Bedömningen av lönsamheten för ett syntetiskt bakteriell konsortium för värd-mikrob In Vitro Gut gränssnittet

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Gut värd-mikrobinteraktioner bedömdes med hjälp av en ny metod som kombinerar en syntetiska orala gemenskap, i vitro gastrointestinala matsmältning och en modell av tunntarmen epitel. Vi presenterar en metod som kan anpassas för att utvärdera cell invasion av patogener och flera arter biofilmer, eller ens att testa probiotiska formuleringar överlevnadsförmåga.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Calatayud Arroyo, M., Van de Wiele, T., Hernandez-Sanabria, E. Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface. J. Vis. Exp. (137), e57699, doi:10.3791/57699 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Samspelet mellan värd och bakterieflora har länge erkänt och utförligt beskrivs. Munnen är liknande till andra delar av mag-tarmkanalen, som bosatt bakterieflora uppstår och förhindrar kolonisation av exogena bakterier. Faktiskt mer än 600 arter av bakterier förekommer i munhålan, och en enda individ kan bära omkring 100 olika när som helst. Orala bakterier besitter förmågan att följa olika nischer i orala ekosystemet, alltså blir integrerat inom bosatt mikrobiella samhällen, och främjar tillväxt och överlevnad. Flödet av bakterier i tarmen vid sväljning har dock föreslagits att störa balansen i tarmfloran. I själva verket skiftade oral administrering av P. gingivalis bakteriell sammansättning i den ileal mikrofloran. Vi använde en syntetisk gemenskap som en förenklad framställning av naturliga muntliga ekosystem, för att belysa överlevnad och lönsamhet av orala bakterier utsätts för simulerad gastrointestinal transit villkor. Fjorton arter markerade, utsattes för in vitro- saliv, mag och tarm matsmältningen processer, och presenteras i en multicompartment cell modell innehållande Caco-2 och HT29-MTX celler för att simulera slemhinnor tarmepitelet. Denna modell serveras nysta effekterna av förtäring bakterier på celler involverade i det enterohepatiska kretsloppet. Med hjälp av syntetiska samhällen tillåter styrbarhet och reproducerbarhet. Således, denna metod kan anpassas att bedöma patogen livskraft och påföljande inflammation-associerade ändringar, colonization kapacitet av probiotiska blandningar, och i slutändan potentiella bakteriell inverkan på presystemisk cirkulationen.

Introduction

Människor sammanbor med bakterier som är närvarande vid samma nummer som mänskliga celler1. Därför är det av avgörande viktigt att få en omfattande förståelse av den mänskliga mikrobiomet. Munhålan är en unik miljö i att den är uppdelad i flera mindre livsmiljöer, som alltså innehåller en stor mängd bakterier och biofilm i dessa olika platser. Att vara ett öppet ekosystem, kan vissa arter i munnen vara övergående besökare. Dock kolonisera vissa mikroorganismer snart efter födelsen och form organiserade biofilmer2. Dessa finns i tändernas yta ovanför den gingivala skreva, subgingival skreva, tungan, slemhinnorna och protetik och fyllningar3. Bakterier kan också vara närvarande som flockar och plankton celler i lumen av kanalen tand, blandade med nekrotisk massa vävnad eller upphängd i en vätska fas.

Det finns aktiva, kontinuerlig överhörning mellan värdceller och bosatt bakterieflora4. Bakterier kommunicera inom och mellan arter, och endast en liten del av naturliga kolonisatörerna kan följa vävnader, medan andra bakterier tillmäter dessa primära kolonisatörerna. Till exempel är cell cell bindning mellan mikroorganismer nyckeln för att integrera sekundära kolonisatörerna i oral biofilm och bygga komplexa nätverk av samverkande mikrobiella celler4. Omkring bildas 70% av bakteriell aggregat i ett salivprov genom Porphyromonas sp., Streptococcus sp., Prevotella sp., Veillonella sp. och oidentifierade Bacteroidetes. F. nucleatum är en mellanliggande kolonisatör i subgingival biofilm och aggregat med sena kolonisatörerna P. gingivalis, T. denticola, och Tannerella forsythia, som är inblandade i parodontit5. Dessutom upptar Streptococcus mitis både slemhinnor och dental livsmiljöer, medan S. sanguinis och S. gordonii föredrar att kolonisera tänder3. Således är, S. sanguinis närvarande i nedre framtänder och hörntänder, medan Actinomyces naeslundii har hittats i övre anteriors6.

Dessutom spelar den inhemska mikrobiomet en roll för att upprätthålla mänsklig hälsa2. Bosatt bakterieflora deltar i immun utbildning och att förebygga patogen expansion. Detta kolonisering motstånd beror på att de infödda bakterierna kan vara bättre anpassad i knutna till ytor och effektivare på metabolising de tillgängliga näringsämnena för tillväxt. Även om probiotiska stammar överleva tidens gastrointestinala och förbli aktiva, har varaktigheten av autoktona bakterier förtäring från en övre läge i mag-tarmkanalen inte fullt beskrivits. Således utsätts vi en konstgjord gemenskap, företrädare för det orala ekosystemet, simulerade gastrointestinal transit villkor. Livskraften hos bakterieceller bedömdes med hjälp av en multicompartment modell som liknar tarmepitelet. Nuvarande gut simulatorer erbjuder lämplig reproducerbarhet när det gäller analys av luminala mikrobiell gemenskapen7. Dock behandlas bakteriell vidhäftning och värd-mikrob interaktion separat, som kombinerar cellinjer med mikrobiella samhällen är utmanande8. Däremot presenterar vi en ram som ger potentiella mekanistisk förklaring av framgångsrika colonization händelser rapporterade i gut-gränssnittet. Faktiskt kan denna modell tillsammans användas med en statisk gut modell för att utvärdera effekterna av mikrobiella samhällen på värd yta signalering.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. stammar och kultur villkor

Obs: Syntetiska orala gemenskapen bestod av stammar ofta finns i den muntliga mikrobiomet3.

  1. Få följande stammar från den amerikanska typen kultur samling (ATCC): Aggregatibacter actinomycetemcomitans (ATCC 43718), Fusobacterium nucleatum (ATCC 10953), Porphyromonas gingivalis (ATCC 33277), Prevotella intermedia (ATCC 25611), Streptococcus mutans (ATCC 25175), Streptococcus sobrinus (ATCC 33478), Actinomyces naeslundii (ATCC 51655), Streptococcus gordonii (ATCC 49818), Actinomyces viscosus (ATCC 15987) och Streptococcus mitis (ATCC 49456).
  2. Förvärva Veillonella parvula från Leibniz Institute DSMZ-tysk samling av mikroorganismer och cellkulturer (DSM 2007), Streptococcus sanguinis ur samlingen BCCM/LMG bakterier (LMG 14657) och använda Streptokocker salivarius stam TOVE-R9och Streptococcus oralis10.

2. utveckling av Medelhavet gemenskapens företrädare för den muntliga mikrobiomet

Obs: Generera en syntetisk gemenskap för att simulera muntlig bakterier till tarmepitelet in vitro- potentiella vidhäftning kapacitet. Odla bakterier på blodagar tallrikar kompletteras med 5 μg/mL hemin 1 μg/mL menadion och 5% steril defibrinated häst blod, som beskrivs i Hernandez-Sanabria o.a. (2017) 11. I korthet:

  1. Lös 100 mg hemin i 2 mL 1 M NaOH, tillsätt 100 mL destillerat Ånghärdad vatten. Förvara i en mörk behållare. Sterilisera genom ett 0,22 µm filter innan du lägger till medium.
  2. Lös 100 mg menadion i 20 mL 96% etanol. Sterilisera genom ett 0,22 µm filter innan du lägger till medium.
  3. Förbereda 1 L blodagar medium (se Tabell för material) enligt tillverkarens instruktioner och autoklav. Låt svalna innan du lägger till häst blodet och kosttillskott. Blanda och häll plattorna.
  4. Förbereda modifierade hjärnan hjärtat Infusion (BHI) buljong som tidigare rapporterade12. Lägg till 5 μg/mL hemin och 1 μg/mL menadion efter autoklavering.
  5. Fördela 9 mL av medlet i Hungate rör och Stäng med en gummipropp och aluminiumhätta. Spola rören med N2tillpass2 (90% / 10%).
  6. Hämta 1 mL anaerob medium med en spruta och placera den i ett 1,5 mL mikrocentrifug rör. Plocka enstaka kolonier av varje bakteriearter, Återsuspendera i mediet och överföra tillbaka i den anaeroba modifierade BHI. Inkubera i 48 timmar vid 37 ° C, med undantag av S. salivarius, som måste inkuberas i 24 h.
  7. Om det behövs bekräfta renhet av kulturerna före montering syntetiska gemenskapen. I korthet:
    1. Extrahera DNA från de flytande kulturerna liksom Hernandez-Sanabria o.a. (2010) 13 och förstärka 16S rRNA genen använda primers 27F (AGAGTTTGATYMTGGCTCAG) och 1492R (TACGGYTACCTTGTTACGACT), och följande program: 5 minuter vid 95 ° C, 30 cykler av 95 ° C i 1 min, 55 ° C i 1 min och 72 ° C under 1,5 min, följt av en sista förlängning steg av 5 min vid 72 ° C.
    2. Rena PCR-produkten med en kommersiell kit (se Tabell för material), följa tillverkarens instruktioner.
    3. Utföra sekvensering reaktionen av renat produkter i en 10 μL total volym innehållande 0,5 μL av färga (se Tabell för material), 3,2 pmol M13f primer (CGCCAGGGTTTTCCCAGTCACGAC), 2,0 μL av 5 x sekvensering buffert och 20 ng av mallen med hjälp av en kommersiella sekvensering system med kit (se Tabell för material).
      Obs: Vi hade denna procedur utförs kommersiellt.
    4. Utför en BLAST sökning på alla sekvenser (http://blast.ncbi.nlm.nih.gov/Blast.cgi) att bestämma den närmaste kända taxonen och jämföra med sekvensen av den ursprungliga stammen med hjälp av verktyget RDP klassificerare online (http://rdp.cme.msu.edu/) och i SINA Anpassning tjänst (https://www.arb-silva.de/aligner/).
  8. Mäta antalet cell i slutet av ruvning, med hjälp av flödescytometri och SYBR Green/Propidium jodid fläcken som beskrivs i Hernandez-Sanabria o.a. (2017) 11. Späd kulturerna till 105 celler mL-1, använda modifierad BHI.
  9. Tillsätt 1 mL S. mitis i 75 mL anaerob BHI och inkubera tills stationära fasen (6 h). Efter, samla 0,75 mL varje utspädda stam och blanda under anaeroba förhållanden.
  10. När alla kulturer har blandats, ta 1 mL av mikrokosmos och lägga till de 75 mL av BHI. Inkubera syntetiska gemenskapen under 10% CO2, 10% H2, 80% N2 för 48 h vid 37 ° C och 200 rpm (se Tabell för material).
  11. Mäta cell densiteten som 2,8. innan vi presenterar gemenskapen till cell modell. Sammansättningen av gemenskapen kan bedömas med kvantitativa Real-Time PCR, använda primers och glödgning temperaturer i tabell 1 i Slomka o.a. (2017) 10. dessutom använda 16S rRNA genen amplikon sekvensering för att tillhandahålla information om den initiala medlemmar närvarande13,14. För antingen identitet-bekräftar protokoll, använda cDNA som en mall för att ange de bakterier som aktivt transkribera proteiner och använda DNA som mall för att avslöja närvaro/frånvaro av stammar.

3. allmänna cellkultur praxis

Obs: För allmänna aspekter av cellodling, författarna se Master och Stacey (2007)15. Få cellinjer som används från den europeiska samling av autentiserade cellkulturer (Caco-2 ECACC 86010202 och HT29-MTX-E12 ECACC 12040401, Public Health England, Storbritannien). Reagenser för cellodling kan köpas (se Tabell för material), om inte annat anges.

  1. Underhåll och passaging av Caco-2 och HT29-MTX cellinjer
    Obs: Caco-2 och HT29-MTX celler odlas rutinmässigt i 25 cm2 vävnadsodling kolvar som innehåller kompletterade DMEM medium (tabell 1). Celler är trypsinized när 60 – 70% sammanflödet nås.
    1. Ta bort cellodlingsmedium från kolvar. Tvätta två gånger med 5 mL PBS utan Ca+++ /Mg +++.
    2. Tillsätt 2 mL av en 0,5 mg/L lösning av trypsin och 0.22 HB etylendiamintetraättiksyra (EDTA). Distribuera trypsin lösningen genom att försiktigt flytta kolven. Ta bort 1,5 mL av trypsin lösningen och inkubera kolven vid 37 ° C i 10 min.
    3. Kolla under mikroskopet om celler är fristående från kolvens yta. Inkubera i ytterligare 5 min, om det behövs.
    4. Tillsätt 5 mL av kompletterade cell kultur media till kolven att inaktivera trypsin. Pipettera upp och ner för att erhålla en homogen enda cellsuspension.
    5. Omedelbart, ta en 50 µL delmängd av cellsuspensionen och blanda med steril 0,4% Trypan blå lösning i en 1:1 (v/v) andel för Caco-2-celler eller 1:5 v/v för HT29-MTX. Blandningen av pipettering och belastning i en räknande kammare (se Tabell för material).
    6. Räkna de viabla cellerna (vita ljusa celler) under mikroskopet (se tillverkarens anvisningar).
    7. Utsäde i en ny kolv på en densitet på 4 x 105 celler/cm2 och 1 x 104 celler/cm2, Caco-2 och HT29-MTX, respektive.
      Obs: (1) Caco-2-celler skilja och bilda åtsittande föreningspunkter en gång når konfluens. Det är extremt viktigt att undvika över-konfluens innan trypsinization. Överväxt av celler i kolven kan orsaka fel i cell avlossning efter trypsinization eller cell klumpar. (2) HT29-MTX celler är slem-producerande celler med höga metaboliska aktiviteten16. Dessa funktioner kan orsaka en snabb försurning av cell kultur media, särskilt om cellerna är på hög densitet. HEPES buffert kan läggas till i cellodlingsmedium (tabell 1) för att bibehålla pH mellan 7 och 7.2. Om pH-värdet sjunker, medium kan vara utbytt när confluency är mindre än 50%. Dock om confluency > 50%, cellkulturen måste delas.

4. montering av en Multicompartment Cell modell simulerar Gut värd-mikrob gränssnittet

Obs: Fullständig samtidig kulturen i dubbla kammare wells (diameter 24 mm, pore storlek 0,4 μm, se Tabell för material).

  1. Tillsätt 1,5 mL komplett cell kultur media till apikala fack och 2 mL att den basala. Preinkubera för 20 – 30 min att få jämn fördelning av cellsuspensionen när sådd.
  2. Trypsinize Caco-2 och HT29-MTX cellkultur som beskrivs i avsnitt 3. Trypsinization förfarandet måste följas noggrant för att uppnå homogen fördelning av både cellinjer, i en enda cell fjädring, utan klumpar.
  3. Räkna de viabla cellerna som beskrivs i 3.1.8.
  4. Justera cell densiteten till 6,5 x 104 celler/cm2 i 90/10 andel av Caco-2/HT29-MTX celler.
  5. Homogenisera cellsuspensioner och lägga till motsvarande volym av Caco-2 och HT29-MTX celler i en förfylld steril behållare med kompletterade cell kultur media. Ta bort före ruvade media från den apikala sidan av kammaren genom aspiration.
  6. Försiktigt blanda cellsuspensionen genom pipettering och överför 1,5 mL i apikala facket av kammaren mellanläggen. Sådd förfarandet kräver en konstant homogenisering av cellsuspensionen, som celler tenderar att sediment. Beroende på upplevelsen av användaren och arbetande hastighet, måste cellsuspension blandas efter dispensering 1 – 3 brunnar.
  7. Flytta plattorna försiktigt bakåt och framåt och sedan höger till vänster till höger (5 – 10 gånger) att få en jämn spridning av celler i brunnen. Transfer till inkubatorn och upprepa rörelsen av plattorna.
  8. Upprätthålla samtidig kulturen av Caco-2/HT29-MTX celler i 15 dagar, uppfriskande apikala och basala fack varannan dag med kompletterade DMEM. Efter denna tid, kan cellen kulturmassmedia ändras till kompletterade DMEM utan antibiotika/antimycotic lösning.
  9. Underhålla systemet förrän 20 – 21 dagar efter sådd av uppfriskande medium varannan dag.
  10. Mäta epiteliala barriären integritet innan analysen, med hjälp av ett elektriskt motstånd-System (se tabell för material), följa instruktionerna för tillverkaren.
    1. Se till att TEER utrustning är fulladdat (> 24 h) innan mätningarna.
    2. Koppla ur utrustningen TEER från strömförsörjningen och täck med en plast autoklav väska. Gör ett hål i påsen att införa elektroden och Anslut till den ingående porten på mätaren. Spraya med 70% etanol/vatten (v/v) innan införa TEER utrustningen till skåpet flöde.
    3. För att desinficera elektroden, fördjupa elektrod tipsen i 70% etanol/vatten (v/v) lösning för 15 min. Tillåt att lufttorka för 15 s. Skölj elektroden i förväg värmde cell kultur media.
    4. Tar cellerna ur inkubatorn och låta celler för att komma till rumstemperatur inuti flödet skåp.
    5. Kontrollera att mätaren kopplas bort från laddaren. Ställ in läge ohm och slå på strömbrytaren på.
    6. Mäta cell motståndet genom att sänka ner elektroden med kortare spetsen i Infoga och längre spets ur brunnen. Håll elektroden i 90° vinkel till plattan infoga.

5. bakteriell överlevnad följande In Vitro gastrointestinala Transit villkor

Obs: Förbereda simulerade matsmältningen vätskor efter protokollet av Minekus et al. (2014) 17, med de ändringar som beskrivs nedan. Förbereda alla spädningarna med ultrarent vatten. Filter-sterilisera alla lösningar genom ett 0,22 µm filter och matsmältningen procedur under sterila förhållanden.

  1. Muntliga matsmältning:
    1. Placera 3 mL bakteriell gemenskapen i en 50 mL sterilt rör, blanda med 3 mL simulerade saliv vätska (SSF), som innehåller (i mmol L-1): KCl, 15,1; KH2PO4, 3,7; NaHCO3, 6,8; MgCl2(H2O)6, 0,5, (NH4) CO3, 0,06; HCl, 1.1; CaCl2(H2O)2, 0,75. Tillsätt 75 U/mL av α-amylas från mänsklig saliv typ IX-A och 2 g/L mucin från svin magen typ II till SSFs.
    2. Inkubera blandningen för 2 min, vid 37 ° C och 100 rpm. Samla en 2 mL prov för DNA-extraktion och flöde flödescytometri kvantifiering (S1).
  2. Gastric matsmältning:
    1. Tillsätt 4 mL simulerad mag vätska (SGF), som innehåller (i mmol L-1): KCl, 6,9; KH2PO4, 0,9; NaHCO3, 25. NaCl, 47,2; MgCl2(H2O)6, 0,1, (NH4) CO3, 0,5; HCl, 15,6; CaCl2(H2O)2, 0,075. Dessutom innehöll SGF 2 g/L av mucin från svin magen typ II.
    2. Mät pH och justera till pH 3 med 1 M HCl, om det behövs. Inkubera vid 37 ° C och 100 rpm. Samla en 2 mL prov (S2).
  3. Tunntarmen matsmältning:
    1. Tillsätt 4 mL simulerade intestinal vätska (SIF) som innehåller (i mmol L-1): KCl, 6,8; KH2PO4, 0,8; NaHCO3, 85. NaCl, 38,4; MgCl2(H2O)6, 0,33; HCl, 8,4; CaCl2(H2O)2, 0,3; till matsmältningen röret.
    2. Justera till pH 7 med 1 M NaOH, om det behövs. Inkubera vid 37 ° C och 100 rpm. Samla en 2 mL prov (S3).

6. bakteriell kolonisering förmåga följande In Vitro gastrointestinala Transit villkor

  1. Centrifugera 2 mL av tunntarmen matsmältningen, i 10 min vid 2,650 x g.
  2. Avlägsna supernatanten och blanda den bakteriella pelleten med 5 mL av kompletterade DMEM utan antibiotika och antimycotic.
  3. Fläcken och kvantifiera intakt/skadade celler som använder en flödescytometer (se Tabell för material), vilket är som beskrivs av Hernandez-Sanabria o.a. (2017) 11.
  4. Justera cell densiteten till 105 livskraftiga celler/mL genom spädning i kompletterade DMEM utan antibiotika och antimycotic.
  5. Ta bort det apikala mediet transwell systemet och tillsätt 1,5 mL av bakteriesuspensionen. Samarbete kultur systemet för 2 h under allmänna cell kultur förhållanden (37 ° C, 95% luftfuktighet, 5% CO2).
    Obs: Denna tid kan förlängas upp till 48 h, beroende på den experimentella protokoll som krävs. Samtidig kulturen kan bibehållas i en annan inkubator än den som används för rutinmässig cell underhåll, för att undvika föroreningar.
  6. Mäta TEER värdena efter inkubation, att utvärdera den epiteliala barriären integritet som beskrivs i 4.11.
  7. Efter att ha avslutat inkubationstiden, ta bort apikala media, och samla 0,5 mL för ytterligare analyser (S4). Ett delprov av media kan användas för bedömning av cellernas viabilitet av laktatdehydrogenas (LDH)-analysen (se Tabell för material), följa instruktionerna för tillverkaren.
  8. Tillsätt 0,5 mL 10 mM N-acetylcystein i HBSS (NAC-buffert) solubilize slem producerad av i HT29-MTX och återställer klibbade bakterier. Inkubera plattorna vid 37 ° C i 1 h, enligt agitation (135 rpm, se Tabell för material).
  9. Återställa den NAC-HBSS i en mikrocentrifug rör (S5) och tvätta två gånger cellerna med 1 mL DPBS.
  10. Tillsätt 0,5 mL 0,5% Triton x-100 (w/v) ovanpå enskiktslager, störa cellerna genom pipettering, återställa vätskan och vortex för 1 min. hastighet är avgörande för att undvika att skada bakteriecellerna med rengöringsmedel.
  11. Centrifugera cellerna för 5 min vid 2,650 x g, samt separat supernatanten (S6) och pelleten (S7).

7. provanalys

Obs: Analysera insamlade prover (S1-S7) att utvärdera bakteriell livskraft och vidhäftning potentiella till intestinala celler, efter en simulerad gastrointestinala matsmältning.

  1. Bakteriella livskraft: passera prover S1-S5 två gånger genom ett 0,45 µm och kvantifiera bakterieceller som använder live/dead cell färgning och flödescytometri, som anges i steg 2,811.
  2. Vidhäftning potentiella: Bered seriella utspädningar (-1 till -8) för S1-S6 och streak 10 µL i blodagar och modifierade BHI plattor. Inkubera vid 37 ° C under anaeroba förhållanden för 24 – 48 h. plattan samma volym av outspädd S7.
    1. Taxonomisk identifiering av vidhäftat bakterier:
      1. Plocka enskilda kolonier med en kultur loop och resuspendera varje på 10 µL nuclease-gratis vatten. Samla 4 µL av denna suspension och använda den som en mall för PCR-amplifiering av 16S rRNA genen med hjälp av primers och villkor som beskrivs i 2.7.1.
      2. Utföra sekvensering efter protokollet i 2.7.3 och validering av sekvensen med hjälp av proceduren som ingår i 2.7.4.
  3. Göra ytterligare nedströms analyser som totala DNA-extraktion, qPCR kvantifiering och/eller 16S rRNA amplikon sekvensering, RNA-extraktion och transcriptomic profilering som önskas.
    Obs: Flöde flödescytometri kvantifiering utfördes omedelbart efter provtagningen. Som en kontroll för membran-permeabilized celler användes ett prov utsätts för 70 ° C i 3 min. Bakgrundsljud bedömdes genom att mäta med flödescytometri den matsmältningen vätskor eller produktproverna cell kultur modell utan bakterier. Varje prov mättes i tre exemplar.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Detta protokoll leder till generation av en modell som är lämplig för att belysa överlevnad och lönsamhet av orala bakterier utsätts för simulerad gastrointestinal transit villkor. Räkningarna av intakta celler från enskilda stammar är cirka 108 cells mL-1 före skapandet av syntetiska gemenskapen, medan Medelhavet mikrokosmos som finns över 90% av viabla celler under upprättandet av gemenskapen () Figur 1A och 1B). Baserat på Live/Dead kvantifiering, minskar bakteriell bärkraft efter varje matsmältningen steg (figur 2). Detta kan vara ett resultat av surt pH under gastric passagen och gallsalter som finns i tunntarmen matsmältningen vätskorna, som inträffar under fysiologiska betingelser. Lönsamhet under transitering genom både in vitro och i vivo gastrointestinala matsmältningen kan bero på variationer i miljön (t.ex. matas vs. fastande förhållanden), eller ens på bakterier skydd processer (spore bildning eller enterisk beläggning).

Flöde flödescytometrisk räkningarna måste jämföras med lämpliga kontroller, till exempel värmeavdödade bakterier eller bakgrunden prover, att utföra korrekt fungerande cell kvantifiering18. De hårda villkor för magen och tunntarmen matsmältningen kan växla bakterier till livskraftiga men icke-odlingsbara celler, som är levande bakterier som inte antingen växer eller dela upp. Därför skiljer sig plattan räknas från livskraftiga blodkroppar erhålls med flödescytometri. Till exempel i figur 3, är viabla celler återhämtat sig från gränssnittet slemhinnor färgade i blått i flödet flödescytometri tomten. Emellertid observerades ingen tillväxt när proverna slem var guldpläterade (resultat inte visas).

Bråket som bakterier visar högre lönsamhet är det cellulära skräpet (S7), som framkommit vid plattan räknar (figur 4). Antalet kolonier kan vara variabel, men närvaron av metaboliskt aktiva bakterier hittas i mindre utspädda proven.

Figure 1
Figur 1: Cellviabilitet av bakterier komponera Medelhavet mikrobiell gemenskapen i början av in vitro- gastrointestinala matsmältningen. (A) livskraftiga blodkroppar (log enheter) kvantifieras av levande/död färgning och flöde flödescytometri (medelvärde ± standardavvikelse, n = 3). (B) representativa flöde flödescytometri tomt Medelhavet mikrobiell gemenskapen efter 48 h av samtidig kultur. Prickar i gröna, röda och svarta representerar livskraftig, skadade och bakgrund eller icke-klassificerade bakterier, respektive. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: cellviabilitet av bakterier efter den simulerade gastrointestinala matsmältningen. Staplarna representerar antalet livskraftiga celler (log enheter) efter oral, magsäcken och små intestinal matsmältningen stegen (medelvärde ± standardavvikelse, n = 3). Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: representativa tomt på livskraftiga bakterieceller i slemhinnor interphasen. Röda prickar representerar bakgrund och blå prickar de viabla cellerna. Flödescytometri villkor fastställdes baserat på rekvisita o.a. (2016) 19. slemhinnor prover var utspädd 1: 100 (v/v) och fläckade Sybr Green/Propidium jodid i 15 min, och 100 µL prov mättes på FL1: 533/30 nm, FL2: 585/40 nm, FL3: > 670 nm långa pass och FL4: 675/25 nm. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: kolonibildande enheter (CFU) vuxit från cellulära skräp i modified BHI plattor. Tre biologiska replikat användes för bakteriell vidhäftning analysen och tre tekniska replikat utfördes för CFU kvantifiering. Två identiska plattor som innehåller -1 till-6 utspädningar av cell skräp (S7) visas i figuren. Klicka här för att se en större version av denna siffra.

Cellkultur Anhängare / fjädring Odling Medium Generella tillägg Särskilda tillägg Fördubbling tid Inkubationsförhållanden
Caco-2 (ECACC 86010202) Anhängare Dulbeccos modifierade Eagle Medium (DMEM) med 4,5 g/L glukos Inaktiverade fetalt bovint serum (10% v/v)
Penicillin (100 U/mL) *
Streptomycin (0,1 mg/mL) *
Amfotericin (0,0025 mg/mL) *
Glutamax (4 mM)
Icke-väsentliga aminosyror (1% v/v)
Pyruvat (1 mM)
65 – 72 h 95% luftfuktighet och 10% CO2
CO2 inkubator (se Tabell för material)
HT29-MTX (ECACC 12040401) Anhängare HEPES (1 mM) 20 – 24 h
* Antibiotika och antimykotika togs bort från cellen kultur media 2 dagar innan du påbörjar analyserna.

Tabell 1: Beskrivning av cell linjer och media sammansättning för cell kultur underhåll.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Den muntliga mikrobiomet är en nyckelfaktor i människors hälsa som nyligen rapporterats av flera författare20,21. Tidigare fynd tyder på att intag av saliv som innehåller stora laster av bakterier kan påverka den mikrobiella ekosystemen av tunntarmen, som är en av de viktigaste platserna för immun priming. Kombinationen av en statisk övre gastrointestinala matsmältningen modell med värd gränssnittet representeras av intestinal epitel och slem som utsöndrar celler, serveras nysta effekterna av komponenten mikrobiell på värden.

In vitro -modeller är grundläggande verktyg för forskning, vilket möjliggör bedriver mekanistiska studier och att uppnå bakgrundskunskap som syftar till att minska, göra effektivare och bättre mål in-vivo studier. Därför är det viktigt att säkerställa renhet, livskraft och optimal tillväxt av axenic kulturer innan syntetiska mikrobiell gemenskapen. Vi rekommenderar att utvärdera genomförbarheten och sammansättningen av bakteriesamhällen före exponering för cellkulturer, att undvika bias i analysen. Höga antalet skadade bakterier kan hindra vidhäftningen och ytterligare påverka integriteten för den cell modellen. Dessutom minimerar användningen av trustable strålningskälla cell cell linje felidentifiering, föroreningar och dålig annotering, förbättra experimentell reproducerbarhet22.

Inklusive slem-producerande celler gör det möjligt för likhet till tunntarmen, som slem och muciner ge första försvarslinje av mag-tarmkanalen23. De slemhinnor skiktet är dessutom lämplig för bakteriell kolonisering, möjliggör karakteristisk bilaterala transporter av bakteriell metaboliter. Dessutom ökar simulerade gastrointestinala sjukdomstillstånd vidhäftning av Lactobacillus paracasei stammar Caco-2 och mucin24, stödja relevansen av att införliva matsmältningsprocess i vår modell.

Ytterligare förbättringar i modellen kan införas för att införliva den immuna värd komponenten, som tidigare granskade25. Nuvarande samarbete kultur system av epitelial och immuna celler har dock inte använts för värd-mikrob interaktion-program (t.ex. utvärdering av mat bioaktiva föreningar eller probiotika), vilket kan tyda på att dessa system kan sakna reproducerbarhet25.

Tidigare forskning med Caco-2, HT29-MTX eller samtidig kulturer bedömas adhesionen av probiotiska eller patogena stammar till däggdjursceller26,27. Med enstaka fläckar eller sammanslutningar av några mikroorganismer kan ge en begränsad översikt på värd-mikrob interaktioner, och det är inte representativ för komplexiteten i den mänskliga mag-tarmkanalen. Även användningen av naturliga mikrobiella samhällen kan vara mer representativ för det in-vivo -scenariot, är de svårt att karakterisera och studera. Däremot erbjuder vår metod möjlighet att bedöma flera värd-mikrobinteraktioner, använder en komplex och representativa mikrokosmos. Användningen av en definierad syntetisk mikrobiell gemenskapens möjliggör generering av ett system med minskad komplexitet28. Förändringar i gemenskapen kan vara ett resultat av microenvironmental villkoren inom ramen för individuella experiment. Således kan den mikrobiella komponenten i denna modell enkelt skalas upp eller ned för deconstructing effekterna av miljön som en selektiv kraft. Slutligen, provtagning tillgängligheten garanterar ytterligare karakterisering av funktionell verksamhet både mänskliga celler och associerade mikrobiell gemenskapen.

Under de senaste åren, har nya in vitro- modeller baserat på organoid teknik utvecklats. Organoids är 3D cellkulturer som införliva några av de viktigaste funktionerna i den föreställda primära vävnaden. Även om intestinal organoids är en nära-fysiologiska system för att studera adulta stamceller och vävnader, har sådan modell också vissa begränsningar. Intestinal organoids har begränsad användning i som liknar inflammatoriska svar på infektion eller droger, eftersom de saknar immunceller. Dessutom är organoids heterogena avseende lönsamhet, storlek och form, hindrar fenotyp screening och rendering standardisering komplexa. Trots begränsningen av förevigade cellinjer för in vitro- modellering av friska vävnader, erbjuder användning av välkarakteriserad och stabil cellinjer också fördelar som repeterbarhet, reproducerbarhet och låg kostnad. Dessa fördelar tillåter samtidiga screening av flera villkor, men translationell användning av uppgifterna är kontroversiell. Primära celler kan vara mer representativ för i vivo fysiologi; men de har hög interindividuell variabilitet, kännetecknas inte fullt, är heterogena och har en begränsad tidsperiod. Dessa faktorer är en nackdel för inklusive flera villkor eller replikerar i en analys.

Som kombinerar cellinjer med komplexa mikrobiella samhällen kan representera en utmaning, fokuserade vi på att utveckla en reproducerbar och repeterbara modell med hög flexibilitet och tillämplighet i laboratorier med grundläggande cell utrustning, tills mer representativ modellerar blev tillgängliga och väl karakteriserade. Vi har utvärderat funktionaliteten för olika bakteriella samhällen med dessa multicompartment modeller, exempelvis för att utvärdera probiotiska beteende i övre mag-tarmkanalen och karakterisera xenobiotiska inverkan på gränssnittet gut. Således föreslår vi denna modell som bas för ytterligare analyser med ett brett utbud av probiotika, droger eller mat föreningar, inom ett relevant och definierade i vitro ekosystem.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att avslöja

Acknowledgments

Författarna erkänner tacksamt finansiellt stöd från stiftelsen Flandern forskning till Marta Calatayud Arroyo (CVE postdoktorala gemenskap-12N2815N). Emma Hernandez-Sanabria är postdoktor stöds av Flandern Innovation och entreprenörskap (Agentschap voor Innovatie dörren Wetenschap sv Technologie, IWT).

Materials

Name Company Catalog Number Comments
STRAINS
Aggregatibacter actinomycetemcomitans American Type Culture Collection ATCC 43718
Fusobacterium nucleatum American Type Culture Collection ATCC 10953
Porphyromonas gingivalis American Type Culture Collection ATCC 33277
Prevotella intermedia American Type Culture Collection ATCC 25611
Streptococcus mutans American Type Culture Collection ATCC 25175
Streptococcus sobrinus American Type Culture Collection ATCC 33478
Actinomyces viscosus American Type Culture Collection ATCC 15987
Streptococcus salivarius  TOVE-R
Streptococcus mitis American Type Culture Collection ATCC 49456
Streptococcus sanguinis BCCM/LMG Bacteria Collection LMG 14657
Veillonella parvula Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures DSM 2007
Streptococcus gordonii American Type Culture Collection ATCC 49818
CELL LINES
Caco-2 cells European Collection of Authenticated Cell Cultures 86010202
HT29-MTX cells European Collection of Authenticated Cell Cultures 12040401
REAGENTS AND CONSUMABLES
Brain Heart Infusion (BHI) broth Oxoid CM1135
Blood Agar 2 Oxoid CM0055 Blood Agar medium
Menadione Sigma M9429
Hemin Sigma H9039
5% sterile defibrinated horse blood E&O Laboratories Ltd, P030
InnuPREP PCRpure Kit Analytik Jena 845-KS-5010250 PCR purification kit
Big Dye Applied Biosystems 4337454 Dye for sequencing
ABI Prism BigDye Terminator v3.1 cycle sequencing kit Applied Biosystems 4337456
SYBR Green I Invitrogen S7585
Propidium Iodide Invitrogen P1304MP
T25 culture flasks uncoated, cell-culture treated, vented, sterile VWR 734-2311
Trypsin-EDTA solution Sigma-Aldrich T3924-100ML
Trypan Blue solution
0.4%, liquid, sterile-filtered
Sigma-Aldrich T8154 
PBS Gibco 14190250
DMEM cell culture media, with GlutaMAX and Pyruvate Life technologies 31966-047
Corning Transwell polyester membrane cell culture inserts Sigma-Aldrich CLS3450-24EA
Mucin from porcine stomach Type II   Sigma-Aldrich M2378
Inactivated fetal bovine serum Greiner Bio One 758093
Antibiotic-Antimycotic (100X) Gibco 15240062
Triton X 100 for molecular biology Sigma-Aldrich T8787 
DPBS without calcium, magnesium Gibco 14190-250
Pierce LDH Cytotoxicity Assay Kit Thermo Fisher Scientific 88953
Corning HTS Transwell-24 well, pore size 0.4 µm Corning Costar Corp 3450
Nuclease-free water Serva Electrophoresis 28539010
EQUIPMENT
Neubauer counting chamber improved Carl Roth T729.1
BD Accuri C6 Flow cytometer BD Biosciences 653118
PowerLyzer 24 Homogenizer MoBio 13155
T100 Thermal Cycler BioRad 186-1096
Flush system Custom made -
InnOva 4080 Incubator Shaker New Brunswick Scientific 8261-30-1007 Shaker for 2.10
Memmert CO2 incubator Memmert GmbH & Co. ICO150med
Millicell ERS (Electrical Resistance System) EMD Millipore, Merck KGaA MERS00002
Millipore Milli-Q academic, ultra pure water system Millipore, Merck KGaA -
Shaker (ROCKER 3D basic) IKA 4000000 Shaker for 6.10

DOWNLOAD MATERIALS LIST

References

  1. Sender, R., Fuchs, S., Milo, R. Revised estimates for the number of human and bacteria cells in the body. PLoS Biology. 14, e1002533 (2016).
  2. Kelly, D., King, T., Aminov, R. Importance of microbial colonization of the gut in early life to the development of immunity. Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis. 58-69 (2007).
  3. Aas, J. A., Paster, B. J., Stokes, L. N., Olsen, I., Dewhirst, F. E. Defining the normal bacterial flora of the oral cavity. Journal of Clinical Microbiology. 43, 5721-5732 (2005).
  4. Marsh, P. D., Head, D. A., Devine, D. A. Dental plaque as a biofilm and a microbial community-Implications for treatment. Journal of Oral Biosciences. 57, 185-191 (2015).
  5. Socransky, S. S., Haffajee, A. D., Cugini, M. A., Smith, C., Kent, R. L. Microbial complexes in subgingival plaque. Journal of Clinical Periodontology. 25, 134-144 (1998).
  6. Haffajee, A. D., et al. Subgingival microbiota in healthy, well-maintained elder and periodontitis subjects. Journal of Clinical Periodontology. 25, 346-353 (1998).
  7. Venema, K. Microbial metabolites produced by the colonic microbiota as drivers for immunomodulation in the host. The FASEB Journal. 27, (2013).
  8. Marzorati, M., et al. The HMI (TM) module: A new tool to study the Host-Microbiota Interaction in the human gastrointestinal tract in vitro. BMC Microbiology. 14, 133 (2014).
  9. Tanzer, J. M., Kurasz, A. B., Clive, J. Competitive displacement of mutans streptococci and inhibition of tooth-decay by Streptococcus-Salivarius Tove-R. Infection and Immunity. 48, 44-50 (1985).
  10. Slomka, V., et al. Nutritional stimulation of commensal oral bacteria suppresses pathogens: the prebiotic concept. Journal of Clinical Periodontology. 44, 344-352 (2017).
  11. Hernandez-Sanabria, E., et al. In vitro increased respiratory activity of selected oral bacteria may explain competitive and collaborative interactions in the oral microbiome. Frontiers in Cellular and Infection Microbiology. 7, 235 (2017).
  12. Alvarez, G., Gonzalez, M., Isabal, S., Blanc, V., Leon, R. Method to quantify live and dead cells in multi-species oral biofilm by real-time PCR with propidium monoazide. AMB Express. 3, (2013).
  13. Ehsani, E., et al. Initial evenness determines diversity and cell density dynamics in synthetic microbial ecosystems. Scientific Reports. 8, 340 (2018).
  14. Hernandez-Sanabria, E., et al. Correlation of particular bacterial PCR-denaturing gradient gel electrophoresis patterns with bovine ruminal fermentation parameters and feed efficiency traits. Applied and Environmental Microbiology. 76, 6338-6350 (2010).
  15. Masters, J. R., Stacey, G. N. Changing medium and passaging cell lines. Nature Protocols. 2, 2276-2284 (2007).
  16. Calatayud, M., Velez, D., Devesa, V. Metabolism of inorganic arsenic in intestinal epithelial cell lines. Chemical Research in Toxicology. 25, 2402-2411 (2012).
  17. Minekus, M., et al. A standardised static in vitro digestion method suitable for food - an international consensus. Food & Function. 5, 1113-1124 (2014).
  18. Berney, M., Hammes, F., Bosshard, F., Weilenmann, H. U., Egli, T. Assessment and interpretation of bacterial viability by using the LIVE/DEAD BacLight kit in combination with flow cytometry. Applied and Environmental Microbiology. 73, 3283-3290 (2007).
  19. Props, R., Monsieurs, P., Mysara, M., Clement, L., Boon, N. Measuring the biodiversity of microbial communities by flow cytometry. Methods in Ecology and Evolution. 7, 1376-1385 (2016).
  20. Yamashita, Y., Takeshita, T. The oral microbiome and human health. Journal of Oral Science. 59, 201-206 (2017).
  21. Wade, W. G. The oral microbiome in health and disease. Pharmacological Research. 69, 137-143 (2013).
  22. Yu, M., et al. A resource for cell line authentication, annotation and quality control. Nature. 520, 307 (2015).
  23. Pelaseyed, T., et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunological Reviews. 260, 8-20 (2014).
  24. Bengoa, A. A., et al. Simulated gastrointestinal conditions increase adhesion ability of Lactobacillus paracasei strains isolated from kefir to Caco-2 cells and mucin. Food Research International. 103, 462-467 (2018).
  25. Kleiveland, C. R., et al. The Impact of Food Bioactives on Health: in vitro and ex vivo models. Verhoeckx, K., et al. Springer International Publishing. 197-205 (2015).
  26. Laparra, J. M., Sanz, Y. Comparison of in vitro models to study bacterial adhesion to the intestinal epithelium. Letters in Applied Microbiology. 49, 695-701 (2009).
  27. Gagnon, M., Berner, A. Z., Chervet, N., Chassard, C., Lacroix, C. Comparison of the Caco-2, HT-29 and the mucus-secreting HT29-MTX intestinal cell models to investigate Salmonella adhesion and invasion. Journal of Microbiological Methods. 94, 274-279 (2013).
  28. Großkopf, T., Soyer, O. S. Synthetic microbial communities. Current Opinion in Microbiology. 18, 72-77 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics