमण का मूल्यांकन करने के लिए अनुकूलित किया जा सकता है वर्तमान फिल्म, या यहां तक कि प्रोबायोटिक योगों के जीवित रहने का परीक्षण करने के लिए ।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Calatayud Arroyo, M., Van de Wiele, T., Hernandez-Sanabria, E. Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface. J. Vis. Exp. (137), e57699, doi:10.3791/57699 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

मेजबान और microbiota के बीच एक साथ खेलना लंबे समय से मांयता प्राप्त है और बड़े पैमाने पर वर्णित है । मुंह जठरांत्र संबंधी मार्ग के अंय वर्गों के समान है, के रूप में निवासी microbiota होता है और exogenous जीवाणुओं द्वारा colonisation रोकता है । वास्तव में, बैक्टीरिया की ६०० से अधिक प्रजातियों मौखिक गुहा में पाए जाते हैं, और एक एकल व्यक्ति के चारों ओर ले जा सकते है १०० किसी भी समय अलग । मौखिक जीवाणु मौखिक पारिस्थितिकी तंत्र में विभिन्न niches का पालन करने की क्षमता के अधिकारी, इस प्रकार निवासी माइक्रोबियल समुदायों के भीतर एकीकृत बनने, और विकास और अस्तित्व के पक्ष में । हालांकि, निगलने के दौरान आंत में बैक्टीरिया का प्रवाह आंत microbiota के संतुलन को परेशान करने के लिए प्रस्तावित किया गया है । वास्तव में, पी gingivalis के मौखिक प्रशासन श्रोणि माइक्रोफ्लोरा में बैक्टीरियल संरचना स्थानांतरित कर दिया । हम प्राकृतिक मौखिक पारिस्थितिकी तंत्र का एक सरलीकृत प्रतिनिधित्व के रूप में एक सिंथेटिक समुदाय का इस्तेमाल किया, स्पष्ट के अस्तित्व और मौखिक जीवाणुओं की व्यवहार्यता अनुकरणीय जठरांत्र पारगमन शर्तों के अधीन । चौदह प्रजातियों का चयन किया गया, इन विट्रो लार, गैस्ट्रिक, और आंत्र पाचन प्रक्रियाओं के अधीन है, और एक multicompartment सेल कएको छैन-2 और HT29-MTX कोशिकाओं युक्त मॉडल के लिए प्रस्तुत करने के लिए आंत श्लैष्मिक उपकला अनुकरण । इस मॉडल को enterohepatic संचलन में शामिल कोशिकाओं पर निगल बैक्टीरिया के प्रभाव को जानने की सेवा की । सिंथेटिक समुदायों का उपयोग नियंत्रण और reproducibility के लिए अनुमति देता है । इस प्रकार, इस पद्धति रोगज़नक़ व्यवहार्यता और बाद में सूजन से जुड़े परिवर्तन, प्रोबायोटिक मिश्रण की औपनिवेशीकरण क्षमता का आकलन करने के लिए अनुकूलित किया जा सकता है, और अंततः, प्रणालीगत संचलन पर संभावित जीवाणु प्रभाव ।

Introduction

मनुष्य बैक्टीरिया के साथ cohabit, जो मानव कोशिकाओं के रूप में एक ही नंबर पर मौजूद हैं1. अत: मानव microbiome की व्यापक समझ प्राप्त करना महत्वपूर्ण है । मौखिक गुहा में एक अनूठा वातावरण है कि यह कई छोटे निवास में विभाजित है, इस प्रकार उन विभिंन स्थानों में बैक्टीरिया और फिल्म की एक विशाल विविधता युक्त । एक खुला पारिस्थितिकी तंत्र होने के नाते, मुंह में कुछ प्रजातियों क्षणिक आगंतुकों हो सकता है । हालांकि, कुछ सूक्ष्मजीवों उपनिवेश के बाद जल्द ही जंम और फार्म का आयोजन किया2फिल्म । ये मसूड़ों दरार के ऊपर दांत की सतह में पाए जाते हैं, subgingival दरार, जीभ, श्लैष्मिक सतहों और दंत कृत्रिमता और fillings3। बैक्टीरिया भी दांत नहर के लुमेन में flocs और planktonic कोशिकाओं के रूप में उपस्थित हो सकते हैं, या तो गल लुगदी ऊतक के साथ मिश्रित या एक द्रव चरण में निलंबित कर दिया ।

वहां सक्रिय है, लगातार पार मेजबान कोशिकाओं और निवासी microbiota4के बीच बात करते हैं । बैक्टीरिया के भीतर और प्रजातियों के बीच संवाद, और प्राकृतिक कॉलोनाइजरों का केवल एक छोटा सा अनुपात ऊतकों का पालन कर सकते हैं, जबकि अन्य बैक्टीरिया इन प्राथमिक कॉलोनाइजरों के लिए देते हैं. उदाहरण के लिए, सेल सेल-सूक्ष्मजीवों के बीच बंधन माध्यमिक कॉलोनाइजरों मौखिक में एकीकृत करने के लिए कुंजी है फिल्म, और बातचीत माइक्रोबियल कोशिकाओं4के जटिल नेटवर्क का निर्माण । एक लार नमूने में बैक्टीरियल समुच्चय के लगभग ७०% Porphyromonas एसपी द्वारा गठित कर रहे हैं., स्ट्रेप्टोकोकस सपा., Prevotella सपा., Veillonella सपा., और अज्ञात Bacteroidetesएफ. के. nucleatum ने दिवंगत कॉलोनाइजरों पी. gingivalis, टी. denticola, और Tannerella forsythia, जो periodontitis5में फंसाया है, के साथ subgingivalी फिल्म और समुच्चय में एक मध्यवर्ती कॉलोनाईजर है. इसके अलावा, स्ट्रेप्टोकोकस mitis दोनों श्लैष्मिक और दंत निवास स्थान पर रह रहे हैं, जबकि एस sanguinis और एस gordonii दांत उपनिवेश को पसंद करते है3। इस प्रकार, एस sanguinis लोअर कृन्तक और कुत्तों में मौजूद है, जबकि Actinomyces naeslundii ऊपरी पूर्वकाल में पाया गया है6

इसके अलावा स्वदेशी microbiome मानव स्वास्थ्य को बनाए रखने में भूमिका निभाता है2. निवासी microbiota प्रतिरक्षा शिक्षा में भाग लेता है और रोगजनक विस्तार को रोकने में । इस colonisation प्रतिरोध होता है क्योंकि देशी बैक्टीरिया बेहतर सतहों के लिए संलग्न में अनुकूलित किया जा सकता है, और अधिक कुशल विकास के लिए उपलब्ध पोषक तत्वों metabolising पर. हालांकि प्रोबायोटिक उपभेदों जठरांत्र मार्ग जीवित रहने और सक्रिय रहते हैं, जठरांत्र संबंधी मार्ग के एक ऊपरी स्थान से निगल autochthonous बैक्टीरिया के हठ पूरी तरह से वर्णित नहीं किया गया है । इस प्रकार, हम एक कृत्रिम समुदाय, मौखिक पारिस्थितिकी तंत्र के प्रतिनिधि, नकली जठरांत्र पारगमन शर्तों के अधीन । बैक्टीरियल कोशिकाओं की व्यवहार्यता आंत उपकला जैसी एक multicompartment मॉडल का उपयोग कर मूल्यांकन किया गया था. वर्तमान आंत सिमुलेटर चमकदार माइक्रोबियल समुदाय7के विश्लेषण के मामले में उपयुक्त reproducibility प्रदान करते हैं । हालांकि, बैक्टीरियल आसंजन और मेजबान सूक्ष्म जीव बातचीत अलग से संबोधित कर रहे हैं, माइक्रोबियल समुदायों के साथ सेल लाइनों के संयोजन के रूप में8चुनौती दे रहा है । इसके विपरीत, हम एक रूपरेखा है कि सफल औपनिवेशीकरण आंत अंतरफलक पर रिपोर्ट की घटनाओं के संभावित यंत्रवत विवरण प्रदान करता है प्रस्तुत करते हैं । दरअसल, इस मॉडल को संयुक्त रूप से एक स्थिर आंत मॉडल के साथ प्रयोग किया जा सकता है मेजबान सतह संकेत पर माइक्रोबियल समुदायों के प्रभाव का मूल्यांकन ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. उपभेदों और संस्कृति की स्थिति

नोट: सिंथेटिक मौखिक समुदाय उपभेदों आमतौर पर मौखिक microbiome3में मौजूद द्वारा रचित किया गया था ।

  1. अमेरिकी प्रकार संस्कृति संग्रह (ATCC) से निम्नलिखित उपभेदों प्राप्त करें: Aggregatibacter actinomycetemcomitans (ATCC ४३७१८), Fusobacterium nucleatum (ATCC १०९५३), Porphyromonas gingivalis (ATCC ३३२७७), Prevotella मीडिया (ATCC २५६११), स्ट्रेप्टोकोकस mutans (ATCC २५१७५), स्ट्रेप्टोकोकस sobrinus (ATCC ३३४७८), Actinomyces naeslundii (ATCC ५१६५५), स्ट्रेप्टोकोकस gordonii (ATCC ४९८१८), Actinomyces viscosus (ATCC १५९८७), और स्ट्रेप्टोकोकस mitis (ATCC ४९४५६) ।
  2. लाइबनिट्स संस्थान DSMZ से Veillonella parvula मोल-सूक्ष्मजीवों और सेल संस्कृतियों के जर्मन संग्रह (DSM २००७), स्ट्रेप्टोकोकस से sanguinis/एलएमजी बैक्टीरिया संग्रह (एलएमजी १४६५७) और उपयोग स्ट्रेप्टोकोकस salivarius तनाव टोवे-आर9, और स्ट्रेप्टोकोकस oralis10

2. ओरल Microbiome के एक Multispecies समुदाय के प्रतिनिधि का विकास

नोट: एक सिंथेटिक समुदाय उत्पंन करने के लिए इन विट्रो आंत उपकला में मौखिक जीवाणुओं के संभावित आसंजन क्षमता अनुकरण । बढ़ने बैक्टीरिया पर रक्त आगर प्लेटों के साथ पूरक 5 μg/एमएल हेमीन, 1 μg/एमएल menadione, और 5% बाँझ defibrinated हार्स रक्त, के रूप में वर्णित Hernandez-Sanabria एट अल. (२०१७) 11. संक्षेप में:

  1. 1 मीटर NaOH के 2 मिलीलीटर में हेमीन के १०० मिलीग्राम भंग, आसुत autoclaved पानी की १०० मिलीलीटर जोड़ें । एक अंधेरे कंटेनर में स्टोर । मध्यम करने के लिए जोड़ने से पहले एक ०.२२ µm फिल्टर के माध्यम से निष्फल.
  2. भंग १०० ९६% इथेनॉल के 20 मिलीलीटर में menadione के मिलीग्राम । मध्यम करने के लिए जोड़ने से पहले एक ०.२२ µm फिल्टर के माध्यम से निष्फल.
  3. निर्माता के निर्देशों और आटोक्लेव के अनुसार रक्त आगार मध्यम ( सामग्री तालिकादेखें) के 1 एल तैयार करें । घोड़ा रक्त और पूरक जोड़ने से पहले शांत हो जाओ । मिश्रण और प्लेटें डालो ।
  4. संशोधित ब्रेन हार्ट इन्फ्यूश़न (BHI) शोरबा के रूप में पहले12की सूचना तैयार । autoclaving के बाद menadione के 5 μg/एमएल के हेमीन और 1 μg/एमएल जोड़ें ।
  5. Hungate ट्यूबों में मध्यम के 9 मिलीलीटर वितरण, और एक रबर डाट और एक एल्यूमीनियम टोपी के साथ बंद । N2/CO2 (90%/10%) के साथ ट्यूब फ्लश ।
  6. एक सिरिंज के साथ anaerobic मध्यम के 1 मिलीलीटर निकालते हैं और यह एक १.५ मिलीलीटर microcentrifuge ट्यूब में जगह है । प्रत्येक जीवाणु प्रजातियों में से एक कालोनियों उठाओ, मध्यम में reसस्पैंड, और anaerobic संशोधित BHI में वापस हस्तांतरण । ३७ ° c पर ४८ ज के लिए मशीन, एस salivarius, जो 24 एच के लिए किया जाना चाहिए के लिए छोड़कर ।
  7. यदि आवश्यक हो, सिंथेटिक समुदाय कोडांतरण से पहले संस्कृतियों की पवित्रता की पुष्टि करें । संक्षेप में:
    1. Hernandez-Sanabria एट अल के रूप में तरल संस्कृतियों से डीएनए निकालें । (२०१०) 13 और बढ़ाना 16S rRNA जीन का उपयोग प्राइमर 27F (AGAGTTTGATYMTGGCTCAG) और 1492R (TACGGYTACCTTGTTACGACT), और निंनलिखित कार्यक्रम: ९५ ° c, ९५ ° c के 30 चक्र 1 मिनट के लिए, ५५ ° c 1 मिनट के लिए, और ७२ ° c के लिए १.५ मिनट, एक अंतिम विस्तार कदम द्वारा पीछा ७२ डिग्री सेल्सियस पर 5 मिनट की ।
    2. एक वाणिज्यिक किट के साथ पीसीआर उत्पाद शुद्ध ( सामग्री की तालिकादेखें), निर्माता के निर्देशों का पालन ।
    3. एक 10 μL कुल मात्रा में शुद्ध उत्पादों के sequencing प्रतिक्रिया प्रदर्शन ०.५ डाई की μL युक्त ( सामग्री की तालिकादेखें), M13f प्राइमर के ३.२ pmol (CGCCAGGGTTTTCCCAGTCACGAC), २.० 5x अनुक्रमण बफर के μL, और 20 टेंपलेट के एनजी, एक का उपयोग कर किट के साथ वाणिज्यिक अनुक्रमण प्रणाली ( सामग्री की तालिकादेखें) ।
      नोट: हम इस प्रक्रिया को वाणिज्यिक प्रदर्शन किया था ।
    4. सभी दृश्यों पर एक विस्फोट खोज प्रदर्शन (http://blast.ncbi.nlm.nih.gov/Blast.cgi) निकटतम ज्ञात taxon निर्धारित करने के लिए और RDP वर्गीकारक ऑनलाइन उपकरण (http://rdp.cme.msu.edu/) और सिना का उपयोग मूल तनाव के अनुक्रम के साथ तुलना संरेखण सेवा (https://www.arb-silva.de/aligner/) ।
  8. मशीन के अंत में सेल संख्या उपाय, प्रवाह cytometry और SYBR ग्रीन/Propidium आयोडाइड दाग का उपयोग कर के रूप में Hernandez-Sanabria एट अल में वर्णित है । (२०१७) 11. 105 कोशिकाओं मिलीलीटर-1, संशोधित BHI का उपयोग करने के लिए संस्कृतियों को पतला ।
  9. anaerobic BHI के ७५ मिलीलीटर में एस. mitis की 1 मिलीलीटर जोड़ें और स्थिर चरण (6 एच) तक गर्मी । निंनलिखित, प्रत्येक पतला तनाव और anaerobic शर्तों के तहत मिश्रण के ०.७५ मिलीलीटर इकट्ठा ।
  10. एक बार सभी संस्कृतियों मिलाया गया है, सूक्ष्म जगत के 1 मिलीलीटर ले, और BHI के ७५ मिलीलीटर में जोड़ें । 10% CO 2, 10% h2, ८०% N2 ४८ H के लिए ३७ ° c और २०० rpm ( सामग्री की तालिकादेखें) के तहत सिंथेटिक समुदाय की मशीन ।
  11. उपाय के रूप में २.८ में सेल घनत्व । समुदाय को सेल मॉडल में पेश करने से पहले । समुदाय की संरचना मात्रात्मक वास्तविक समय पीसीआर के साथ मूल्यांकन किया जा सकता है, प्राइमरों और Slomka एट अल के 1 टेबल में एनीलिंग तापमान का उपयोग कर । (२०१७) 10. इसके अलावा,13,14वर्तमान प्रारंभिक सदस्यों के बारे में जानकारी प्रदान करने के लिए 16S rRNA जीन amplicon अनुक्रमण का उपयोग करें । या तो पहचान-पुष्टि प्रोटोकॉल के लिए, एक के रूप में उपयोग सीडीएनए के लिए बैक्टीरिया सक्रिय रूप से टाइप प्रोटीन संकेत टेंपलेट, और एक के रूप में डीएनए का उपयोग करें उपस्थिति प्रकट/

3. जनरल सेल संस्कृति प्रथाओं

नोट: सेल संस्कृति के सामांय पहलुओं के लिए, लेखक गुरु और स्टेसी (२००७)15को देखें । प्रमाणीकृत कक्ष संस्कृतियों (कएको छैन-2 ECACC ८६०१०२०२ और HT29-MTX-E12 ECACC १२०४०४०१, सार्वजनिक स्वास्थ्य इंग्लैंड, यूके) के यूरोपीय संग्रह से उपयोग किया गया कक्ष पंक्तियाँ प्राप्त करें । सेल संस्कृति के लिए रिएजेंट खरीदा जा सकता है ( सामग्री की तालिकादेखें), जब तक अंयथा निर्दिष्ट ।

  1. कएको छैन-2 और HT29-MTX सेल लाइनों के रखरखाव और passaging
    नोट: कएको छैन-2 और HT29-MTX कोशिकाओं नियमित रूप से 25 सेमी2 ऊतक संस्कृति के पूरक DMEM मध्यम (तालिका 1) युक्त कुप्पी में उगाया जाता है । कोशिकाएँ जब ६०-७०% संगम पर पहुँच जाती हैं तो trypsinized होती हैं.
    1. सेल कल्चरल मीडियम को कुप्पी से निकाल दें । सीए+ +/Mg++ के बिना पंजाब के 5 मिलीलीटर के साथ दो बार धो लें ।
    2. trypsin और ०.२२ g/l ईथीलीन डायमाइन tetraacetic अम्ल (EDTA) के एक ०.५ मिलीग्राम/l समाधान के 2 मिलीलीटर जोड़ें । धीरे से कुप्पी ले जाकर trypsin समाधान वितरित करें । trypsin समाधान के १.५ मिलीलीटर निकालें और 10 मिनट के लिए ३७ डिग्री सेल्सियस पर कुप्पी मशीन ।
    3. अगर कोशिकाओं कुप्पी सतह से अलग कर रहे हैं माइक्रोस्कोप के तहत जाँच करें । अतिरिक्त 5 मिनट के लिए मशीन, अगर जरूरत है ।
    4. trypsin को निष्क्रिय करने के लिए कुप्पी के लिए पूरक सेल संस्कृति मीडिया के 5 मिलीलीटर जोड़ें । प्लास्टिक ऊपर और नीचे एक समरूप एकल सेल निलंबन प्राप्त करने के लिए ।
    5. तुरंत, एक ५० µ एल aliquot सेल निलंबन के साथ और मिश्रण बाँझ ०.४% Trypan नीले समाधान में एक 1:1 (v/v) अनुपात के साथ कएको छैन-2 कोशिकाओं या 1:5 वी/वी के लिए HT29-MTX । एक मतगणना कक्ष में pipetting और लोड करके मिक्स ( सामग्री की तालिकादेखें) ।
    6. व्यवहार्य कोशिकाओं (सफेद उज्ज्वल कोशिकाओं) माइक्रोस्कोप के तहत गणना (निर्माता के निर्देश देखें) ।
    7. 4 x 105 कोशिकाओं के घनत्व पर एक नई कुप्पी में बीज/सेमी2 और 1 x 104 कोशिकाओं/सेमी 2, कएको छैन-2 और HT29-MTX, के लिए क्रमशः ।
      नोट: (1) कएको छैन-2 कोशिकाओं अंतर और तंग जंक्शनों फार्म एक बार प्रवाह तक पहुंचने । यह trypsinization से पहले ओवर-प्रवाह से बचने के लिए अत्यंत महत्वपूर्ण है । कुप्पी में कोशिकाओं के अधिक वृद्धि trypsinization और/या सेल के झुरमुट के बाद कोशिका टुकड़ी में असफलता का कारण बन सकता है । (2) HT29-MTX कोशिकाओं बलगम उच्च चयापचय गतिविधि के साथ कोशिकाओं के उत्पादन16हैं । इन सुविधाओं सेल संस्कृति मीडिया की एक तेजी से अंलीकरण कारण हो सकता है, खासकर अगर कोशिकाओं उच्च घनत्व पर हैं । HEPES बफर सेल संस्कृति मध्यम (तालिका 1) के लिए 7 और ७.२ के बीच पीएच बनाए रखने के लिए जोड़ा जा सकता है । यदि पीएच बूंदें, मध्यम विमर्श किया जा सकता है जब प्रभावित ५०% से कम है । हालांकि, अगर > 50% प्रवाह, सेल संस्कृति विभाजित किया जाना चाहिए ।

4. एक Multicompartment सेल का पेट मेजबान-सूक्ष्म जीव इंटरफेस अनुकरण मॉडल के विधानसभा

नोट: पूर्ण सह-संस्कृति डबल चैंबर वेल्स में (व्यास 24 मिमी, ताकना आकार ०.४ माइक्रोन; सामग्री की तालिकादेखें) ।

  1. शिखर डिब्बे और बेसल करने के लिए 2 मिलीलीटर के लिए पूरा सेल संस्कृति मीडिया के १.५ मिलीलीटर जोड़ें । 20 के लिए पूर्व-गर्मी-30 मिनट सेल निलंबन के भी वितरण प्राप्त करने के लिए जब सीडिंग ।
  2. Trypsinize की कोशिका संस्कृति को कएको छैन-2 और HT29-MTX की धारा 3 में वर्णित किया गया है । trypsinization प्रक्रिया सही दोनों सेल लाइनों के समरूप वितरण प्राप्त करने के बाद, एक ही कक्ष निलंबन में, झुरमुट के बिना होना चाहिए ।
  3. 3.1.8 में वर्णित के रूप में व्यवहार्य कोशिकाओं गिनती ।
  4. ६.५ x 104 कोशिकाओं/कएको छैन-2/HT29- MTX कोशिकाओं के 90/10 के अनुपात में सेल घनत्व को समायोजित करें ।
  5. Homogenize सेल सस्पेंशन और पूरक सेल संस्कृति मीडिया के साथ एक पूर्व भर बाँझ कंटेनर के लिए कएको छैन-2 और HT29-MTX कोशिकाओं की इसी मात्रा में जोड़ें । आकांक्षा द्वारा चैंबर के शिखर ओर से पूर्व-मशीनी मीडिया को हटा दें ।
  6. धीरे से pipetting द्वारा सेल सस्पेंशन मिश्रण, और १.५ एमएल चैंबर आवेषण के शिखर डिब्बे में स्थानांतरण । सीडिंग प्रक्रिया सेल निलंबन की एक निरंतर homogenization की आवश्यकता है, के रूप में कोशिकाओं तलछट के लिए करते हैं । उपयोगकर्ता और काम की गति के अनुभव के आधार पर, सेल निलंबन 1-3 कुओं के वितरण के बाद मिलाया जाना चाहिए ।
  7. धीरे पिछड़े और आगे प्लेटों हटो और फिर सही करने के लिए बाएं से दाएं (5-10 बार) अच्छी तरह से कोशिकाओं का एक भी प्रसार प्राप्त करने के लिए । मशीन के लिए स्थानांतरण और प्लेटों के आंदोलन को दोहराने ।
  8. कएको छैन-2/HT29-MTX कोशिकाओं की सह-संस्कृति को 15 दिनों के लिए, ताज़ा शिखर और बेसल डिब्बों को पूरक DMEM के साथ हर 2 दिन बनाए रखें । इस समय के बाद, कोशिका संस्कृति मीडिया एंटीबायोटिक/antimycotic समाधान के बिना पूरक DMEM के लिए बदला जा सकता है ।
  9. इस प्रणाली को बनाए रखने के 20-21 दिनों के बाद से मध्यम हर 2 दिन ताज़ा द्वारा बीज ।
  10. परख शुरू करने से पहले उपकला बाधा अखंडता को मापने, एक विद्युत प्रतिरोध प्रणाली का उपयोग (सामग्री की तालिका देखें), निर्माता निर्देशों का पालन.
    1. सुनिश्चित करें कि तीळ उपकरण पूरी तरह से चार्ज है (> 24 एच) माप शुरू करने से पहले.
    2. एक प्लास्टिक आटोक्लेव बैग के साथ बिजली की आपूर्ति और कवर से तीळ उपकरण डिस्कनेक्ट । बैग में एक छेद बनाओ इलेक्ट्रोड परिचय और मीटर पर इनपुट बंदरगाह में प्लग । प्रवाह कैबिनेट में तीळ उपकरण शुरू करने से पहले ७०% इथेनॉल/पानी (वी/वी) के साथ स्प्रे ।
    3. इलेक्ट्रोड को संक्रमित करने के लिए, 15 मिनट के लिए ७०% इथेनॉल/पानी में इलेक्ट्रोड युक्तियां विसर्जित (वी//15 एस के लिए शुष्क हवा के लिए अनुमति दें पहले गर्म सेल संस्कृति मीडिया में इलेक्ट्रोड कुल्ला ।
    4. कक्ष मशीन से बाहर ले जाओ और कोशिकाओं के प्रवाह कैबिनेट के अंदर कमरे के तापमान पर आने के लिए अनुमति देते हैं ।
    5. सुनिश्चित करें कि मीटर चार्जर से कट गया है । Ohms करने के लिए मोड स्विच सेट और पावर स्विच चालू करें ।
    6. संमिलित करें और अब अच्छी तरह से बाहर टिप में कम टिप के साथ इलेक्ट्रोड विसर्जित करके सेल प्रतिरोध को मापने । इलेक्ट्रोड एक ९० ° कोण पर प्लेट डालने के लिए रखें ।

5. बैक्टीरियल अस्तित्व इन विट्रो जठरांत्र पारगमन शर्तों में निंनलिखित

नोट: Minekus एट अल के प्रोटोकॉल के बाद नकली पाचन तरल पदार्थ तैयार करते हैं । (२०१४) 17, नीचे वर्णित संशोधनों के साथ । ultrapure पानी के साथ सभी कमजोरियां तैयार करते हैं । फ़िल्टर-एक ०.२२ µm फिल्टर के माध्यम से सभी समाधान निष्फल और बाँझ शर्तों के तहत पाचन प्रक्रिया प्रदर्शन.

  1. मौखिक पाचन:
    1. एक ५० मिलीलीटर बाँझ ट्यूब में बैक्टीरियल समुदाय के 3 मिलीलीटर प्लेस, नकली लार द्रव (SSF) के 3 मिलीलीटर के साथ मिश्रण, युक्त (mmol एल-1में): KCl, १५.१; KH2पो4, ३.७; NaHCO3, ६.८; MgCl(एचओ), ०.५, (NH) जपान, ०.०६; एचसीएल, १.१; CaCl(एचओ), ०.७५. मानव लार से α-amylase के ७५ U/एमएल जोड़ें प्रकार IX-A और 2 g/L mucin से सुअर का पेट प्रकार द्वितीय से SSF ।
    2. 2 मिनट, ३७ डिग्री सेल्सियस, और १०० rpm पर के लिए मिश्रण की मशीन । डीएनए निष्कर्षण और प्रवाह cytometry ठहराव (एस 1) के लिए एक 2 मिलीलीटर नमूना लीजिए ।
  2. गैस्ट्रिक पाचन:
    1. नकली गैस्ट्रिक द्रव (SGF) के 4 मिलीलीटर जोड़ें, जिसमें (mmol L-1में): KCl, ६.९; KH2पो4, ०.९; NaHCO3, 25; NaCl, ४७.२; MgCl(एचओ), ०.१, (NH) जपान, ०.५; एचसीएल, १५.६; CaCl(एचओ), ०.०७५. इसके अलावा, SGF सुअर का पेट प्रकार द्वितीय से mucin के 2 g/L निहित ।
    2. पीएच को मापने और 1 एम एचसीएल के साथ पीएच 3 समायोजित करने के लिए अगर जरूरत है । ३७ ° c और १०० rpm पर मशीन । एक 2 मिलीलीटर नमूना (S2) ले लीजिए ।
  3. छोटी आंत पाचन:
    1. नकली आंत्र द्रव (SIF) युक्त (mmol L-1में): KCl, ६.८ के 4 मिलीलीटर जोड़ें; KH2पो4, ०.८; NaHCO3, ८५; NaCl, ३८.४; MgCl(एचओ), ०.३३; एचसीएल, ८.४; CaCl(एचओ), ०.३; पाचन ट्यूब करने के लिए ।
    2. 1 मीटर NaOH के साथ पीएच 7 को समायोजित करें, यदि आवश्यक हो । ३७ ° c और १०० rpm पर मशीन । एक 2 मिलीलीटर नमूना (S3) ले लीजिए ।

6. बैक्टीरियल औपनिवेशीकरण क्षमता इन विट्रो जठरांत्र पारगमन शर्तों में निंनलिखित

  1. छोटे आंत पाचन के 2 मिलीलीटर, 10 मिनट के लिए २,६५० x gपर ।
  2. supernatant निकालें और एंटीबायोटिक और antimycotic के बिना पूरक DMEM के 5 मिलीलीटर के साथ बैक्टीरियल गोली मिश्रण ।
  3. दाग और एक प्रवाह cytometer का उपयोग कर बरकरार/क्षतिग्रस्त कोशिकाओं ( सामग्री की तालिकादेखें), Hernandez-Sanabria एट अल द्वारा वर्णित के रूप में । (२०१७) 11.
  4. एंटीबायोटिक और antimycotic के बिना पूरक DMEM में कमजोर द्वारा 105 व्यवहार्य कोशिकाओं/एमएल के लिए सेल घनत्व को समायोजित करें ।
  5. transwell प्रणाली के शिखर मध्यम निकालें और बैक्टीरियल सस्पेंशन के १.५ मिलीलीटर जोड़ें । सह संस्कृति जनरल सेल संस्कृति शर्तों के तहत 2 एच के लिए प्रणाली (३७ ° c, ९५% आर्द्रता, 5% सह2) ।
    नोट: इस समय ४८ एच तक बढ़ाया जा सकता है, प्रयोगात्मक आवश्यक प्रोटोकॉल के आधार पर. सह संस्कृति एक अलग मशीन में है कि नियमित सेल रखरखाव के लिए इस्तेमाल किया, संदूषण से बचने के लिए बनाए रखा जा सकता है ।
  6. मशीन के बाद तीळ मूल्यों को मापने, ४.११ में वर्णित के रूप में उपकला बाधा की अखंडता का मूल्यांकन करने के लिए.
  7. मशीन समय को पूरा करने पर, शिखर मीडिया को हटाने, और आगे विश्लेषण (S4) के लिए ०.५ मिलीलीटर इकट्ठा । मीडिया का एक नमूना स्तनपान डिहाइड्रोजनेज (LDH) परख द्वारा सेल व्यवहार्यता के आकलन के लिए इस्तेमाल किया जा सकता है ( सामग्री की तालिकादेखें), निर्माता निर्देशों का पालन ।
  8. HBSS में 10 मिमी N-असेटयलस्यस्थेने की ०.५ मिलीलीटर जोड़ें (एनएसी-बफर) HT29-MTX द्वारा उत्पादित बलगम solubilize करने के लिए और पालने बैक्टीरिया को ठीक करने के लिए. 1 एच के लिए ३७ ° c पर प्लेटें आंदोलन के तहत (१३५ rpm, सामग्री की मेजदेखें) ।
  9. एक microcentrifuge ट्यूब (S5) में एनएसी-HBSS पुनर्प्राप्त करें और 1 मिलीलीटर DPBS के साथ दो बार कोशिकाओं को धो लें ।
  10. monolayers के शीर्ष पर ०.५% ट्राइटन X-१०० (डब्ल्यू/वी) की ०.५ मिलीलीटर जोड़ें, pipetting द्वारा कोशिकाओं को बाधित, 1 मिनट के लिए तरल और भंवर की वसूली. गति डिटर्जेंट के साथ बैक्टीरियल कोशिकाओं को नुकसान पहुँचाए से बचने के लिए महत्वपूर्ण है ।
  11. २,६५० x gपर 5 मिनट के लिए कोशिकाओं के केंद्रापसारक, और supernatant (S6) और गोली (S7) अलग ।

7. नमूना विश्लेषण

नोट: एक नकली जठरांत्र पाचन के बाद, आंतों की कोशिकाओं के लिए बैक्टीरियल व्यवहार्यता और आसंजन क्षमता का मूल्यांकन करने के लिए एकत्र नमूनों (एस-S7) का विश्लेषण करें ।

  1. बैक्टीरियल व्यवहार्यता: एक ०.४५ µm के माध्यम से एस 1-S5 दो बार पास नमूने और जीवाणु कोशिकाओं रहते/मृत सेल धुंधला और प्रवाह cytometry का उपयोग कर, के रूप में चरण २.८11में संकेत दिया ।
  2. आसंजन क्षमता: सीरियल कमजोर पड़ने के लिए तैयार (-1 से-8) एस-S6 और लकीर के लिए 10 µ एल रक्त में आगर और संशोधित BHI प्लेटों. 24 के लिए anaerobic शर्तों के तहत ३७ डिग्री सेल्सियस पर मशीन-48 एच प्लेट unपतला S7 का एक ही मात्रा ।
    1. Taxonomical का पालन बैक्टीरिया की पहचान:
      1. एक संस्कृति पाश के साथ व्यक्तिगत कालोनियों उठाओ और nuclease मुक्त पानी की 10 µ एल पर प्रत्येक reसस्पेंड । इस निलंबन के 4 µ एल लीजिए और यह 16S rRNA जीन की पीसीआर प्रवर्धन के लिए एक टेम्पलेट के रूप में उपयोग प्राइमरों और 2.7.1 में वर्णित शर्तों का उपयोग कर.
      2. 2.7.3 में प्रोटोकॉल के बाद sequencing निष्पादित करें, और 2.7.4 में शामिल कार्यविधि का उपयोग करते हुए अनुक्रम का सत्यापन ।
  3. ऐसे कुल डीएनए निष्कर्षण, qPCR ठहराव और/या 16S rRNA amplicon अनुक्रमण, आरएनए निष्कर्षण, और transcriptomic profiling के रूप में वांछित के रूप में आगे बहाव विश्लेषण करते हैं ।
    नोट: प्रवाह cytometry ठहराव नमूना के बाद तुरंत किया गया था । झिल्ली-permeabilized कोशिकाओं के लिए एक नियंत्रण के रूप में, 3 मिनट के लिए ७० ° c से अवगत कराया नमूना का उपयोग किया गया था । पृष्ठभूमि शोर cytometry पाचन तरल पदार्थ या बैक्टीरिया के बिना सेल संस्कृति मॉडल से प्राप्त नमूनों के प्रवाह के साथ मापने के द्वारा मूल्यांकन किया गया था । हर सैंपल को तपसिल में मापा गया ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

इस प्रोटोकॉल एक elucidating के अस्तित्व और मौखिक जीवाणुओं की व्यवहार्यता नकली जठरांत्र पारगमन शर्तों के अधीन के लिए उपयुक्त मॉडल की पीढ़ी की ओर जाता है । व्यक्तिगत उपभेदों से बरकरार कोशिकाओं की गिनती लगभग है 108 कोशिकाओं मिलीलीटर-1 सिंथेटिक समुदाय के निर्माण से पहले, जबकि multispecies सूक्ष्म जगत समुदाय की स्थापना के दौरान व्यवहार्य कोशिकाओं के ९०% से ऊपर निहित ( चित्र 1a और 1b) । जीवित/मृत ठहराव के आधार पर, प्रत्येक पाचन कदम (चित्रा 2) के बाद बैक्टीरियल व्यवहार्यता घटाता है । यह गैस्ट्रिक बीतने के दौरान और पित्त लवण छोटी आंत पाचन तरल पदार्थ में निहित के दौरान एसिड पीएच का परिणाम हो सकता है, के रूप में शारीरिक स्थितियों के तहत होने वाली । इन विट्रो में और vivo जठरांत्र पाचन में दोनों के माध्यम से पारगमन के दौरान व्यवहार्यता पर्यावरण में बदलाव पर निर्भर हो सकता है (जैसे, फेड बनाम तेजी से शर्तों), या यहां तक कि बैक्टीरिया संरक्षण प्रक्रियाओं पर (बीजाणु गठन या प्रवेश कोटिंग्स) ।

प्रवाह cytometric गिनती उपयुक्त नियंत्रण के साथ तुलना में होना चाहिए, जैसे गर्मी के मारे बैक्टीरिया या पृष्ठभूमि के नमूने, सटीक व्यवहार्य सेल ठहराव18प्रदर्शन करने के लिए. पेट और छोटी आंत पाचन की कठोर शर्तों बैक्टीरिया व्यवहार्य लेकिन गैर-culturable कोशिकाओं है, जो जीवित बैक्टीरिया है कि या तो बढ़ने या विभाजित नहीं कर रहे है स्विच कर सकते हैं । इस कारण से, थाली गिनती व्यवहार्य कोशिका प्रवाह cytometry के साथ प्राप्त गिनती से अलग है । उदाहरण के लिए, चित्रा 3में, श्लैष्मिक अंतरफलक से बरामद व्यवहार्य कोशिकाओं के प्रवाह cytometry भूखंड में नीले रंग में हैं । हालांकि, कोई वृद्धि नहीं मनाया गया जब इन बलगम नमूने चढ़ाया गया (परिणाम नहीं दिखाया गया) ।

भिंन है जिस पर बैक्टीरिया उच्च व्यवहार्यता दर दिखाने सेलुलर मलबे (S7), के रूप में थाली गिनती (चित्रा 4) से पता चला है । कालोनियों की संख्या चर सकता है, लेकिन चयापचय सक्रिय बैक्टीरिया की उपस्थिति कम पतला नमूनों में पाया जाता है ।

Figure 1
चित्रा 1: इन विट्रो जठरांत्र पाचन की शुरुआत में multispecies माइक्रोबियल समुदाय रचना बैक्टीरिया की कोशिका व्यवहार्यता । (क) व्यवहार्य कोशिका गणना (लॉग इकाइयों) quantified द्वारा लाइव/मौत धुंधला और प्रवाह cytometry (औसत ± मानक विचलन, n = 3) । (ख) सह संस्कृति के ४८ ज के बाद multispecies माइक्रोबियल समुदाय के प्रतिनिधि प्रवाह cytometry भूखंड । हरे, लाल, और काले में डॉट्स क्रमशः व्यवहार्य, क्षतिग्रस्त और पृष्ठभूमि या गैर वर्गीकृत बैक्टीरिया का प्रतिनिधित्व करते हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: नकली जठरांत्र पाचन के बाद बैक्टीरिया की कोशिका व्यवहार्यता । सलाखों के व्यवहार्य कोशिकाओं की संख्या का प्रतिनिधित्व (लॉग इन इकाइयों) के बाद मौखिक, गैस्ट्रिक, और छोटे आंत्र पाचन कदम (औसत ± मानक विचलन, n = 3) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3: श्लैष्मिक चरण में व्यवहार्य बैक्टीरियल कोशिकाओं के प्रतिनिधि साजिश । लाल डॉट्स पृष्ठभूमि और नीले डॉट्स व्यवहार्य कोशिकाओं का प्रतिनिधित्व करते हैं । फ्लो cytometry शर्तों सहारा एट अल के आधार पर स्थापित किया गया । (२०१६) 19. श्लैष्मिक नमूनों 1:100 (v/v) पतला और 15 मिनट के लिए Sybr ग्रीन/Propidium आयोडाइड के साथ सना हुआ था, और १०० µ एल के नमूने FL1:533/30 एनएम, FL2:585/40 एनएम, FL3: > 670 एनएम लांग पास, और FL4:675/25 एनएम मापा गया था । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: कॉलोनी बनाने इकाइयों (CFU) संशोधित BHI प्लेटों में सेलुलर मलबे से उगाया । तीन जैविक प्रतिकृति बैक्टीरियल आसंजन परख और तीन तकनीकी दोहराने के लिए इस्तेमाल किया गया CFU ठहराव के लिए प्रदर्शन किया गया । दो की प्रतिकृति प्लेट युक्त-सेल मलबे (S7) के 1 से-6 कमजोर पड़ने आंकड़ा में दिखाया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

सेल संस्कृति अनुयाई/निलंबन संवर्धन माध्यम सामांय खुराक विशिष्ट खुराक दोहरीकरण का समय गर्मी की स्थिति
कएको छैन-2 (ECACC ८६०१०२०२) अनुयाई Dulbecco के संशोधित ईगल मीडियम (DMEM) के साथ ४.५ g/L ग्लूकोज निष्क्रिय भ्रूण गोजातीय सीरम (10% v/
पेनिसिलिन (१०० यू/एमएल) *
Streptomycin (०.१ मिलीग्राम/एमएल) *
Amphotericin (०.००२५ मिलीग्राम/एमएल) *
Glutamax (4 मिमी)
गैर आवश्यक aminoacids (1% v/
पाइरूवेट (1 मिमी)
६५ – ७२ ज ९५% आर्द्रता और 10% सह2
सह2 मशीन ( सामग्री की तालिकादेखें)
HT29-MTX (ECACC १२०४०४०१) अनुयाई HEPES (1 मिमी) २० – २४ ज
* एंटीबायोटिक्स और रोधी दवाओं को सेल कल्चर मीडिया से 2 दिन पहले ही परख कर शुरू कर दिया गया ।

तालिका 1: सेल संस्कृति रखरखाव के लिए कक्ष रेखाओं और मीडिया संरचना का विवरण ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

ओरल microbiome मानव स्वास्थ्य में एक महत्वपूर्ण तत्व के रूप में हाल ही में कई लेखकों द्वारा रिपोर्ट20,21। पिछले निष्कर्षों का सुझाव है कि बैक्टीरिया की बड़ी भार युक्त लार की घूस छोटी आंत के माइक्रोबियल पारिस्थितिकी तंत्र को प्रभावित कर सकते हैं, जो प्रतिरक्षा भड़काना के लिए मुख्य साइटों में से एक है । मेजबान इंटरफेस के साथ एक स्थिर ऊपरी जठरांत्र पाचन मॉडल के संयोजन आंत्र उपकला और बलगम स्रावित कोशिकाओं द्वारा प्रतिनिधित्व, मेजबान पर माइक्रोबियल घटक के प्रभाव को जानने के लिए कार्य किया.

इन विट्रो मॉडल अनुसंधान के लिए बुनियादी उपकरणों रहे हैं, यंत्रवत अध्ययन के संचालन के लिए अनुमति देता है और पृष्ठभूमि ज्ञान को कम करने के उद्देश्य को प्राप्त करने, अधिक कुशल बनाने, और vivo अध्ययन में बेहतर लक्ष्य । इस कारण से, यह शुद्धता, व्यवहार्यता सुनिश्चित करने के लिए महत्वपूर्ण है, और axenic संस्कृतियों के इष्टतम विकास सिंथेटिक माइक्रोबियल समुदाय की स्थापना से पहले । हम सेल संस्कृतियों के लिए जोखिम से पहले बैक्टीरियल समुदायों की व्यवहार्यता और संरचना का मूल्यांकन करने की सलाह देते हैं, विश्लेषण में पूर्वाग्रह से बचने के लिए । क्षतिग्रस्त बैक्टीरिया की उच्च संख्या आसंजन में बाधा और आगे सेल मॉडल की अखंडता को प्रभावित कर सकते हैं । इसके अलावा, सेल लाइनों के एक विश्वसनीय स्रोत का उपयोग सेल लाइन की पहचान, संदूषण को कम करने, और गरीब एनोटेशन, प्रयोगात्मक reproducibility22बढ़ाने होगा ।

बलगम उत्पादन कोशिकाओं सहित छोटी आंत को समानता में सक्षम बनाता है, बलगम के रूप में और mucins जठरांत्र संबंधी मार्ग के पहले रक्षा लाइन प्रदान23. इसके अलावा, श्लैष्मिक परत बैक्टीरियल colonisation के लिए उपयुक्त है, बैक्टीरियल चयापचयों के characterising द्विपक्षीय परिवहन के लिए अनुमति देता है । इसके अलावा, नकली जठरांत्र शर्तों कएको छैन-2 और mucin24के लिए लैक्टोबैसिलस paracasei उपभेदों के आसंजन की क्षमता में वृद्धि, हमारे मॉडल में पाचन प्रक्रियाओं को शामिल करने की प्रासंगिकता का समर्थन ।

मॉडल में और सुधार प्रतिरक्षा मेजबान घटक शामिल करने के लिए शुरू किया जा सकता है, के रूप में पहले25की समीक्षा की । हालांकि, वर्तमान सह-संस्कृति उपकला और प्रतिरक्षा कोशिकाओं के सिस्टम होस्ट-सूक्ष्म जीव बातचीत अनुप्रयोगों के लिए इस्तेमाल नहीं किया गया है (जैसे, खाद्य के मूल्यांकन के लिए सक्रिय यौगिकों या प्रोबायोटिक्स), जो संकेत हो सकता है कि उन प्रणालियों की कमी हो सकती है reproducibility25.

कएको छैन के साथ पिछले अनुसंधान-2, HT29-MTX या सह संस्कृतियों स्तनधारी कोशिकाओं के लिए प्रोबायोटिक या रोगजनक उपभेदों के आसंजन का मूल्यांकन26,27। एकल दाग या कुछ सूक्ष्मजीवों के संघों का उपयोग मेजबान-सूक्ष्म जीव बातचीत पर एक सीमित सिंहावलोकन प्रदान कर सकते हैं, और यह मानव जठरांत्र संबंधी मार्ग की जटिलता का प्रतिनिधि नहीं है । हालांकि प्राकृतिक माइक्रोबियल समुदायों का उपयोग vivo परिदृश्य में अधिक प्रतिनिधि हो सकता है, वे characterise और अध्ययन करने के लिए मुश्किल हैं । इसके विपरीत, हमारी कार्यप्रणाली एक जटिल और प्रतिनिधि सूक्ष्म जगत का उपयोग करते हुए, अनेक मेज़बान-सूक्ष्म जीव इंटरैक्शन का आकलन करने का अवसर प्रदान करती है. एक परिभाषित सिंथेटिक माइक्रोबियल समुदाय का उपयोग कम जटिलता28के साथ एक प्रणाली की पीढ़ी के लिए अनुमति देता है । समुदाय में परिवर्तन व्यक्तिगत प्रयोगों के सन्दर्भ में microenvironmental स्थितियों का परिणाम हो सकता है । इस प्रकार, इस मॉडल के माइक्रोबियल घटक आसानी से ऊपर या नीचे एक चयनात्मक बल के रूप में पर्यावरण के प्रभाव के निर्माण के लिए बढ़ाया जा सकता है । अंत में, नमूना पहुंच की गारंटी देता है और दोनों मानव कोशिकाओं और जुड़े माइक्रोबियल समुदाय के कार्यात्मक गतिविधियों के आगे वर्णन ।

पिछले वर्षों में, organoid तकनीक पर आधारित इन विट्रो मॉडलों में नई विकसित की गई है । Organoids 3 डी सेल संस्कृतियों है कि प्रतिनिधित्व प्राथमिक ऊतक की प्रमुख विशेषताओं में से कुछ को शामिल कर रहे हैं । हालांकि आंत्र organoids वयस्क स्टेम कोशिकाओं और ऊतकों के अध्ययन के लिए एक के पास शारीरिक प्रणाली हैं, इस तरह के मॉडल भी कुछ सीमाएं हैं । आंत्र organoids संक्रमण या दवाओं के लिए भड़काऊ प्रतिक्रियाओं जैसी में सीमित उपयोग किया है, के रूप में वे प्रतिरक्षा कोशिकाओं की कमी है । इसके अतिरिक्त, organoids व्यवहार्यता, आकार, और आकार के बारे में विषम हैं, phenotype स्क्रीनिंग और प्रतिपादन मानकीकरण परिसर में बाधा । इन विट्रो में के लिए अमर सेल लाइनों की सीमा के बावजूद स्वस्थ ऊतकों के मॉडलिंग, अच्छी तरह से विशेषता और स्थिर सेल लाइनों का उपयोग भी दोहराव, reproducibility, और कम लागत के रूप में लाभ प्रदान करता है । ये लाभ कई शर्तों के एक साथ स्क्रीनिंग के लिए अनुमति देते हैं, लेकिन डेटा के अनुवाद का उपयोग विवादास्पद है । प्राथमिक कोशिकाओं vivo फिजियोलॉजी में अधिक प्रतिनिधि हो सकता है; हालांकि, वे उच्च अंतर व्यक्तिगत परिवर्तनशीलता है, पूरी तरह से लक्षण नहीं हैं, विषम हैं, और एक सीमित समय अवधि है । इन कारकों में कई शर्तों या एक परख में प्रतिकृतियां सहित के लिए एक खामी है ।

जटिल माइक्रोबियल समुदायों के साथ सेल लाइनों के संयोजन के रूप में एक चुनौती का प्रतिनिधित्व कर सकते हैं, हम उच्च लचीलापन और बुनियादी सेल उपकरण के साथ प्रयोगशालाओं में प्रयोज्यता के साथ एक reproducible और दोहराने मॉडल विकसित करने पर ध्यान केंद्रित, जब तक अधिक प्रतिनिधि मॉडल उपलब्ध है और अच्छी तरह से विशेषता बन गया । हम विविध जीवाणु इन multicompartment मॉडल का उपयोग कर समुदायों की कार्यक्षमता का मूल्यांकन किया है, उदाहरण के लिए, ऊपरी जठरांत्र संबंधी मार्ग में प्रोबायोटिक व्यवहार के मूल्यांकन के लिए और आंत अंतरफलक पर characterising xenobiotic प्रभाव के लिए । इस प्रकार, हम प्रोबायोटिक्स, दवाओं, या खाद्य यौगिकों की एक विस्तृत विविधता के साथ आगे की परख के लिए एक आधार के रूप में इस मॉडल का प्रस्ताव है, एक प्रासंगिक और इन विट्रो पारिस्थितिकी तंत्र में परिभाषित के भीतर ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है

Acknowledgments

लेखक आभार Flanders रिसर्च फाउंडेशन से मार्ता Calatayud अर्रोयो (FWO postdoctoral फैलोशिप-12N2815N) के लिए वित्तीय सहायता स्वीकार करते हैं । एम्मा Hernandez-Sanabria Flanders इनोवेशन और उद्यमिता (Agentschap voor Innovatie डोर Wetenschap en technologie पर, आईडब् ल् यूटी) द्वारा समर्थित एक postdoctoral फेलो है ।

Materials

Name Company Catalog Number Comments
STRAINS
Aggregatibacter actinomycetemcomitans American Type Culture Collection ATCC 43718
Fusobacterium nucleatum American Type Culture Collection ATCC 10953
Porphyromonas gingivalis American Type Culture Collection ATCC 33277
Prevotella intermedia American Type Culture Collection ATCC 25611
Streptococcus mutans American Type Culture Collection ATCC 25175
Streptococcus sobrinus American Type Culture Collection ATCC 33478
Actinomyces viscosus American Type Culture Collection ATCC 15987
Streptococcus salivarius  TOVE-R
Streptococcus mitis American Type Culture Collection ATCC 49456
Streptococcus sanguinis BCCM/LMG Bacteria Collection LMG 14657
Veillonella parvula Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures DSM 2007
Streptococcus gordonii American Type Culture Collection ATCC 49818
CELL LINES
Caco-2 cells European Collection of Authenticated Cell Cultures 86010202
HT29-MTX cells European Collection of Authenticated Cell Cultures 12040401
REAGENTS AND CONSUMABLES
Brain Heart Infusion (BHI) broth Oxoid CM1135
Blood Agar 2 Oxoid CM0055 Blood Agar medium
Menadione Sigma M9429
Hemin Sigma H9039
5% sterile defibrinated horse blood E&O Laboratories Ltd, P030
InnuPREP PCRpure Kit Analytik Jena 845-KS-5010250 PCR purification kit
Big Dye Applied Biosystems 4337454 Dye for sequencing
ABI Prism BigDye Terminator v3.1 cycle sequencing kit Applied Biosystems 4337456
SYBR Green I Invitrogen S7585
Propidium Iodide Invitrogen P1304MP
T25 culture flasks uncoated, cell-culture treated, vented, sterile VWR 734-2311
Trypsin-EDTA solution Sigma-Aldrich T3924-100ML
Trypan Blue solution
0.4%, liquid, sterile-filtered
Sigma-Aldrich T8154 
PBS Gibco 14190250
DMEM cell culture media, with GlutaMAX and Pyruvate Life technologies 31966-047
Corning Transwell polyester membrane cell culture inserts Sigma-Aldrich CLS3450-24EA
Mucin from porcine stomach Type II   Sigma-Aldrich M2378
Inactivated fetal bovine serum Greiner Bio One 758093
Antibiotic-Antimycotic (100X) Gibco 15240062
Triton X 100 for molecular biology Sigma-Aldrich T8787 
DPBS without calcium, magnesium Gibco 14190-250
Pierce LDH Cytotoxicity Assay Kit Thermo Fisher Scientific 88953
Corning HTS Transwell-24 well, pore size 0.4 µm Corning Costar Corp 3450
Nuclease-free water Serva Electrophoresis 28539010
EQUIPMENT
Neubauer counting chamber improved Carl Roth T729.1
BD Accuri C6 Flow cytometer BD Biosciences 653118
PowerLyzer 24 Homogenizer MoBio 13155
T100 Thermal Cycler BioRad 186-1096
Flush system Custom made -
InnOva 4080 Incubator Shaker New Brunswick Scientific 8261-30-1007 Shaker for 2.10
Memmert CO2 incubator Memmert GmbH & Co. ICO150med
Millicell ERS (Electrical Resistance System) EMD Millipore, Merck KGaA MERS00002
Millipore Milli-Q academic, ultra pure water system Millipore, Merck KGaA -
Shaker (ROCKER 3D basic) IKA 4000000 Shaker for 6.10

DOWNLOAD MATERIALS LIST

References

  1. Sender, R., Fuchs, S., Milo, R. Revised estimates for the number of human and bacteria cells in the body. PLoS Biology. 14, e1002533 (2016).
  2. Kelly, D., King, T., Aminov, R. Importance of microbial colonization of the gut in early life to the development of immunity. Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis. 58-69 (2007).
  3. Aas, J. A., Paster, B. J., Stokes, L. N., Olsen, I., Dewhirst, F. E. Defining the normal bacterial flora of the oral cavity. Journal of Clinical Microbiology. 43, 5721-5732 (2005).
  4. Marsh, P. D., Head, D. A., Devine, D. A. Dental plaque as a biofilm and a microbial community-Implications for treatment. Journal of Oral Biosciences. 57, 185-191 (2015).
  5. Socransky, S. S., Haffajee, A. D., Cugini, M. A., Smith, C., Kent, R. L. Microbial complexes in subgingival plaque. Journal of Clinical Periodontology. 25, 134-144 (1998).
  6. Haffajee, A. D., et al. Subgingival microbiota in healthy, well-maintained elder and periodontitis subjects. Journal of Clinical Periodontology. 25, 346-353 (1998).
  7. Venema, K. Microbial metabolites produced by the colonic microbiota as drivers for immunomodulation in the host. The FASEB Journal. 27, (2013).
  8. Marzorati, M., et al. The HMI (TM) module: A new tool to study the Host-Microbiota Interaction in the human gastrointestinal tract in vitro. BMC Microbiology. 14, 133 (2014).
  9. Tanzer, J. M., Kurasz, A. B., Clive, J. Competitive displacement of mutans streptococci and inhibition of tooth-decay by Streptococcus-Salivarius Tove-R. Infection and Immunity. 48, 44-50 (1985).
  10. Slomka, V., et al. Nutritional stimulation of commensal oral bacteria suppresses pathogens: the prebiotic concept. Journal of Clinical Periodontology. 44, 344-352 (2017).
  11. Hernandez-Sanabria, E., et al. In vitro increased respiratory activity of selected oral bacteria may explain competitive and collaborative interactions in the oral microbiome. Frontiers in Cellular and Infection Microbiology. 7, 235 (2017).
  12. Alvarez, G., Gonzalez, M., Isabal, S., Blanc, V., Leon, R. Method to quantify live and dead cells in multi-species oral biofilm by real-time PCR with propidium monoazide. AMB Express. 3, (2013).
  13. Ehsani, E., et al. Initial evenness determines diversity and cell density dynamics in synthetic microbial ecosystems. Scientific Reports. 8, 340 (2018).
  14. Hernandez-Sanabria, E., et al. Correlation of particular bacterial PCR-denaturing gradient gel electrophoresis patterns with bovine ruminal fermentation parameters and feed efficiency traits. Applied and Environmental Microbiology. 76, 6338-6350 (2010).
  15. Masters, J. R., Stacey, G. N. Changing medium and passaging cell lines. Nature Protocols. 2, 2276-2284 (2007).
  16. Calatayud, M., Velez, D., Devesa, V. Metabolism of inorganic arsenic in intestinal epithelial cell lines. Chemical Research in Toxicology. 25, 2402-2411 (2012).
  17. Minekus, M., et al. A standardised static in vitro digestion method suitable for food - an international consensus. Food & Function. 5, 1113-1124 (2014).
  18. Berney, M., Hammes, F., Bosshard, F., Weilenmann, H. U., Egli, T. Assessment and interpretation of bacterial viability by using the LIVE/DEAD BacLight kit in combination with flow cytometry. Applied and Environmental Microbiology. 73, 3283-3290 (2007).
  19. Props, R., Monsieurs, P., Mysara, M., Clement, L., Boon, N. Measuring the biodiversity of microbial communities by flow cytometry. Methods in Ecology and Evolution. 7, 1376-1385 (2016).
  20. Yamashita, Y., Takeshita, T. The oral microbiome and human health. Journal of Oral Science. 59, 201-206 (2017).
  21. Wade, W. G. The oral microbiome in health and disease. Pharmacological Research. 69, 137-143 (2013).
  22. Yu, M., et al. A resource for cell line authentication, annotation and quality control. Nature. 520, 307 (2015).
  23. Pelaseyed, T., et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunological Reviews. 260, 8-20 (2014).
  24. Bengoa, A. A., et al. Simulated gastrointestinal conditions increase adhesion ability of Lactobacillus paracasei strains isolated from kefir to Caco-2 cells and mucin. Food Research International. 103, 462-467 (2018).
  25. Kleiveland, C. R., et al. The Impact of Food Bioactives on Health: in vitro and ex vivo models. Verhoeckx, K., et al. Springer International Publishing. 197-205 (2015).
  26. Laparra, J. M., Sanz, Y. Comparison of in vitro models to study bacterial adhesion to the intestinal epithelium. Letters in Applied Microbiology. 49, 695-701 (2009).
  27. Gagnon, M., Berner, A. Z., Chervet, N., Chassard, C., Lacroix, C. Comparison of the Caco-2, HT-29 and the mucus-secreting HT29-MTX intestinal cell models to investigate Salmonella adhesion and invasion. Journal of Microbiological Methods. 94, 274-279 (2013).
  28. Großkopf, T., Soyer, O. S. Synthetic microbial communities. Current Opinion in Microbiology. 18, 72-77 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics