Beoordelen van de levensvatbaarheid van een synthetische bacteriële Consortium op de In Vitro -Interface van het Gut-Host-microbe

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Gut host-microbe interacties werden geschat aan de hand van een nieuwe benadering van het combineren van een synthetische mondelinge Gemeenschap, in vitro gastro-intestinale spijsvertering en een model van het epitheel van de dunne darm. Presenteren we een methode die aangepast worden kan voor de beoordeling van de cel invasie van ziekteverwekkers en multispecifieke biofilms, of zelfs om te testen op het overlevingsvermogen van probiotische formuleringen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Calatayud Arroyo, M., Van de Wiele, T., Hernandez-Sanabria, E. Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface. J. Vis. Exp. (137), e57699, doi:10.3791/57699 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Het samenspel tussen host en microbiota heeft al lang erkend en uitgebreid beschreven. De mond is vergelijkbaar met andere delen van het maag-darmkanaal, zoals ingezeten microbiota treedt op en voorkomt dat de kolonisatie door exogene bacteriën. Inderdaad, meer dan 600 soorten bacteriën in de mondholte zijn gevonden, en een enkel individu kan ongeveer 100 verschillende op elk gewenst moment uitvoeren. Mondelinge bacteriën bezitten het vermogen om te voldoen aan de verschillende niches in de mondelinge ecosysteem, dus steeds geïntegreerd binnen de ingezetene microbiële gemeenschappen, en de bevordering van de groei en de overleving. De stroom van bacteriën in de darm tijdens het slikken is echter voorgesteld om het evenwicht van de darmflora verstoord. In feite, verschoven orale toediening van P. gingivalis bacteriële samenstelling in de ileale van de darmflora. We gebruikten een synthetische Gemeenschap als een vereenvoudigde weergave van de natuurlijke orale ecosysteem, ophelderen van het voortbestaan en de levensvatbaarheid van mondelinge bacteriën aan gesimuleerde gastro-intestinale transit voorwaarden onderworpen. Veertien soorten werden geselecteerd, onderworpen aan de in vitro speeksel, maag en intestinale spijsvertering processen en gepresenteerd aan een multicompartment cel model met Caco-2 en HT29-MTX cellen ter simulering van de darm mucosal epitheel. Dit model diende te ontrafelen van de impact van slikte bacteriën op cellen die betrokken zijn bij de enterohepatische circulatie. Met behulp van synthetische gemeenschappen zorgt voor controleerbaarheid en reproduceerbaarheid. Dus, deze methode kan worden aangepast aan het beoordelen van de levensvatbaarheid van pathogenen en latere wijzigingen van de ontsteking-geassocieerde, kolonisatie capaciteit van probiotische mengsels, en uiteindelijk, potentiële bacteriële invloed op het presystemic verkeer.

Introduction

Mensen samenwonen met bacteriën, die aanwezig is op hetzelfde nummer als menselijke cellen1zijn. Vandaar, is het van cruciaal belang belangrijk te verkrijgen van een grondig inzicht in de menselijke microbiome. De mondholte is een unieke omgeving, omdat het is verdeeld in verschillende kleinere habitats, dus met een grote verscheidenheid van bacteriën en biofilms op de verschillende locaties. Wordt een open ecosysteem, kan sommige soorten in de mond worden voorbijgaande bezoekers. Echter, bepaalde micro-organismen koloniseren kort na de geboorte en vorm georganiseerd biofilms2. Deze zijn te vinden in het oppervlak van de tanden boven de gingival spleet, de subgingivale spleet, tong, mucosal oppervlakken en tandheelkundige protheses en vullingen3. Bacteriën kunnen ook aanwezig zoals Floc en planktonische cellen in het lumen van het kanaal van de tand, vermengd met necrotisch pulp weefsel of gesuspendeerd in een vloeibare fase.

Er is een actief, continu cross-talk tussen de cellen van de gastheer en de resident microbiota4. Bacteriën communiceren binnen en tussen soorten, en slechts een klein deel van de natuurlijke kolonisten kan vasthouden aan weefsels, terwijl andere bacteriën aan deze primaire kolonisten hechten. Bijvoorbeeld, is cel-cel binding tussen micro-organismen de sleutel voor mondelinge biofilms te integreren in de secundaire kolonisten, en het bouwen van complexe netwerken van interagerende Microbiële cellen-4. Ongeveer worden 70% van de bacteriële aggregaten in een steekproef van speeksel gevormd door Porphyromonas sp., Streptococcus sp., Prevotella sp., Veillonella sp. en onbekende Bacteroidetes. F. nucleatum is een tussenliggende kolonisator in de subgingivale biofilm en aggregaten met de late kolonisten P. gingivalis, T. denticola, en Tannerella forsythia, die zijn betrokken bij parodontitis5. Streptococcus mitis neemt bovendien zowel mucosal en tandheelkundige habitats, terwijl S. sanguinis en S. gordonii verkiezen te koloniseren tanden3. Dus is, S. sanguinis aanwezig in de onderste snijtanden en hoektanden, terwijl Actinomyces naeslundii heeft gevonden in de bovenste Anteriores6.

Bovendien, speelt de inheemse microbiome een rol bij het handhaven van de gezondheid van de mens2. Resident microbiota participeert in immuun onderwijs en bij het voorkomen van pathogen expansie. Deze kolonisatie resistentie doet zich voor omdat de inheemse bacteriën beter worden kunnen aangepast bij het aansluiten van oppervlakken en efficiënter op de metabolising van de beschikbare voedingsstoffen voor groei. Hoewel probiotische stammen de gastro-intestinale passage overleven en actief te blijven, is de persistentie van autochtone bacteriën opname door de mond van een bovenste locatie van het maag-darmstelsel niet volledig beschreven. Dus, we een kunstmatige Gemeenschap, vertegenwoordiger van het mondelinge ecosysteem, aan gesimuleerde gastro-intestinale transit voorwaarden onderworpen. Levensvatbaarheid van bacteriële cellen werd beoordeeld met behulp van een multicompartment model dat lijkt op het epitheel van de darm. Huidige gut simulatoren bieden geschikte reproduceerbaarheid in termen van analyse van de luminal van de microbiële Gemeenschap7. Echter, bacteriële hechting- en gastheer-microbe interactie worden afzonderlijk behandeld, zoals cellijnen combineren met microbiële gemeenschappen is uitdagend8. In tegenstelling, presenteren we een kader waarmee potentiële mechanistische uitleg van succesvolle kolonisatie gebeurtenissen gemeld op de gut-interface. Inderdaad, dit model kan worden samen gebruikt met een statische gut-model om te evalueren van het effect van microbiële gemeenschappen op host oppervlakte signalering.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. de stammen en cultuur voorwaarden

Opmerking: De synthetische mondelinge Gemeenschap werd gecomponeerd door spanningen in de mondelinge microbiome3algemeen aanwezig.

  1. Verkrijgen van de volgende stammen uit de Amerikaanse Type Culture Collection (ATCC): Actinobacillus actinomycetemcomitans (ATCC 43718), Fusobacterium nucleatum (ATCC 10953), Porphyromonas gingivalis (ATCC 33277), Prevotella intermedia (ATCC 25611), Streptococcus mutans (ATCC 25175), Streptococcus sobrinus (ATCC 33478), Actinomyces naeslundii (ATCC 51655), Streptococcus gordonii (ATCC 49818), Actinomyces kruiskruid (ATCC 15987) en Streptococcus mitis (ATCC 49456).
  2. Veillonella parvula van de Leibniz Institute DSMZ-Duits collectie van micro-organismen en de celculturen (DSM 2007), Streptococcus sanguis uit de BCCM/LMG bacteriën collectie (LMG 14657) verwerven en gebruiken Streptococcus salivarius stam TOVE-R9, en Streptococcus oralis10.

2. ontwikkeling van een diepteverschillen Gemeenschap vertegenwoordiger van de mondelinge Microbiome

Opmerking: Het genereren van een synthetische Gemeenschap ter simulering van de potentiële capaciteit van de hechting van mondelinge bacteriën aan de darm in vitro epitheel. Groeien bacteriën op bloed agar platen aangevuld met 5 μg/mL Hemine 1 μg/mL menadione en 5% steriele defibrinated paard bloed, zoals beschreven in Hernandez-Sanabria et al. (2017) 11. In het kort:

  1. Los 100 mg Hemine in 2 mL zuiver 1 M NaOH, voeg 100 mL gedestilleerd gesteriliseerde met autoclaaf water. Bewaar in een donkere container. Steriliseren door een 0,22 µm filter alvorens toe te voegen aan medium.
  2. Los 100 mg menadione in 20 mL ethanol 96%. Steriliseren door een 0,22 µm filter alvorens toe te voegen aan medium.
  3. Bereiden 1 L van bloed agar medium (Zie Tabel van materialen) volgens de instructies van de fabrikant en de autoclaaf. Laat koel neer voordat het paard bloed en de supplementen toe te voegen. Meng en giet de platen.
  4. Bereiden gemodificeerde hersenen hart infusie (BHI) Bouillon als eerder gemeld12. Voeg 5 μg/mL Hemine en 1 μg/mL menadione na autoclaaf.
  5. Afzien van 9 mL van het medium in Hungate buizen en sluit met een rubberstop en een aluminium dop. Spoel de buizen met N2/CO2 (90% / 10%).
  6. 1 mL van anaërobe medium ophalen met een injectiespuit en plaats deze in een tube van 1,5 mL microcentrifuge. Kies enkele kolonies van elke bacteriesoorten, resuspendeer in het medium, en breng terug in de anaërobe gemodificeerde BHI. Incubeer gedurende 48 uur bij 37 ° C, met uitzondering van S. salivarius, die moet worden geïncubeerd gedurende 24 uur.
  7. Indien nodig, zuiverheid van de culturen vóór het monteren van de synthetische Gemeenschap bevestigen. In het kort:
    1. Uittreksel van DNA uit de vloeibare culturen zoals Hernandez-Sanabria et al. (2010) 13 en het versterken van het 16S rRNA gen gebruikend de inleidingen 27F (AGAGTTTGATYMTGGCTCAG) en 1492R (TACGGYTACCTTGTTACGACT), en het volgende programma: 5 minuten bij 95 ° C, 30 cycli van 95 ° C gedurende 1 min., 55 ° C voor 1 min en 72 ° C gedurende 1,5 min, gevolgd door een definitieve verlenging stap van 5 minuten bij 72 ° C.
    2. Zuiveren van het PCR-product met een commerciële kit (Zie Tabel of Materials), volgens de instructies van de fabrikant.
    3. De reactie van de volgorde van de gezuiverde producten uitvoeren in een totaal volume van 10 μL met 0,5 μL van kleurstof (Zie Tabel of Materials), 3.2 pmol M13f primer (CGCCAGGGTTTTCCCAGTCACGAC), 2.0 μL van 5 x de volgorde buffer en 20 ng van sjabloon, met behulp van een commerciële rangschikkend systeem met kit (Zie Tabel van materialen).
      Opmerking: We hadden deze procedure commercieel uitgevoerd.
    4. Een zoekopdracht BLAST over alle van de sequenties (http://blast.ncbi.nlm.nih.gov/Blast.cgi) om te bepalen van de dichtstbijzijnde bekend taxon en vergelijken met de volgorde van de oorspronkelijke stam met behulp van de classificatie van de RDP-online tool (http://rdp.cme.msu.edu/) en de SINA Uitlijning service (https://www.arb-silva.de/aligner/).
  8. Het nummer van de cel aan het eind van de incubatie, met stroom cytometry en SYBR groen/Propidium jodide vlek zoals beschreven in Hernandez-Sanabria et al. meten (2017) 11. Verdun de culturen tot 105 cellen mL-1, met behulp van BHI bewerkt.
  9. Voeg 1 mL S. mitis in 75 mL anaërobe BHI en incubeer tot de stationaire fase (6 h). Na, verzamelen 0,75 mL elke verdunde stam en meng onder anaërobe omstandigheden.
  10. Zodra alle culturen zijn gemengd, neem 1 mL van de microkosmos, en toevoegen aan de 75 mL van BHI. Incubeer de synthetische Gemeenschap onder 10% CO2, 10% H2, 80% N2 gedurende 48 uur bij 37 ° C en 200 rpm (Zie Tabel van materialen).
  11. De celdichtheid van maatregel zoals in 2.8. vóór de presentatie van de Gemeenschap aan de cel model. Samenstelling van de Gemeenschap kan worden beoordeeld met kwantitatieve Real-Time PCR, met behulp van de inleidingen en temperaturen in tabel 1 van Slomka et al. gloeien (2017) 10. Bovendien 16S rRNA gene amplicon sequencing gebruiken om informatie te verstrekken over de oorspronkelijke leden aanwezig13,14. Voor beide bevestiging van identiteit protocol, cDNA als sjabloon gebruiken om aan te geven van de bacteriën actief het transcriberen van eiwitten en DNA gebruiken als een sjabloon te onthullen van de aanwezigheid/afwezigheid van de stammen.

3. algemene celkweek praktijken

Opmerking: Voor algemene aspecten van de cultuur van de cel, de auteurs verwijzen naar meester en Stacey (2007),15. Verkrijgen cellijnen gebruikt uit de Europese collectie van geverifieerde celculturen (Caco-2 ECACC 86010202 en HT29-MTX-E12 ECACC 12040401, Public Health England, UK). Reagentia voor cultuur van de cel kunnen worden gekocht (Zie Tabel of Materials), tenzij anders aangegeven.

  1. Onderhouds- en passaging van cellijnen Caco-2 en HT29-MTX
    Opmerking: Caco-2 en HT29-MTX cellen worden routinematig gekweekt in 25 cm2 weefselkweek kolven met aangevuld DMEM medium (tabel 1). Cellen zijn trypsinized bij de samenvloeiing van de 60-70% is bereikt.
    1. Verwijder het kweekmedium cel uit de kolven. Was tweemaal met telkens 5 mL PBS zonder Ca++/Mg++.
    2. Voeg toe 2 mL van een oplossing van 0.5 mg/L van trypsine en 0.22 g/L Dinatriumethyleendiaminetetra-azijnzuuroplossing (NA2EDTA). De trypsine-oplossing distribueren door de erlenmeyer voorzichtig te verplaatsen. Verwijderen van 1,5 mL trypsine-oplossing en de kolf bij 37 ° C gedurende 10 minuten uit te broeden.
    3. Kijk onder de Microscoop als cellen worden losgemaakt van het oppervlak van de kolf. Incubeer gedurende extra 5 min, indien nodig.
    4. Voeg 5 mL aangevuld cel voedingsbodems aan de kolf naar de inactivering van de trypsine. Pipetteer op en neer voor het verkrijgen van een homogene interne celsuspensie.
    5. Onmiddellijk, nemen een 50 µL van de celsuspensie aliquoot en meng met de steriele oplossing van 0,4% Trypan blauw in een verhouding van 1:1 (v/v) voor Caco-2 cellen of 1:5 v/v voor HT29-MTX. Meng door pipetteren en laden in een tellen kamer (Zie Tabel van materialen).
    6. De levensvatbare cellen (wit helder cellen) tellen onder de Microscoop (Zie de instructies van de fabrikant).
    7. Seed in een nieuwe kolf bij een dichtheid van 4 x 105 cellen/cm2 en 1 x 104 cellen/cm2, voor Caco-2 en HT29-MTX, respectievelijk.
      Opmerking: (1) Caco-2 cellen onderscheiden en vormen van strakke kruispunten eenmaal confluentie bereiken. Het is belangrijk om te voorkomen dat over-confluentie vóór trypsinebehandeling. Overmatige groei van cellen in de kolf kan leiden tot storing in cel detachement na trypsinebehandeling en/of cel klontjes. (2) HT29-MTX cellen zijn slijm-producerende cellen met hoge metabole activiteit16. Deze functies kan een snelle verzuring van de cel-cultuur-media, vooral als cellen staan met hoge dichtheid. HEPES-buffer kan worden toegevoegd aan het kweekmedium cel (tabel 1) om de pH-waarde tussen 7 en (7.2). Als de pH druppels, medium kan worden uitgewisseld wanneer confluency is minder dan 50%. Echter, als confluency > 50%, de cultuur van de cel moet worden opgesplitst.

4. assemblage voor een Multicompartment cel Model simuleren van de Interface van de Host-microbe Gut

Opmerking: Voer de co cultuur in dubbele kamer wells (diameter 24 mm, porie grootte 0,4 μm; Zie Tabel van materialen).

  1. 1,5 mL van volledige cel cultuur media aan de apicale compartiment en 2 mL tot de basale toevoegen. Vooraf Incubeer gedurende 20 tot 30 min voor gelijkmatige verdeling van de celsuspensie wanneer zaaien.
  2. Trypsinize de celcultuur van Caco-2 en HT29-MTX zoals beschreven in sectie 3. De procedure trypsinebehandeling moet nauwkeurig worden gevolgd om een homogene verdeling van beide cellijnen, in een enkele cel vering, zonder klontjes.
  3. Levensvatbare cellen tellen zoals beschreven in 3.1.8.
  4. Aanpassen van de celdichtheid tot 6,5 x 104 cellen/cm2 in een 90/10 deel van Caco-2/HT29-MTX cellen.
  5. Meng de cel schorsingen en de overeenkomstige hoeveelheid Caco-2 en HT29-MTX cellen toevoegen aan een vooraf ingevulde steriele container met aangevuld cel voedingsbodems. Verwijder het pre bebroede medium van de apicale zijde van de kamer door aspiratie.
  6. Zachtjes de celsuspensie Meng door pipetteren en 1,5 mL overbrengen in de apicale compartiment van de tussenvoegsels van de kamer. De seeding procedure vereist een constante homogenisering van de celsuspensie, zoals cellen de neiging om sediment. Afhankelijk van de ervaring van de gebruiker en de snelheid moet celsuspensie gemengd worden na aflevering 1 – 3 wells.
  7. Platen voorzichtig achteruit en vooruit te verplaatsen en vervolgens naar rechts links naar rechts (5-10 keer) te verkrijgen een zelfs verspreiding van cellen in de put. Overbrengen van incubator en herhaal de beweging van de platen.
  8. Handhaven de co cultuur van Caco-2/HT29-MTX cellen voor 15 dagen, verfrissende apicale en basale compartimenten om de 2 dagen met aangevuld DMEM. Na deze tijd, kan de cel-cultuur-media worden gewijzigd in aangevuld DMEM zonder antibioticum/antimycotic oplossing.
  9. Handhaving van het systeem tot 20 – 21 dagen na zaaien door het vernieuwen van het medium om de 2 dagen.
  10. Meten van de integriteit van de epitheliale barrière voordat de assay, met behulp van een elektrische weerstand systeem (zie tabel of Materials), volgens de instructies van de fabrikant.
    1. Zorgen dat TEER apparatuur volledig is opgeladen (> 24 uur) voordat de metingen.
    2. De TEER apparatuur verbreken op de voeding en de cover met een kunststof autoclaaf zak. Maak een gat in de zak te voeren van de elektrode en sluit aan op de ingang poort van de meter. Spray met 70% ethanol/water (v/v) voordat de invoering van de TEER-apparatuur in de kast van de stroom.
    3. Onderdompelen om te desinfecteren van de elektrode, de elektrode-tips in 70% ethanol/water (v/v) oplossing voor 15 min. toestaan in de lucht droog voor 15 s. spoelen de elektrode in voorverwarmde cel voedingsbodems.
    4. Neem de cellen uit de incubator en cellen om te komen tot kamertemperatuur binnen de stroom kabinet toestaan.
    5. Zorg ervoor dat de meter is losgekoppeld van de lader. Zet de modusschakelaar in ohm en zet de schakelaar aan.
    6. Meet de weerstand van de cel door het onderdompelen van de elektrode met de kortere tip in het invoegen en de langere tip uit de put. Houd de elektrode in een hoek van 90° aan de plaat invoegen.

5. bacteriële overleven In Vitro gastro-intestinale Transit volgendevoorwaarden

Opmerking: Bereiden gesimuleerde spijsvertering vloeistoffen na het protocol van Minekus et al. (2014) 17, met de wijzigingen die hieronder worden beschreven. Maak alle de verdunningen met ultrazuiver water. Alle oplossingen met een filter steriliseren door een 0,22 µm filter en het uitvoeren van de procedure van de spijsvertering onder steriele omstandigheden.

  1. Mondelinge spijsvertering:
    1. Breng 3 mL van de bacteriële Gemeenschap in een steriele tube van 50 mL, meng met 3 mL van de gesimuleerde speeksel vloeistof (SSF), met (in mmol L-1): KCl, 15.1; KH2PO4, 3.7; NaHCO3, 6,8; MgCl2(H2O)6, 0.5, (NH4) CO3, 0,06; HCl, 1.1; CaCl2(H2O)2, 0,75. 75 U/mL van α-amylase uit menselijke speeksel Type IX-A en 2 g/L mucin van varkens maag type II aan de SSF toevoegen.
    2. Incubeer het mengsel gedurende 2 minuten, bij 37 ° C, en 100 rpm. Een 2 mL monster voor DNA-extractie en stroom cytometry kwantificering (S1) verzameld.
  2. Maag spijsvertering:
    1. Voeg 4 mL gesimuleerde maag vloeistof (SGF), met (in mmol L-1): KCl, 6,9; KH2PO4, 0,9; NaHCO3, 25; NaCl, 47.2; MgCl2(H2O)6, 0.1, (NH4) CO3, 0,5; HCl, 15,6; CaCl2(H2O)2, 0,075. Daarnaast bevatte de SGF mucin van varkens maag type II 2 g/L.
    2. Meten van de pH en aan te passen aan pH 3 met 1 M HCl, indien nodig. Incubeer bij 37 ° C en 100 rpm. Een 2 mL monster (S2) verzameld.
  3. Dunne darm de spijsvertering:
    1. Voeg 4 mL gesimuleerde intestinale vloeistof (SIF) met (in mmol L-1): KCl, 6,8; KH2PO4, 0.8; NaHCO3, 85; NaCl, 38,4; MgCl2(H2O)6, 0,33; HCl, 8.4; CaCl2(H2O)2, 0.3; aan de buis van de spijsvertering.
    2. Aangepast aan de pH 7 met 1 M NaOH, indien nodig. Incubeer bij 37 ° C en 100 rpm. Een 2 mL monster (S3) verzameld.

6. bacteriële kolonisatie vermogen In Vitro gastro-intestinale Transit volgendevoorwaarden

  1. 2 mL van de dunne darm spijsvertering, gedurende 10 minuten bij 2,650 x gcentrifugeren.
  2. Verwijder het supernatant en meng de bacteriële pellet met 5 mL aangevuld DMEM zonder antibiotica en antimycotic.
  3. Vlekken en kwantificeren van intact/beschadigde cellen met behulp van een stroom cytometer (Zie Tabel of Materials), zoals beschreven door Hernandez-Sanabria et al. (2017) 11.
  4. De celdichtheid tot 105 levensvatbare cellen/mL aanpassen door verder verdunnen in aangevuld DMEM zonder antibiotica en antimycotic.
  5. Verwijder het apicale medium van het transwell systeem en voeg 1,5 mL van de bacteriële suspensie. Samen cultuur het systeem voor 2U onder algemene cel kweekomstandigheden (37 ° C, luchtvochtigheid van 95%, 5% CO2).
    Opmerking: Deze tijd kan worden verlengd tot 48 uur, afhankelijk van het experimentele protocol vereist. De co cultuur kan worden gehandhaafd in een verschillende incubator dan die is gebruikt voor routinematige cel onderhoud, om te voorkomen dat verontreinigingen.
  6. Meten van het TEER-waarden na incubatie, om te evalueren van de integriteit van de epitheliale barrière, zoals beschreven in 4.11.
  7. Na het voltooien van incubatietijd, verwijder apicale media en verzamelen van 0,5 mL voor verdere analyses (S4). Een deelmonster van media kan worden gebruikt voor de beoordeling van de levensvatbaarheid van de cellen door lactaat Dehydrogenase (LDH) assay (Zie Tabel of Materials), volgens de instructies van de fabrikant.
  8. Voeg 0,5 mL 10 mM N-Acetylcysteïne in HBSS (NAC-buffer) solubilize van het slijm geproduceerd door de HT29-MTX en zelfklevend bacteriën te herstellen. Incubeer de platen bij 37 ° C gedurende 1 uur, onder agitatie (135 rpm, Zie Tabel van materialen).
  9. Herstellen van de NAC-HBSS in een microcentrifuge buis (S5) en tweemaal de cellen met 1 mL DPBS wassen.
  10. Voeg 0,5 mL 0,5% Triton X-100 (m/v) op de top van de monolayers, breek de cellen door pipetteren, herstellen van de vloeistof en de vortex voor 1 min. snelheid is van cruciaal belang om te voorkomen beschadiging van de bacteriële cellen met het wasmiddel.
  11. De cellen gedurende 5 minuten bij 2,650 x gcentrifugeren en scheiden het supernatant (S6) en de pellet (S7).

7. voorbeeld analyse

Opmerking: Verzamelde monsters (S1-S7) te beoordelen van de levensvatbaarheid van de bacteriële en de hechting aan de intestinale cellen, na een gesimuleerde gastro-intestinale spijsvertering potentiële analyseren.

  1. Bacteriële levensvatbaarheid: Pass monsters S1-S5 tweemaal door een 0,45 µm en kwantificeren van bacteriële cellen met behulp van live/dode cel kleuring en stroom cytometry, zoals aangegeven in stap 2.811.
  2. Hechting potentiële: Maak seriële verdunningen (-1 tot -8) voor S1-S6 en strijk 10 µL in bloed agar en bewerkt BHI platen. Incubeer bij 37 ° C onder anaërobe omstandigheden voor 24 – 48 h. plaat dezelfde hoeveelheid onverdund S7.
    1. Taxonomische identificatie van zelfklevend bacteriën:
      1. Kies afzonderlijke kolonies met een lus van de cultuur en resuspendeer elk op 10 µL van nuclease-gratis water. 4 µL van deze opschorting verzamelen en gebruiken als een sjabloon voor PCR versterking van het 16S rRNA gen met behulp van de inleidingen en de voorwaarden beschreven in 2.7.1.
      2. Rangschikken volgens het protocol in 2.7.3, en validatie van de volgorde met behulp van de procedure die is opgenomen in 2.7.4 uitvoeren
  3. Doen verder stroomafwaarts analyse zoals totale DNA-extractie, qPCR kwantificering en/of 16S rRNA amplicon sequencing, RNA extractie en transcriptomic profilering als gewenst.
    Opmerking: Stroom cytometry kwantificering werd uitgevoerd onmiddellijk na de monsterneming. Als een besturingselement voor membraan-permeabel cellen, werd een steekproef blootgesteld tot 70 ° C gedurende 3 minuten gebruikt. Achtergrondgeluiden werd beoordeeld door het meten met stroom cytometry van de spijsvertering vloeistoffen of monsters uit de cel cultuur model zonder bacteriën. Elke sample werd gemeten in drievoud.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dit protocol leidt tot het genereren van een model geschikt is voor het ophelderen van het voortbestaan en de levensvatbaarheid van mondelinge bacteriën aan gesimuleerde gastro-intestinale transit voorwaarden onderworpen. De graven van onbeschadigde cellen uit afzonderlijke stammen is ongeveer 108 cellen mL-1 vóór de oprichting van de synthetische Gemeenschap, terwijl de diepteverschillen microkosmos opgenomen boven de 90% van levensvatbare cellen tijdens de totstandbrenging van de Gemeenschap () Figuur 1A en 1B). Gebaseerd op de Live/Dead kwantificering, vermindert bacteriële levensvatbaarheid na elke stap van de spijsvertering (Figuur 2). Dit kan een resultaat van zure pH in de maag passage en de galzouten opgenomen in de dunne darm spijsvertering vloeistoffen, als die zich voordoen onder fysiologische omstandigheden. Levensvatbaarheid tijdens de doorvoer door zowel in vitro als in vivo gastro-intestinale spijsvertering kan afhangen van variaties in de omgeving (bijvoorbeeld gevoed vs. gevast voorwaarden), of zelfs op processen voor gegevensbescherming van bacteriën (spore vorming of darmen coatings).

Graven van de cytometrische van de stroom moeten worden vergeleken met geschikte besturingselementen, zoals warmte-doden bacteriën of achtergrond monsters, voor het uitvoeren van nauwkeurige levensvatbare cellen kwantificering18. De barre omstandigheden van de maag en dunne darm de spijsvertering kunnen overschakelen van bacteriën naar haalbare maar niet-culturable cellen, die levende bacteriën die niet zijn hetzij groeien of verdelen. Om deze reden is de graven van de plaat afwijken van levensvatbare cellen graven verkregen met stroom cytometry. Bijvoorbeeld, in Figuur 3, zijn levensvatbare cellen hersteld van de mucosal interface gekleurd in het blauw in de stroom cytometry plot. Echter werd geen groei waargenomen toen deze slijm monsters waren vergulde (resultaten niet weergegeven).

De noemer waarop bacteriën Toon hoger levensvatbaarheid tarieven is het cellulaire puin (S7), zoals geopenbaard door plaat tellen (Figuur 4). Het aantal kolonies wellicht variabele, maar aanwezigheid van metabolisch actieve bacteriën wordt aangetroffen in de minder verdunde monsters.

Figure 1
Figuur 1: Levensvatbaarheid van de bacteriën de diepteverschillen microbiële Gemeenschap aan het begin van de gastro-intestinale spijsvertering in vitro componeren van cellen. (A) levensvatbare cellen graven (log-eenheden) gekwantificeerd door de kleuring en stroom cytometry leven/dood (gemiddelde ± standaardafwijking, n = 3). (B) vertegenwoordiger stroom cytometry plot van de diepteverschillen microbiële Gemeenschap na 48u van co cultuur. Stippen in de groene, rode en zwarte vertegenwoordigen levensvatbare, beschadigde en achtergrond of niet-ingedeelde bacteriën, respectievelijk. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: levensvatbaarheid van de bacteriën van cellen na de gesimuleerde gastro-intestinale spijsvertering. Staven het aantal levensvatbare cellen (log-eenheden) na de mondelinge, maag en kleine intestinale spijsvertering stappen (gemiddelde ± standaardafwijking, n = 3). Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: vertegenwoordiger plot van levensvatbare bacteriële cellen in de interfase mucosal. Rode stippen vormen de achtergrond en blauwe stippen de levensvatbare cellen. Stroom cytometry voorwaarden werden vastgesteld op basis van Props et al. (2016) 19. mucosal monsters werden verdunde 1:100 (v/v) en gekleurd met Sybr groen/Propidium jodide gedurende 15 minuten en 100 µL van monster werd gemeten op FL1: 533/30 nm, FL2: 585/40 nm, FL3: > 670 nm lange pass en FL4: 675/25 nm. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: kolonievormende eenheden (kve) gegroeid van de cellulaire puin in bewerkt BHI platen. Drie biologische replicatieonderzoeken werden gebruikt voor de bepaling van het bacteriële hechting en drie technische replicatieonderzoeken werden uitgevoerd voor de kwantificering van de CFU. Twee repliceren platen met -1 tot-6 verdunningen van het puin van de cel (S7) worden weergegeven in de afbeelding. Klik hier voor een grotere versie van dit cijfer.

Celcultuur Aanhanger / opschorting Kweken van Medium Algemene aanvullingen Specifieke supplementen Verdubbeling van de tijd Incubatieomstandigheden
CaCO-2 (ECACC 86010202) Aanhanger Dulbecco van bewerkt Eagle Medium (DMEM) met 4,5 g/L glucose Geïnactiveerd foetale runderserum (10% v/v)
Penicilline (100 U/mL) *
Streptomycine (0,1 mg/mL) *
Amfotericine (0.0025 mg/mL) *
Glutamax (4 mM)
Niet-essentiële aminozuren (1% v/v)
Pyruvaat (1 mM)
65 – 72 h 95% vochtigheid en 10% CO2
CO2 incubator (Zie Tabel van materialen)
HT29-MTX (ECACC 12040401) Aanhanger HEPES (1 mM) 20 – 24 h
* Antibiotica en antischimmelmiddelen werden verwijderd uit de cel voedingsbodems 2 dagen voordat de tests.

Tabel 1: Beschrijving van de cel lijnen en media samenstelling voor cel cultuur onderhoud.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

De mondelinge microbiome is een sleutelelement in de gezondheid van de mens, zoals onlangs gerapporteerd door diverse auteurs20,21. Eerdere bevindingen suggereren dat de inname van speeksel met grote ladingen van bacteriën het microbiële ecosysteem van de dunne darm, die tot de belangrijkste sites voor immuun priming behoort kan beïnvloeden. De combinatie van een statische bovenste gastro-intestinale spijsvertering model met de host-interface vertegenwoordigd door intestinale epitheliale en slijm-afscheidende cellen, diende te ontrafelen van de impact van de microbiële component op de host.

In vitro modellen zijn fundamentele instrumenten voor onderzoek, waardoor mechanistisch orkestdirectie en het bereiken van de achtergrondkennis te verminderen, efficiënter en beter doel in vivo studies maken. Om deze reden is het essentieel om zuiverheid, levensvatbaarheid en optimale groei van een culturen voorafgaand aan de synthetische microbiële Gemeenschap. Het is raadzaam om de evaluatie van de levensvatbaarheid en de samenstelling van bacteriële Gemeenschappen vóór de blootstelling aan celculturen, om te voorkomen dat vooringenomenheid in de analyse. Hoge aantal beschadigde bacteriën kan een belemmering vormen voor de hechting en verdere invloed op de integriteit van de cell model. Bovendien zal het gebruik van een betrouwbare bron van cellijnen cel lijn onjuiste, verontreiniging en arme aantekening, verbetering van de experimentele reproduceerbaarheid22minimaliseren.

Met inbegrip van slijm-producerende cellen kan gelijkenis met de dunne darm, zoals slijm en mucinen de eerste verdedigingslinie van de gastro-intestinale tractus23 bieden. De mucosal laag is bovendien geschikt voor bacteriële kolonisatie, waardoor voor karakteriseren bilaterale vervoer van bacteriële metabolieten. Bovendien, gesimuleerde gastro-intestinale voorwaarden verhogen het vermogen van de hechting van Lactobacillus paracasei stammen tot Caco-2 en mucin24, ter ondersteuning van de relevantie van het opnemen van assimilatieproces in ons model.

Verdere verbeteringen in het model kunnen worden ingevoerd om op te nemen van de immuun hostcomponent, als eerder gerecenseerd25. Echter, huidige co cultuur systemen van epitheliale en immuun cellen niet zijn gebruikt voor host-microbe interactie toepassingen (bijv . evaluatie van voedsel bioactieve stoffen of probiotica), die erop wijzen kunnen dat deze systemen mag ontbreken reproduceerbaarheid25.

Eerder onderzoek met Caco-2, HT29-MTX of co culturen beoordeeld de hechting van probiotische of pathogene stammen op zoogdiercellen26,27. Met behulp van enkele vlekken of verenigingen van enkele micro-organismen kunnen een beperkt overzicht verschaffen op de host-microbe interacties, en het is niet representatief voor de complexiteit van de menselijke maag-darmkanaal. Hoewel het gebruik van natuurlijke microbiële gemeenschappen kan meer representatief is voor het scenario in vivo , zijn ze moeilijk te karakteriseren en te bestuderen. In tegenstelling, biedt onze methodologie de mogelijkheid om meerdere host-microbe interacties, met behulp van een complexe en representatieve microkosmos te beoordelen. Het gebruik van een gedefinieerde synthetische microbiële Gemeenschap zorgt voor de generatie van een systeem met verminderde complexiteit28. Veranderingen in de Gemeenschap kunnen worden een gevolg van de microenvironmental voorwaarden in het kader van individuele experimenten. Dus, de microbiële component van dit model kan worden gemakkelijk geschaald omhoog of omlaag voor het deconstrueren van de effecten van milieu als een selectieve kracht. Tot slot garandeert bemonstering toegankelijkheid verdere karakterisering van de functionele activiteiten van zowel menselijke cellen en de bijbehorende microbiële Gemeenschap.

In de afgelopen jaren zijn er nieuwe in vitro modellen gebaseerd op organoid technologie ontwikkeld. Organoids zijn 3D celculturen dat enkele van de belangrijkste functies van het vertegenwoordigde primaire weefsel nemen. Hoewel intestinale organoids een in de buurt van de fysiologische systeem zijn voor het bestuderen van adulte stamcellen en weefsels, heeft dergelijk model ook enkele beperkingen. Intestinale organoids hebben beperkt gebruik in lijkend op inflammatoire reacties op infectie of drugs, zijn ze niet van immuuncellen. Daarnaast zijn de organoids met betrekking tot de levensvatbaarheid, de grootte en vorm, belemmeren fenotype screening en renderen van normalisatie complexe heterogene. Ondanks de beperking van vereeuwigd cellijnen voor in vitro modellering van gezond weefsel, biedt het gebruik van goed gekarakteriseerd en stabiele cellijnen ook voordelen zoals lage kosten, herhaalbaarheid en reproduceerbaarheid. Deze voordelen zorgen voor gelijktijdige screening van verschillende omstandigheden, maar de translationeel gebruik van de gegevens is controversieel. Primaire cellen mogelijk meer vertegenwoordiger van in vivo fysiologie; zij hebben hoge Inter individuele variabiliteit, zijn niet volledig gekenmerkt, zijn echter heterogeen, en hebben een beperkte tijdspanne. Deze factoren zijn een nadeel voor het opnemen van meerdere voorwaarden of worden gerepliceerd in een test.

Aangezien cellijnen combineren met complexe microbiële gemeenschappen een uitdaging vertegenwoordigen kan, wij gericht op de ontwikkeling van een reproduceerbare en herhaalbare model met hoge flexibiliteit en toepasbaarheid in laboratoria met fundamentele cel apparatuur, tot meer representatief modellen werd beschikbaar en goed gekarakteriseerd. We hebben de functionaliteit van bacteriële cultuurgemeenschappen met behulp van deze multicompartment modellen, bijvoorbeeld voor het evalueren van probiotische gedrag in de bovenste gastro-intestinale tractus en karakteriseren xenobiotische effect op de darm interface geëvalueerd. Dus, stellen wij dit model als basis voor verdere tests met een breed scala aan probiotica, drugs of voedsel verbindingen, binnen een ecosysteem relevante en omschreven in vitro .

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen

Acknowledgments

De auteurs mijn dankbaarheid uitspreken voor financiële steun van de Flanders Research Foundation aan Marta Calatayud Arroyo (FWO postdoctoral fellowship-12N2815N). Emma Hernandez-Sanabria is een postdoctoraal ondersteund door Vlaanderen innovatie en ondernemerschap (Agentschap voor Innovatie door Wetenschap en Technologie, IWT).

Materials

Name Company Catalog Number Comments
STRAINS
Aggregatibacter actinomycetemcomitans American Type Culture Collection ATCC 43718
Fusobacterium nucleatum American Type Culture Collection ATCC 10953
Porphyromonas gingivalis American Type Culture Collection ATCC 33277
Prevotella intermedia American Type Culture Collection ATCC 25611
Streptococcus mutans American Type Culture Collection ATCC 25175
Streptococcus sobrinus American Type Culture Collection ATCC 33478
Actinomyces viscosus American Type Culture Collection ATCC 15987
Streptococcus salivarius  TOVE-R
Streptococcus mitis American Type Culture Collection ATCC 49456
Streptococcus sanguinis BCCM/LMG Bacteria Collection LMG 14657
Veillonella parvula Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures DSM 2007
Streptococcus gordonii American Type Culture Collection ATCC 49818
CELL LINES
Caco-2 cells European Collection of Authenticated Cell Cultures 86010202
HT29-MTX cells European Collection of Authenticated Cell Cultures 12040401
REAGENTS AND CONSUMABLES
Brain Heart Infusion (BHI) broth Oxoid CM1135
Blood Agar 2 Oxoid CM0055 Blood Agar medium
Menadione Sigma M9429
Hemin Sigma H9039
5% sterile defibrinated horse blood E&O Laboratories Ltd, P030
InnuPREP PCRpure Kit Analytik Jena 845-KS-5010250 PCR purification kit
Big Dye Applied Biosystems 4337454 Dye for sequencing
ABI Prism BigDye Terminator v3.1 cycle sequencing kit Applied Biosystems 4337456
SYBR Green I Invitrogen S7585
Propidium Iodide Invitrogen P1304MP
T25 culture flasks uncoated, cell-culture treated, vented, sterile VWR 734-2311
Trypsin-EDTA solution Sigma-Aldrich T3924-100ML
Trypan Blue solution
0.4%, liquid, sterile-filtered
Sigma-Aldrich T8154 
PBS Gibco 14190250
DMEM cell culture media, with GlutaMAX and Pyruvate Life technologies 31966-047
Corning Transwell polyester membrane cell culture inserts Sigma-Aldrich CLS3450-24EA
Mucin from porcine stomach Type II   Sigma-Aldrich M2378
Inactivated fetal bovine serum Greiner Bio One 758093
Antibiotic-Antimycotic (100X) Gibco 15240062
Triton X 100 for molecular biology Sigma-Aldrich T8787 
DPBS without calcium, magnesium Gibco 14190-250
Pierce LDH Cytotoxicity Assay Kit Thermo Fisher Scientific 88953
Corning HTS Transwell-24 well, pore size 0.4 µm Corning Costar Corp 3450
Nuclease-free water Serva Electrophoresis 28539010
EQUIPMENT
Neubauer counting chamber improved Carl Roth T729.1
BD Accuri C6 Flow cytometer BD Biosciences 653118
PowerLyzer 24 Homogenizer MoBio 13155
T100 Thermal Cycler BioRad 186-1096
Flush system Custom made -
InnOva 4080 Incubator Shaker New Brunswick Scientific 8261-30-1007 Shaker for 2.10
Memmert CO2 incubator Memmert GmbH & Co. ICO150med
Millicell ERS (Electrical Resistance System) EMD Millipore, Merck KGaA MERS00002
Millipore Milli-Q academic, ultra pure water system Millipore, Merck KGaA -
Shaker (ROCKER 3D basic) IKA 4000000 Shaker for 6.10

DOWNLOAD MATERIALS LIST

References

  1. Sender, R., Fuchs, S., Milo, R. Revised estimates for the number of human and bacteria cells in the body. PLoS Biology. 14, e1002533 (2016).
  2. Kelly, D., King, T., Aminov, R. Importance of microbial colonization of the gut in early life to the development of immunity. Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis. 58-69 (2007).
  3. Aas, J. A., Paster, B. J., Stokes, L. N., Olsen, I., Dewhirst, F. E. Defining the normal bacterial flora of the oral cavity. Journal of Clinical Microbiology. 43, 5721-5732 (2005).
  4. Marsh, P. D., Head, D. A., Devine, D. A. Dental plaque as a biofilm and a microbial community-Implications for treatment. Journal of Oral Biosciences. 57, 185-191 (2015).
  5. Socransky, S. S., Haffajee, A. D., Cugini, M. A., Smith, C., Kent, R. L. Microbial complexes in subgingival plaque. Journal of Clinical Periodontology. 25, 134-144 (1998).
  6. Haffajee, A. D., et al. Subgingival microbiota in healthy, well-maintained elder and periodontitis subjects. Journal of Clinical Periodontology. 25, 346-353 (1998).
  7. Venema, K. Microbial metabolites produced by the colonic microbiota as drivers for immunomodulation in the host. The FASEB Journal. 27, (2013).
  8. Marzorati, M., et al. The HMI (TM) module: A new tool to study the Host-Microbiota Interaction in the human gastrointestinal tract in vitro. BMC Microbiology. 14, 133 (2014).
  9. Tanzer, J. M., Kurasz, A. B., Clive, J. Competitive displacement of mutans streptococci and inhibition of tooth-decay by Streptococcus-Salivarius Tove-R. Infection and Immunity. 48, 44-50 (1985).
  10. Slomka, V., et al. Nutritional stimulation of commensal oral bacteria suppresses pathogens: the prebiotic concept. Journal of Clinical Periodontology. 44, 344-352 (2017).
  11. Hernandez-Sanabria, E., et al. In vitro increased respiratory activity of selected oral bacteria may explain competitive and collaborative interactions in the oral microbiome. Frontiers in Cellular and Infection Microbiology. 7, 235 (2017).
  12. Alvarez, G., Gonzalez, M., Isabal, S., Blanc, V., Leon, R. Method to quantify live and dead cells in multi-species oral biofilm by real-time PCR with propidium monoazide. AMB Express. 3, (2013).
  13. Ehsani, E., et al. Initial evenness determines diversity and cell density dynamics in synthetic microbial ecosystems. Scientific Reports. 8, 340 (2018).
  14. Hernandez-Sanabria, E., et al. Correlation of particular bacterial PCR-denaturing gradient gel electrophoresis patterns with bovine ruminal fermentation parameters and feed efficiency traits. Applied and Environmental Microbiology. 76, 6338-6350 (2010).
  15. Masters, J. R., Stacey, G. N. Changing medium and passaging cell lines. Nature Protocols. 2, 2276-2284 (2007).
  16. Calatayud, M., Velez, D., Devesa, V. Metabolism of inorganic arsenic in intestinal epithelial cell lines. Chemical Research in Toxicology. 25, 2402-2411 (2012).
  17. Minekus, M., et al. A standardised static in vitro digestion method suitable for food - an international consensus. Food & Function. 5, 1113-1124 (2014).
  18. Berney, M., Hammes, F., Bosshard, F., Weilenmann, H. U., Egli, T. Assessment and interpretation of bacterial viability by using the LIVE/DEAD BacLight kit in combination with flow cytometry. Applied and Environmental Microbiology. 73, 3283-3290 (2007).
  19. Props, R., Monsieurs, P., Mysara, M., Clement, L., Boon, N. Measuring the biodiversity of microbial communities by flow cytometry. Methods in Ecology and Evolution. 7, 1376-1385 (2016).
  20. Yamashita, Y., Takeshita, T. The oral microbiome and human health. Journal of Oral Science. 59, 201-206 (2017).
  21. Wade, W. G. The oral microbiome in health and disease. Pharmacological Research. 69, 137-143 (2013).
  22. Yu, M., et al. A resource for cell line authentication, annotation and quality control. Nature. 520, 307 (2015).
  23. Pelaseyed, T., et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunological Reviews. 260, 8-20 (2014).
  24. Bengoa, A. A., et al. Simulated gastrointestinal conditions increase adhesion ability of Lactobacillus paracasei strains isolated from kefir to Caco-2 cells and mucin. Food Research International. 103, 462-467 (2018).
  25. Kleiveland, C. R., et al. The Impact of Food Bioactives on Health: in vitro and ex vivo models. Verhoeckx, K., et al. Springer International Publishing. 197-205 (2015).
  26. Laparra, J. M., Sanz, Y. Comparison of in vitro models to study bacterial adhesion to the intestinal epithelium. Letters in Applied Microbiology. 49, 695-701 (2009).
  27. Gagnon, M., Berner, A. Z., Chervet, N., Chassard, C., Lacroix, C. Comparison of the Caco-2, HT-29 and the mucus-secreting HT29-MTX intestinal cell models to investigate Salmonella adhesion and invasion. Journal of Microbiological Methods. 94, 274-279 (2013).
  28. Großkopf, T., Soyer, O. S. Synthetic microbial communities. Current Opinion in Microbiology. 18, 72-77 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics