Avaliação da viabilidade de um consórcio bacteriano sintético na Interface Host-micróbio em Vitro Gut

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Interações do anfitrião-micróbio de intestino foram avaliadas usando uma nova abordagem que combina uma comunidade oral sintética, em vitro digestão gastrointestinal e um modelo do epitélio do intestino delgado. Apresentamos um método que pode ser adaptado para avaliar a invasão celular dos micróbios patogénicos e biofilmes de várias espécies, ou mesmo para testar a capacidade de sobrevivência dos probióticos formulações.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Calatayud Arroyo, M., Van de Wiele, T., Hernandez-Sanabria, E. Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface. J. Vis. Exp. (137), e57699, doi:10.3791/57699 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A interação entre o host e microbiota tem sido reconhecida por muito tempo e extensivamente descrita. A boca é semelhante a outras seções do tracto gastrointestinal, como microbiota residente ocorre e evita a colonização por bactérias exógenas. Com efeito, mais de 600 espécies de bactérias são encontradas na cavidade oral, e um único indivíduo pode transportar cerca de 100 diferentes a qualquer momento. Bactérias orais possuem a capacidade de aderir aos diversos nichos do ecossistema oral, assim, tornando-se integrados dentro dos residentes das comunidades microbianas e favorecem crescimento e sobrevivência. No entanto, o fluxo de bactérias no intestino durante a deglutição tem sido proposto para perturbar o equilíbrio da microbiota do intestino. Na verdade, a administração oral de p. gingivalis mudou a composição bacteriana na microflora ileal. Éramos uma comunidade sintética como uma representação simplificada do ecossistema natural oral, para elucidar a sobrevivência e viabilidade de bactérias orais, sujeitado a condições de trânsito gastrointestinal simulado. Catorze espécies foram selecionados, submetidos a em vitro salivar, gástrica e processos de digestão intestinal e apresentou um modelo de célula multicompartment contendo células Caco-2 e HT29-MTX para simular o epitélio da mucosa do intestino. Este modelo serviu para desvendar o impacto das bactérias engolidos em células envolvidas na circulação entero-hepática. Usar comunidades sintéticas permite a controlabilidade e reprodutibilidade. Assim, esta metodologia pode ser adaptada para avaliar a viabilidade do agente patogénico e inflamação associada as alterações subsequentes, capacidade de colonização de probiótico misturas, e em última análise, bacteriana potencial impacto sobre a circulação pré-sistêmico.

Introduction

Os seres humanos convivem com as bactérias, que estão presentes no mesmo número de células humanas1. Portanto, é de crucial importante obter uma compreensão abrangente da microbiome humano. A cavidade oral é um ambiente único, em que é dividido em vários habitats menores, assim, que contém uma grande variedade de bactérias e biofilmes nesses locais diferentes. Um ecossistema aberto, algumas espécies na boca podem ser transitórios visitantes. No entanto, certos microorganismos colonizam logo após o nascimento e a forma organizaram de biofilmes2. Estes são encontrados na superfície de dentes acima a fenda gengival, o bico subgengival, língua, mucosas e próteses dentárias e recheios3. Bactérias podem também estar presentes como flocos e células planctônicas no lúmen do canal do dente, ou misturado com o tecido pulpar necrótico ou suspensas em uma fluido fase.

Não há ativo, contínuo-conversas cruzadas entre células hospedeiras e a microbiota residente4. Bactérias se comunicar dentro e entre espécies, e apenas uma pequena proporção dos colonizadores naturais pode aderir aos tecidos, enquanto outras bactérias anexar a estes colonizadores primários. Por exemplo, ligação de celular entre microorganismos é chave para a integração de colonizadores secundários em biofilmes orais e construção de redes complexas de interação de células microbianas4. Cerca de 70% dos agregados de bactérias em uma amostra de saliva são formadas por Porphyromonas SP., Streptococcus SP., Prevotella SP., Veillonella SP. e não identificado Bacteroidetes. F. nucleatum é um colonizador intermediário no biofilme subgengival e agregados com os colonizadores tarde p. gingivalis, T. denticola e Tannerella forsythia, que estão implicados na periodontite5. Além disso, Streptococcus mitis ocupa habitats da mucosa e dentais, enquanto S. sanguinis e S. gordonii preferem colonizam dentes3. Assim, S. sanguinis está presente em menor incisivos e caninos, enquanto Actinomyces naeslundii foi encontrado em VITAPAN superior6.

Além disso, o indígena microbiome desempenha um papel na manutenção da saúde humana2. Microbiota residente participa educação imune e na prevenção da expansão do patógeno. Esta resistência de colonização ocorre porque as bactérias nativas podem estar melhor adaptado ao anexar às superfícies e mais eficiente em metabolizar os nutrientes disponíveis para o crescimento. Embora cepas probióticas sobrevivem a passagem gastrointestinal e permanecem ativas, a persistência de bactérias autóctones engolida de uma posição superior do trato gastrintestinal não foi totalmente descrita. Assim, estamos sujeitos a uma comunidade artificial, representante do ecossistema oral, às condições de trânsito gastrointestinal simulado. Viabilidade das células bacterianas foi avaliada usando um modelo multicompartment parecido com o epitélio do intestino. Simuladores de intestino atual oferecem reprodutibilidade adequada em termos de análise da comunidade microbiana luminal7. No entanto, adesão bacteriana e interação do anfitrião-micróbio separadamente destinam-se, como combinar linhas celulares com comunidades microbianas é um desafio8. Em contrapartida, apresentamos um quadro que apresenta potencial explicação mecanicista de colonização bem sucedidos eventos relatados na interface do intestino. Com efeito, este modelo pode ser usado em conjunto com um modelo de intestino estático para avaliar o impacto das comunidades microbianas na sinalização superfície do hospedeiro.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. cepas e as condições de cultura

Nota: A Comunidade oral sintética foi composta por cepas comumente presentes no microbiome oral3.

  1. Obter as seguintes estirpes de coleção de cultura do tipo americano (ATCC): Aggregatibacter actinomycetemcomitans (ATCC 43718), Fusobacterium nucleatum (ATCC 10953), Porphyromonas gingivalis (ATCC 33277), Prevotella intermedia (ATCC 25611), Streptococcus mutans (ATCC 25175), Streptococcus sobrinus (ATCC 33478), Actinomyces naeslundii (ATCC 51655), Streptococcus gordonii (ATCC 49818), Actinomyces viscosus (ATCC 15987) e Streptococcus mitis (ATCC 49456).
  2. Veillonella parvula do Leibniz Institute DSMZ-alemão coleção de microorganismos e culturas de células (DSM 2007), Streptococcus sanguinis , da coleção de bactérias BCCM/LMG (LMG 14657) de adquirir e usar Streptococcus salivarius estirpe TOVE-R9e Streptococcus oral10.

2. desenvolvimento de um representante da Comunidade terminousua da Microbiome Oral

Nota: Gere uma comunidade sintética para simular a potencial capacidade de aderência de bactérias orais para o epitélio do intestino em vitro . Crescer bactérias em placas de ágar sangue suplementadas com 5 hemina μg/mL, 1 menadiona μg/mL e o sangue de cavalo desfibrinado estéril de 5%, conforme descrito em Hernandez-Sanabria et al (2017) 11. em breve:

  1. Dissolver 100 mg de hemina em 2 mL de 1 M de NaOH, adicionar 100 mL de água destilada esterilizada. Guarde em um recipiente escuro. Esterilize através de um filtro de 0,22 µm antes de adicionar ao meio.
  2. Dissolva 100 mg de menadiona em 20 mL de etanol a 96%. Esterilize através de um filtro de 0,22 µm antes de adicionar ao meio.
  3. Preparar 1 L de ágar-ágar sangue (ver a Tabela de materiais) de acordo com as instruções do fabricante e autoclave. Deixe arrefecer antes de adicionar o sangue de cavalo e os suplementos. Misture e despeje as placas.
  4. Prepare a infusão de coração de cérebro modificado (BHI) caldo como relatado anteriormente,12. Adicione 5 μg/mL de hemina e 1 μg/mL de menadiona após esterilização em autoclave.
  5. Dispense o 9 mL do meio em tubos de Hungate e feche com uma rolha de borracha e uma tampa de alumínio. Lave os tubos com N2/CO2 (90% / 10%).
  6. Recuperar a 1 mL de meio anaeróbico com uma seringa e coloque-o em um tubo de microcentrifugadora de 1,5 mL. Escolhe a única colônias de cada espécie bacteriana, Ressuspender a médio e transferência de volta para o BHI modificado anaeróbica. Incube durante 48 h a 37 ° C, com exceção de S. salivarius, que devem ser incubadas durante 24 h.
  7. Se necessário, confirme a pureza das culturas antes da montagem da Comunidade sintética. Em breve:
    1. Extrair o DNA das culturas líquidas como Hernandez-Sanabria et al (2010) 13 e amplificar o gene 16S rRNA, usando as primeiras demão 27F (AGAGTTTGATYMTGGCTCAG) e 1492R (TACGGYTACCTTGTTACGACT) e o programa a seguir: 5 minutos a 95 ° C, 30 ciclos de 95 ° C por 1 min, 55 ° C por 1 min e 72 ° C por 1,5 min, seguido por uma etapa de extensão final de 5 min a 72 ° C.
    2. Purificar o produto PCR com um comercial kit (veja a Tabela de materiais), seguindo as instruções do fabricante.
    3. Realizar a reação de sequenciamento dos produtos purificados em um volume total de 10 μL contendo 0,5 μL de tintura (ver Tabela de materiais), 3.2 pmol de M13f primer (CGCCAGGGTTTTCCCAGTCACGAC), 2,0 μL de 5x buffer de sequenciamento e 20 ng do modelo, usando um sistema de sequenciamento comercial com kit (veja a Tabela de materiais).
      Nota: Tivemos este procedimento realizado comercialmente.
    4. Executar uma pesquisa de explosão em todas as sequências (http://blast.ncbi.nlm.nih.gov/Blast.cgi) para determinar o taxon conhecido mais próximo e comparar com a sequência da estirpe original usando a ferramenta on-line de RDP classificador (http://rdp.cme.msu.edu/) e a SINA Serviço de alinhamento (https://www.arb-silva.de/aligner/).
  8. Medir o número de células no final da incubação, usando citometria de fluxo e mancha de SYBR Green/Propidium iodeto como descrito em Hernandez-Sanabria et al (2017) 11. diluir as culturas para 105 células mL-1, usando modificado BHI.
  9. Adicionar 1 mL de S. mitis em 75 mL de BHI anaeróbica e incubar até fase estacionária (6 h). A seguir, recolha 0,75 mL de cada estirpe diluído e misturar em condições anaeróbias.
  10. Uma vez que todas as culturas foram misturadas, tomar 1 mL do microcosmo e adicionar a 75 mL de BHI. Incubar a Comunidade sintética abaixo dos 10% CO2, 10% H2, 80% N2 por 48 h a 37 ° C e 200 rpm (ver Tabela de materiais).
  11. Medir a densidade de células como no 2.8. antes de apresentar a Comunidade para o modelo de célula. Composição da Comunidade pode ser avaliada com PCR quantitativo em tempo real, usando as primeiras demão e recozimento temperaturas no quadro 1 do Slomka et al (2017) 10. Além disso, usar o sequenciamento de amplicons do 16S rRNA gene para fornecer informações sobre os membros iniciais presentes13,14. Para qualquer protocolo de confirmação de identidade, use cDNA como um modelo para indicar as bactérias ativamente transcrevendo as proteínas e usar o DNA como um modelo para revelar a presença ou ausência das cepas.

3. práticas de cultura de pilha geral

Nota: Para aspectos gerais da cultura de pilha, os autores referem-se ao mestre e Stacey (2007)15. Obter linha de celular usada a partir da coleção de autenticado célula culturas europeias (Caco-2 ECACC 86010202 e 12040401 de ECACC HT29-MTX-E12, saúde pública, Inglaterra, Reino Unido). Reagentes para cultura de células podem ser comprados (consulte Tabela de materiais), a menos que especificado de outra forma.

  1. Manutenção e passagem de linhas de células Caco-2 e HT29-MTX
    Nota: Células Caco-2 e HT29-MTX rotineiramente são cultivadas em frascos de cultura de tecidos de2 25 cm contendo complementado meio DMEM (tabela 1). As células são trypsinized quando é alcançada a confluência de 60-70%.
    1. Retire os frascos, o meio de cultura celular. Lave duas vezes com 5 mL de PBS sem Ca ++/. mg ++.
    2. Adicione 2 mL de uma solução de 0,5 mg/L de tripsina e 0,22 g/L ácido etilenodiaminotetracético (EDTA). Distribua a solução de tripsina movendo suavemente o frasco. Retire 1,5 mL da solução de tripsina e incubar o frasco a 37 ° C por 10 min.
    3. Verifique sob o microscópio se células são desanexadas da superfície do balão. Incube durante 5min adicional, se necessário.
    4. Adicione 5 mL de meios de cultura celular complementado no balão para inactivar a tripsina. Pipetar acima e para baixo para obter uma suspensão homogênea única célula.
    5. Imediatamente, pegue um 50 µ l alíquota da suspensão celular e misturar com a solução de azul de Tripan 0,4% estéril em uma proporção de 1:1 (v/v) para as células Caco-2 ou 1:5 v/v para HT29-MTX. Mix por pipetagem e carga em uma câmara de contagem (ver Tabela de materiais).
    6. Contar as células viáveis (células brancas brilhantes) sob o microscópio (consulte as instruções do fabricante).
    7. As sementes em um balão de novo em uma densidade de 4 x 105 células/cm2 e 1 x 104 células/cm2, Caco-2 e HT29-MTX, respectivamente.
      Nota: células Caco-2 (1) diferenciam e formam junções apertadas uma vez atingindo a confluência. É extremamente importante evitar sobreconfluência antes tripsinização. Crescimento excessivo de células em balão pode causar falha no destacamento de célula após grupos tripsinização e/ou células. (2) HT29-MTX células são produtoras de muco células com alta atividade metabólica16. Esses recursos podem causar uma rápida acidificação dos meios de cultura de células, especialmente se as células estão em alta densidade. Tampão HEPES pode ser adicionado ao meio de cultura celular (tabela 1) para manter o pH entre 7 e 7,2. Se o pH cai, a mídia pode ser trocado quando Confluencia é inferior a 50%. No entanto, se a confluencia > 50%, a cultura de pilha deve ser dividida.

4. montagem de um modelo de célula electrolyzer simulando a Interface de Host-micróbio do intestino

Nota: Complete a co-cultura em dobro poços de câmara (diâmetro 24mm, poros tamanho 0,4 μm; ver Tabela de materiais).

  1. Adicione 1,5 mL de meio de cultura de célula completa para o compartimento apical e 2 mL para o basal. Pre-incube durante 20 a 30 min obter uma distribuição uniforme da suspensão celular quando a semeadura.
  2. Trypsinize a cultura de células Caco-2 e HT29-MTX conforme descrito na seção 3. O procedimento tripsinização com precisão é imprescindível para alcançar uma distribuição homogénea de ambas as linhas de celular, em suspensão uma única célula, sem grumos.
  3. Conte as células viáveis, conforme descrito em 3.1.8.
  4. Ajuste a densidade da célula para 6,5 x 104 células/cm2 numa proporção de 90/10 de células Caco-2/HT29-MTX.
  5. Homogeneizar as suspensões celulares e adicionar o volume correspondente de células Caco-2 e HT29-MTX pré-cheia recipiente estéril com meio de cultura celular completados. Remova a mídia pré-incubado do lado apical da câmara por aspiração.
  6. Delicadamente misture a suspensão de células pipetando e transferir 1,5 mL para o compartimento apical de inserções da câmara. O procedimento de semeadura exige uma constante homogeneização da suspensão de células, como células tendem a sedimentar. Dependendo da experiência do usuário e velocidade de trabalho, suspensão de células deve ser misturado depois da preparação de 1 – 3 poços.
  7. Mover placas suavemente para trás e para frente e depois à direita para a esquerda para a direita (5 – 10 vezes) para obter um mesmo propagação de células no poço. Transferir para a incubadora e repita o movimento das placas.
  8. Manter a co-cultura de células Caco-2/HT29-MTX por 15 dias, refrescante compartimentos apicais e basais a cada 2 dias com DMEM completada. Após este tempo, os meios de cultura de células pode ser alterado para completada DMEM sem solução antibiótico/antimicótico.
  9. Manter o sistema até 20 – 21 dias após semeadura, renovando o meio a cada 2 dias.
  10. Medir a integridade da barreira epitelial antes de iniciar o ensaio, usando um sistema de resistência elétrica (ver tabela de materiais), seguindo as instruções do fabricante.
    1. Certifique-se de que o equipamento de TEER está totalmente carregado (> 24 h) antes de iniciar as medições.
    2. Desconecte o equipamento TEER a alimentação e a cobertura com um saco de plástico de autoclave. Faça um buraco no saco para introduzir o eletrodo e conecte a porta de entrada do medidor. Spray com 70% de etanol/água (v/v), antes de introduzir o equipamento de TEER dentro do gabinete de fluxo.
    3. Para desinfectar o eletrodo, mergulhe as pontas de eletrodo em solução de etanol/água (v/v) de 70% por 15 min. permitir ao ar seco durante 15 s. enxaguar o eletrodo em meios de cultura de células previamente aquecido.
    4. Levar as células fora da incubadora e permitir que as células para a temperatura dentro do fluxo do armário.
    5. Certifique-se de que o medidor está desligado do carregador. Coloque o interruptor de modo Ohms e rode o interruptor de alimentação na.
    6. Medir a resistência da célula imergindo o eletrodo com a ponta mais curta na inserção e a ponta mais tempo fora do poço. Mantenha o eletrodo em um ângulo de 90° para a inserção da placa.

5. bacteriana sobrevivência após In Vitro as condições de trânsito Gastrointestinal

Nota: Preparar simulado digestão fluidos seguindo o protocolo de Minekus et al . (2014) 17, com as alterações descritas abaixo. Prepare todas as diluições com água ultrapura. Filtro-esterilizar todas as soluções através de um filtro de 0,22 µm e executar o processo de digestão em condições estéreis.

  1. Digestão oral:
    1. Coloque 3 mL da comunidade bacteriana em um tubo estéril de 50 mL, misture com 3 mL de fluido de saliva simulado (SSF), contendo (em mmol L-1): KCl, 15.1; KH2PO4, 3.7; NaHCO3, 6,8; MgCl2(H2O)6, 0.5, (NH4) CO3, 0,06; HCl, 1.1; CaCl2(H2O)2, 0,75. Adicione 75 U/mL de α-amilase da saliva humana tipo IX-A e mucina de 2 g/L de tipo suínos estômago II para o SSF.
    2. Incube a mistura por 2 min, a 37 ° C e 100 rpm. Recolha uma amostra de 2 mL para extração de DNA e quantificação de citometria de fluxo (S1).
  2. Digestão gástrica:
    1. Adicionar 4 mL de fluido gástrico simulado (SGF), contendo (em mmol L-1): KCl, 6,9; KH2PO4, 0,9; NaHCO3, 25; NaCl, 47.2; MgCl2(H2O)6, 0.1, (NH4) CO3, 0,5; HCl, 15,6; CaCl2(H2O)2, 0,075. Além disso, o SGF contido de mucina do tipo suínos estômago II 2 g/L.
    2. Medir o pH e ajustar o pH a 3 com 1 M de HCl, se necessário. Incube a 37 ° C e 100 rpm. Recolha uma amostra de 2 mL (S2).
  3. Digestão do intestino delgado:
    1. Adicionar 4 mL de líquido intestinal simulado (SIF) que contém (em mmol L-1): KCl, 6,8; KH2PO4, 0,8; NaHCO3, 85; NaCl, 38,4; MgCl2(H2O)6, 0,33; HCl, 8.4; CaCl2(H2O)2, 0,3; para o tubo de digestão.
    2. Ajuste o pH 7 com 1 M de NaOH, se necessário. Incube a 37 ° C e 100 rpm. Recolha uma amostra de 2 mL (S3).

6. capacidade de colonização bacteriana In Vitro trânsito Gastrointestinal condições a seguir

  1. Centrifugue a 2 mL de digestão do intestino delgado, durante 10 minutos a 2.650 x g.
  2. Remover o sobrenadante e misturar a pelota bacteriana com 5 mL de DMEM completada sem antibiótico e antibacteriano.
  3. Mancha e quantificar células intactas/danificado usando um citômetro de fluxo (ver Tabela de materiais), como descrito por Hernandez-Sanabria et al (2017) 11.
  4. Ajuste a densidade da célula a 10 células/mL viável5 diluindo em DMEM completada sem antibiótico e antibacteriano.
  5. Remover o meio apical do sistema transwell e adicionar 1,5 mL da suspensão bacteriana. Cultura co o sistema por 2 h em condições de cultura celular geral (37 ° C, umidade de 95%, 5% CO2).
    Nota: Este tempo pode ser estendido até 48 h, dependendo do protocolo experimental necessário. A cultura de co pode ser mantida em uma incubadora diferente daquele usado para a manutenção de rotina de célula, para evitar contaminações.
  6. Medir os valores TEER após a incubação, para avaliar a integridade da barreira epitelial, conforme descrito em 4.11.
  7. Ao completar o tempo de incubação, remova a mídia apical e coletar 0,5 mL para mais análises (S4). Uma subamostra de mídia pode ser usada para avaliação da viabilidade celular por ensaio de lactato desidrogenase (LDH) (ver Tabela de materiais), seguindo as instruções do fabricante.
  8. Adicione 0,5 mL de N-acetilcisteína de 10 mM em HBSS (NAC-buffer) para solubilizar o muco produzido pelo HT29-MTX e recuperar bactérias aderidas. Incubar as placas a 37 ° C, durante 1 h, sob agitação (135 rpm, consulte a Tabela de materiais).
  9. Recuperar o NAC-HBSS em um tubo de microcentrifugadora (S5) e lavar duas vezes as células com 1 mL DPBS.
  10. Adicionar 0,5 mL de 0.5% Triton X-100 (w/v) em cima de monocamadas, perturbar as células pipetando, recuperar o líquido e o vórtice para 1 min. velocidade é crucial para não danificar as células bacterianas com o detergente.
  11. Centrifugar as células por 5 min a 2.650 x ge separar o sobrenadante (S6) e o pellet (S7).

7. análise da amostra

Nota: Analise amostras coletadas (S1-S7) para avaliar a viabilidade bacteriana e aderência potencial para as células intestinais, seguindo uma simulado digestão gastrointestinal.

  1. Viabilidade bacteriana: passar amostras S1-S5 duas vezes através de um 0,45 µm e quantificar células bacterianas usando coloracao celular vivo/morto e fluxo cytometry, conforme indicado no passo 2.811.
  2. Potencial de adesão: preparar diluições em série (-1 a -8) para S1-S6 e raia de 10 µ l em ágar sangue e modificados placas BHI. Incube a 37 ° C em condições anaeróbias por 24 – 48 h placa o mesmo volume de S7 não diluído.
    1. Identificação taxonômica de bactérias aderidas:
      1. Escolha colônias individuais com um loop de cultura e ressuspender cada em 10 µ l de água livre de nuclease. Coletar 4 µ l da suspensão e usá-lo como um modelo para amplificação por PCR do gene 16S rRNA utilizando os primers e as condições descritas em 2.7.1.
      2. Realize o sequenciamento seguindo o protocolo em 2.7.3 e validação da sequência usando o procedimento incluído no 2.7.4.
  3. Fazer mais análise a jusante, tais como extração de DNA total, qPCR quantificação e/ou 16S rRNA amplicon arranjar em sequência, extração de RNA e transcriptomic de perfil conforme desejado.
    Nota: Quantificação de citometria de fluxo foi realizada imediatamente após a amostragem. Como um controle para células de membrana-permeabilizado, foi utilizada uma amostra exposta a 70 ° C por 3 min. Ruído de fundo foi avaliado pela medição com citometria de fluxo, a digestão fluidos ou amostras obtidas a partir do modelo de cultura celular sem bactérias. Cada amostra foi medida em triplicado.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Este protocolo leva à geração de um modelo apropriado para elucidar a sobrevivência e viabilidade de bactérias orais, sujeitado a condições de trânsito gastrointestinal simulado. As contagens de células intactas de cepas individuais é aproximadamente 108 células antes da mL-1 a criação da Comunidade sintética, enquanto o microcosmo terminousua contida acima de 90% de células viáveis durante o estabelecimento da Comunidade ( Figura 1A e 1B). Com base na quantificação Live/mortos, diminui a viabilidade bacteriana após cada etapa de digestão (Figura 2). Isso pode ser um resultado de pH ácido durante a passagem gástrica e os sais de bile contidos em fluidos de digestão do intestino delgado, ocorrem sob condições fisiológicas. Viabilidade durante o trânsito através de digestão gastrointestinal em vitro e em vivo pode depender de variações no ambiente (por exemplo, alimentou vs jejuou condições), ou até mesmo em processos de proteção de bactérias (esporo formação ou revestimentos entéricos).

Contagens de fluxo cytometric devem ser comparadas com controles apropriados, como calor-matou as bactérias ou amostras de fundo, para realizar a quantificação de células viáveis precisos18. As duras condições de digestão no estômago e intestino delgado podem alternar as bactérias às células viáveis, mas não-viáveis, que são bactérias vivas que não crescem ou dividir. Por esta razão, contagens das placas diferem de contagem de células viáveis obtidas com citometria de fluxo. Por exemplo, na Figura 3, células viáveis recuperadas através da interface da mucosa são coloridas em azul no jazigo da citometria de fluxo. No entanto, nenhum crescimento foi observado quando estas amostras de muco foram chapeados (resultados não mostrados).

A fração em que bactérias mostram taxas mais elevadas de viabilidade é o restos celulares (S7), como revelado pela placa de contagem (Figura 4). O número de colônias pode ser variável, mas a presença de bactérias metabolicamente ativas é encontrada nas amostras menos diluídas.

Figure 1
Figura 1: Viabilidade das bactérias compondo a comunidade microbiana terminousua no início da digestão gastrointestinal em vitro celular. Contagem de células viáveis de (A) (unidades logarítmicas) quantificada por citometria de fluxo e coloração live/morte (média ± desvio-padrão, n = 3). (B) parcela de citometria de fluxo representativo da comunidade microbiana terminousua após 48 h de co-cultura. Pontos em verde, vermelho e preto representam viável, danificado e plano de fundo ou bactérias não classificados, respectivamente. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: viabilidade das bactérias celular após a digestão gastrointestinal simulada. Barras representam o número de células viáveis (unidades logarítmicas) após as etapas da digestão intestinal oral, gástrica e pequenas (média ± desvio-padrão, n = 3). Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: parcela representativa das células bacterianas viáveis no período da intérfase da mucosa. Pontos vermelhos representam os pontos de fundo e azul as células viáveis. Condições de citometria de fluxo foram estabelecidas com base em adereços et al (2016) 19. da mucosa amostras foram diluídas 1: 100 (v/v) e corados com Sybr Green/Propidium iodeto por 15 min, e 100 µ l de amostra foi medida em FL1: 533/30 nm, FL2: 585/40 nm, FL3: > 670 nm long pass e FL4: 675/25 nm. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: unidades (CFU) cultivadas a partir de restos celulares no formadoras modificado placas BHI. Três repetições biológicas foram utilizadas para o ensaio de adesão bacteriana e realizaram-se três repetições de técnicas para a quantificação do UFC. Duas placas replicar contendo -1-6 diluições dos estilhaços da célula (S7) são mostradas na figura. Clique aqui para ver uma versão maior desta figura.

Cultura celular Aderente / suspensão Meio de cultivo Suplementos gerais Suplementos específicos Tempo de duplicação Condições de incubação
Caco-2 (ECACC 86010202) Aderentes Modificado águia médio (DMEM de Dulbecco) com glicose de 4,5 g/L Soro bovino fetal inativado (10% v/v)
Penicilina (100 U/mL) *
Estreptomicina (0,1 mg/mL) *
Anfotericina (0,0025 mg/mL) *
Glutamax (4 mM)
Aminoácidos não-essenciais (1% v/v)
Piruvato (1 mM)
65 – 72 h 95% de umidade e 10% CO2
Incubadora de CO2 (ver Tabela de materiais)
HT29-MTX (ECACC 12040401) Aderentes HEPES (1 mM) 20 – 24 h
* Antibióticos e antifúngicos foram retirados os meios de cultura celular 2 dias antes de começar os ensaios.

Tabela 1: Descrição da composição de linhas e meios de comunicação a célula para a manutenção de cultura celular.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

A microbiome oral é um elemento chave na saúde humana, como recentemente relatado por vários autores20,21. Conclusões anteriores sugerem que a ingestão de saliva contendo grandes cargas de bactérias pode influenciar o ecossistema microbiano do intestino delgado, que é um dos principais locais para a ferragem imune. A combinação de um modelo estático digestão gastrointestinal superior com a interface de host, representado pelas células epiteliais e secretoras de muco intestinais, serviu para desvendar o impacto do componente microbiano no host.

Modelos in vitro são ferramentas básicas para pesquisa, permitindo a realização de estudos mecanicistas e alcançar o conhecimento de fundo que se destina a reduzir, tornar mais eficiente e melhor destino na vivo estudos. Por esta razão, é fundamental para garantir o crescimento ideal das culturas axénica, antes de estabelecer a comunidade microbiana sintética, viabilidade e pureza. Recomenda-se avaliar a viabilidade e a composição das comunidades bacterianas antes da exposição de culturas de células, para evitar distorções na análise. Elevado número de bactérias danificadas pode dificultar a adesão e impacto ainda mais a integridade do modelo de célula. Além disso, o uso de uma fonte confiável de linhas celulares minimizará a identificação errônea de linha celular, contaminação e anotação pobre, realçando a reprodutibilidade experimental22.

Incluindo células produtoras de muco permite a semelhança com o intestino delgado, como muco e mucins fornecem a primeira linha de defesa do trato gastrointestinal23. Além disso, a camada da mucosa é apropriada para a colonização bacteriana, permitindo a caracterização bilateral transporte de metabólitos bacterianos. Além disso, condições simuladas gastrointestinais aumentam a capacidade de aderência de cepas de Lactobacillus paracasei de Caco-2 e mucina24, apoiando a relevância de incorporar processos digestivos em nosso modelo.

Novas melhorias no modelo podem ser introduzidas para incorporar o componente imune do hospedeiro, como anteriormente analisados25. No entanto, os sistemas atuais co-cultura de células epiteliais e imunes não foram utilizados para aplicações de interação micróbio-hospedeiro (por exemplo, avaliação de compostos bioativos de alimentos ou probióticos), que podem indicar que esses sistemas podem carecer de reprodutibilidade,25.

Pesquisas anteriores com Caco-2, HT29-MTX ou culturas co avaliaram a aderência da Probiótica ou cepas patogênicas de pilhas mamíferas26,27. Manchas de uso único ou associações de alguns microorganismos podem fornecer uma visão limitada sobre o anfitrião-micróbio interações, e não é representativa da complexidade do trato gastrointestinal humano. Embora o uso de comunidades microbianas naturais pode ser mais representativas do cenário na vivo , eles são difíceis de caracterizar e estudar. Em contraste, nossa metodologia oferece a oportunidade de avaliar várias interações do anfitrião-micróbio, usando um microcosmo representativo e complexo. O uso de uma comunidade microbiana sintética definido permite a geração de um sistema com complexidade reduzida28. Mudanças na Comunidade podem ser um resultado das condições microenvironmental no contexto das experiências individuais. Assim, o componente microbiano deste modelo pode ser facilmente dimensionado cima ou para baixo para desconstruir o impacto do ambiente como uma força seletiva. Finalmente, acessibilidade de amostragem garante ainda mais a caracterização das atividades funcionais de células humanas e a comunidade microbiana associada.

Nos últimos anos, foram desenvolvidos novos modelos em vitro baseados na tecnologia de organoides. Organoids são culturas de células 3D que incorporam algumas das principais características do tecido primário representado. Embora um sistema perto-fisiológicas para o estudo de células-tronco adultas e tecidos organoids intestinais, tal modelo também tem algumas limitações. Organoids intestinais tem uso limitado no assemelhando-se a respostas inflamatórias, a infecção ou drogas, como lhes falta de células do sistema imunológico. Além disso, organoids são heterogêneos em relação a viabilidade, tamanho e forma, impedindo o fenótipo triagem e processamento complexo de padronização. Apesar da limitação de linhas de celulares imortalizado por em vitro modelação dos tecidos saudáveis, o uso de linhas celulares bem caracterizadas e estável também oferece vantagens como a repetibilidade, reprodutibilidade e baixo custo. Estes benefícios permitem a exibição simultânea de várias condições, mas o uso de translação dos dados é controverso. As células primárias podem ser mais representativos da fisiologia no vivo ; no entanto, apresentam alta variabilidade inter-individual, não são totalmente caracterizados, são heterogêneos e têm um número limitado período de tempo. Esses fatores são um empecilho para a inclusão de várias condições ou Replica em um ensaio.

Como combinar linhas celulares com comunidades microbianas complexas pode representar um desafio, focamos no desenvolvimento de um modelo reproduzível e repetível com alta flexibilidade e aplicabilidade em laboratórios com equipamentos de celular básico, até mais representativo modelos tornaram-se disponíveis e bem caracterizados. Nós avaliamos a funcionalidade de diversas comunidades bacterianas usando estes modelos multicompartment, por exemplo, para avaliar o comportamento de probióticos no trato gastrointestinal superior e para a caracterização xenobióticos impacto na interface do intestino. Assim, propomos este modelo como base para mais ensaios com uma grande variedade de probióticos, drogas ou alimentos compostos, dentro de um ecossistema relevante e definidos em vitro .

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a divulgar

Acknowledgments

Os autores reconhecem com gratidão apoio financeiro da Fundação de pesquisa de Flandres para Marta Calatayud Arroyo (FWO postdoctoral fellowship-12N2815N). Emma Hernandez-Sanabria é um pós-doutorado apoiado por Flandres inovação e empreendedorismo (Agentschap voor Innovatie porta Wetenschap en Technologie, navegação fluvial).

Materials

Name Company Catalog Number Comments
STRAINS
Aggregatibacter actinomycetemcomitans American Type Culture Collection ATCC 43718
Fusobacterium nucleatum American Type Culture Collection ATCC 10953
Porphyromonas gingivalis American Type Culture Collection ATCC 33277
Prevotella intermedia American Type Culture Collection ATCC 25611
Streptococcus mutans American Type Culture Collection ATCC 25175
Streptococcus sobrinus American Type Culture Collection ATCC 33478
Actinomyces viscosus American Type Culture Collection ATCC 15987
Streptococcus salivarius  TOVE-R
Streptococcus mitis American Type Culture Collection ATCC 49456
Streptococcus sanguinis BCCM/LMG Bacteria Collection LMG 14657
Veillonella parvula Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures DSM 2007
Streptococcus gordonii American Type Culture Collection ATCC 49818
CELL LINES
Caco-2 cells European Collection of Authenticated Cell Cultures 86010202
HT29-MTX cells European Collection of Authenticated Cell Cultures 12040401
REAGENTS AND CONSUMABLES
Brain Heart Infusion (BHI) broth Oxoid CM1135
Blood Agar 2 Oxoid CM0055 Blood Agar medium
Menadione Sigma M9429
Hemin Sigma H9039
5% sterile defibrinated horse blood E&O Laboratories Ltd, P030
InnuPREP PCRpure Kit Analytik Jena 845-KS-5010250 PCR purification kit
Big Dye Applied Biosystems 4337454 Dye for sequencing
ABI Prism BigDye Terminator v3.1 cycle sequencing kit Applied Biosystems 4337456
SYBR Green I Invitrogen S7585
Propidium Iodide Invitrogen P1304MP
T25 culture flasks uncoated, cell-culture treated, vented, sterile VWR 734-2311
Trypsin-EDTA solution Sigma-Aldrich T3924-100ML
Trypan Blue solution
0.4%, liquid, sterile-filtered
Sigma-Aldrich T8154 
PBS Gibco 14190250
DMEM cell culture media, with GlutaMAX and Pyruvate Life technologies 31966-047
Corning Transwell polyester membrane cell culture inserts Sigma-Aldrich CLS3450-24EA
Mucin from porcine stomach Type II   Sigma-Aldrich M2378
Inactivated fetal bovine serum Greiner Bio One 758093
Antibiotic-Antimycotic (100X) Gibco 15240062
Triton X 100 for molecular biology Sigma-Aldrich T8787 
DPBS without calcium, magnesium Gibco 14190-250
Pierce LDH Cytotoxicity Assay Kit Thermo Fisher Scientific 88953
Corning HTS Transwell-24 well, pore size 0.4 µm Corning Costar Corp 3450
Nuclease-free water Serva Electrophoresis 28539010
EQUIPMENT
Neubauer counting chamber improved Carl Roth T729.1
BD Accuri C6 Flow cytometer BD Biosciences 653118
PowerLyzer 24 Homogenizer MoBio 13155
T100 Thermal Cycler BioRad 186-1096
Flush system Custom made -
InnOva 4080 Incubator Shaker New Brunswick Scientific 8261-30-1007 Shaker for 2.10
Memmert CO2 incubator Memmert GmbH & Co. ICO150med
Millicell ERS (Electrical Resistance System) EMD Millipore, Merck KGaA MERS00002
Millipore Milli-Q academic, ultra pure water system Millipore, Merck KGaA -
Shaker (ROCKER 3D basic) IKA 4000000 Shaker for 6.10

DOWNLOAD MATERIALS LIST

References

  1. Sender, R., Fuchs, S., Milo, R. Revised estimates for the number of human and bacteria cells in the body. PLoS Biology. 14, e1002533 (2016).
  2. Kelly, D., King, T., Aminov, R. Importance of microbial colonization of the gut in early life to the development of immunity. Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis. 58-69 (2007).
  3. Aas, J. A., Paster, B. J., Stokes, L. N., Olsen, I., Dewhirst, F. E. Defining the normal bacterial flora of the oral cavity. Journal of Clinical Microbiology. 43, 5721-5732 (2005).
  4. Marsh, P. D., Head, D. A., Devine, D. A. Dental plaque as a biofilm and a microbial community-Implications for treatment. Journal of Oral Biosciences. 57, 185-191 (2015).
  5. Socransky, S. S., Haffajee, A. D., Cugini, M. A., Smith, C., Kent, R. L. Microbial complexes in subgingival plaque. Journal of Clinical Periodontology. 25, 134-144 (1998).
  6. Haffajee, A. D., et al. Subgingival microbiota in healthy, well-maintained elder and periodontitis subjects. Journal of Clinical Periodontology. 25, 346-353 (1998).
  7. Venema, K. Microbial metabolites produced by the colonic microbiota as drivers for immunomodulation in the host. The FASEB Journal. 27, (2013).
  8. Marzorati, M., et al. The HMI (TM) module: A new tool to study the Host-Microbiota Interaction in the human gastrointestinal tract in vitro. BMC Microbiology. 14, 133 (2014).
  9. Tanzer, J. M., Kurasz, A. B., Clive, J. Competitive displacement of mutans streptococci and inhibition of tooth-decay by Streptococcus-Salivarius Tove-R. Infection and Immunity. 48, 44-50 (1985).
  10. Slomka, V., et al. Nutritional stimulation of commensal oral bacteria suppresses pathogens: the prebiotic concept. Journal of Clinical Periodontology. 44, 344-352 (2017).
  11. Hernandez-Sanabria, E., et al. In vitro increased respiratory activity of selected oral bacteria may explain competitive and collaborative interactions in the oral microbiome. Frontiers in Cellular and Infection Microbiology. 7, 235 (2017).
  12. Alvarez, G., Gonzalez, M., Isabal, S., Blanc, V., Leon, R. Method to quantify live and dead cells in multi-species oral biofilm by real-time PCR with propidium monoazide. AMB Express. 3, (2013).
  13. Ehsani, E., et al. Initial evenness determines diversity and cell density dynamics in synthetic microbial ecosystems. Scientific Reports. 8, 340 (2018).
  14. Hernandez-Sanabria, E., et al. Correlation of particular bacterial PCR-denaturing gradient gel electrophoresis patterns with bovine ruminal fermentation parameters and feed efficiency traits. Applied and Environmental Microbiology. 76, 6338-6350 (2010).
  15. Masters, J. R., Stacey, G. N. Changing medium and passaging cell lines. Nature Protocols. 2, 2276-2284 (2007).
  16. Calatayud, M., Velez, D., Devesa, V. Metabolism of inorganic arsenic in intestinal epithelial cell lines. Chemical Research in Toxicology. 25, 2402-2411 (2012).
  17. Minekus, M., et al. A standardised static in vitro digestion method suitable for food - an international consensus. Food & Function. 5, 1113-1124 (2014).
  18. Berney, M., Hammes, F., Bosshard, F., Weilenmann, H. U., Egli, T. Assessment and interpretation of bacterial viability by using the LIVE/DEAD BacLight kit in combination with flow cytometry. Applied and Environmental Microbiology. 73, 3283-3290 (2007).
  19. Props, R., Monsieurs, P., Mysara, M., Clement, L., Boon, N. Measuring the biodiversity of microbial communities by flow cytometry. Methods in Ecology and Evolution. 7, 1376-1385 (2016).
  20. Yamashita, Y., Takeshita, T. The oral microbiome and human health. Journal of Oral Science. 59, 201-206 (2017).
  21. Wade, W. G. The oral microbiome in health and disease. Pharmacological Research. 69, 137-143 (2013).
  22. Yu, M., et al. A resource for cell line authentication, annotation and quality control. Nature. 520, 307 (2015).
  23. Pelaseyed, T., et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunological Reviews. 260, 8-20 (2014).
  24. Bengoa, A. A., et al. Simulated gastrointestinal conditions increase adhesion ability of Lactobacillus paracasei strains isolated from kefir to Caco-2 cells and mucin. Food Research International. 103, 462-467 (2018).
  25. Kleiveland, C. R., et al. The Impact of Food Bioactives on Health: in vitro and ex vivo models. Verhoeckx, K., et al. Springer International Publishing. 197-205 (2015).
  26. Laparra, J. M., Sanz, Y. Comparison of in vitro models to study bacterial adhesion to the intestinal epithelium. Letters in Applied Microbiology. 49, 695-701 (2009).
  27. Gagnon, M., Berner, A. Z., Chervet, N., Chassard, C., Lacroix, C. Comparison of the Caco-2, HT-29 and the mucus-secreting HT29-MTX intestinal cell models to investigate Salmonella adhesion and invasion. Journal of Microbiological Methods. 94, 274-279 (2013).
  28. Großkopf, T., Soyer, O. S. Synthetic microbial communities. Current Opinion in Microbiology. 18, 72-77 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics