Évaluation de la viabilité d’un Consortium bactérien synthétique sur l’Interface hôte-microbe In Vitro Gut

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Interactions hôtes-microorganismes gut ont été évaluées à l’aide d’une nouvelle approche combinant une communauté orale synthétique, in vitro digestion gastro-intestinale et un modèle de l’épithélium de l’intestin grêle. Nous présentons une méthode qui peut être adaptée pour évaluer l’invasion des cellules des agents pathogènes et des biofilms multi-espèces, ou même de tester la capacité de survie des probiotiques formulations.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Calatayud Arroyo, M., Van de Wiele, T., Hernandez-Sanabria, E. Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface. J. Vis. Exp. (137), e57699, doi:10.3791/57699 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

L’interaction entre l’hôte et de la flore microbienne a été reconnue depuis longtemps et largement décrite. La bouche est semblable à d’autres sections du tractus gastro-intestinal, comme résident microbiote se produit et empêche la colonisation par des bactéries exogènes. En effet, plus de 600 espèces de bactéries sont trouvent dans la cavité buccale, et une seule personne peut transporter environ 100 différents à tout moment. Bactéries orales possèdent la capacité de respecter les divers créneaux dans l’écosystème par voie orale, donc s’intégrer dans les communautés microbiennes et qui favorise la croissance et la survie. Cependant, le débit des bactéries dans l’intestin lors de la déglutition a proposé à perturber l’équilibre de la microflore intestinale. En fait, l’administration orale de P. gingivalis décalé la composition bactérienne de la microflore iléale. Nous avons utilisé une communauté synthétique comme une représentation simplifiée de l’écosystème naturel par voie orale, pour élucider la survie et la viabilité des bactéries orales soumises à des conditions de transit gastrointestinal simulée. Quatorze espèces ont été sélectionnés, soumis à in vitro salivaires, gastriques et les processus de la digestion intestinale et présentés à un modèle de cellule compartiments contenant des cellules Caco-2 et HT29-MTX pour simuler l’épithélium muqueux du tube digestif. Ce modèle a servi à éclaircir l’impact des bactéries avalés sur cellules impliquées dans la circulation entéro-hépatique. À l’aide des communautés synthétiques permet de contrôlabilité et reproductibilité. Ainsi, cette méthode peut être adaptée pour évaluer la viabilité de l’agent pathogène et les changements ultérieurs associée à l’inflammation, la capacité de colonisation des mélanges de probiotiques, et en fin de compte, bactérien potentiel impact sur la circulation presystemic.

Introduction

Les êtres humains cohabitent avec des bactéries qui sont présentes sur le même nombre que les cellules humaines1. Donc, il importe de crucial afin d’obtenir une compréhension globale du microbiome humain. La cavité buccale est un environnement unique, car il est divisé en plusieurs petits habitats, donc contenant une grande variété de bactéries et de biofilms dans ces différents endroits. Étant un écosystème ouvert, certaines espèces dans la bouche peut être transitoires visiteurs. Toutefois, certains micro-organismes colonisent peu après que la naissance et la forme organisée de biofilms2. Ceux-ci sont présents dans la surface des dents au-dessus de la crevasse gingivale, la crevasse sous-gingival, muqueuses et prothèses dentaires et de garnitures3. Les bactéries peuvent également être présents comme les flocons et les cellules planctoniques dans la lumière du canal dentaire, soit mélangés entre eux avec tissu de pulpe nécrotique ou en suspension dans une phase fluide.

Il est active et continue la diaphonie entre les cellules de l’hôte et la microflore résidente4. Les bactéries communiquent au sein et entre les espèces, et seule une faible proportion des colonisateurs naturels peut adhérer aux tissus, tandis que les autres bactéries attachent à ces colonisateurs primaires. Par exemple, liaison de cellules entre micro-organismes est la clé pour intégrer les colonisateurs secondaires biofilms par voie orale et construction de réseaux complexes d’interaction des cellules microbiennes4. Environ 70 % des agrégats bactériens dans un échantillon de salive sont formés par Porphyromonas SP., Streptococcus SP., Prevotella SP., Veillonella SP. et non identifiés Bacteroidetes. F. nucleatum est un colonisateur intermédiaire dans le biofilm sous-gingival et agrégats avec les colonisateurs fin P. gingivalis, T. denticola et Tannerella forsythia, qui sont impliqués dans la parodontite5. En outre, Streptococcus mitis occupe les habitats les muqueuses et dentaires, tandis que S. sanguinis et S. gordonii préfèrent à coloniser les dents3. Ainsi, S. sanguinis est présente dans moins incisives et canines, Actinomyces naeslundii a retrouvé en dents antérieures supérieures6.

En outre, le microbiome autochtone joue un rôle dans le maintien de la santé humaine2. Microbiote résident participe à l’éducation immunitaire et pour prévenir l’expansion de l’agent pathogène. Cette résistance de colonisation se produit parce que les bactéries indigènes peuvent être mieux adaptés à attacher aux surfaces et plus efficace à la métabolisation des nutriments disponibles pour la croissance. Bien que les souches probiotiques survivent le passage gastro-intestinal et restent actives, la persistance de bactéries autochtones avalé d’une situation supérieure du tube digestif n’a pas été entièrement décrit. Ainsi, nous avons soumis une communauté artificielle, représentant de l’écosystème par voie orale, aux conditions du transit gastro-intestinal simulée. La viabilité des cellules bactériennes a été évaluée en utilisant un modèle de compartiments ressemblant à l’épithélium du tube digestif. Simulateurs de gut actuel offrent reproductibilité adaptée en termes d’analyse de la communauté microbienne luminale7. Cependant, adhérence bactérienne et l’interaction hôte-microbe séparément s’adressent, comme la combinaison de lignées cellulaires avec des communautés microbiennes est difficile8. En revanche, nous présentons un cadre qui fournit une explication mécaniste potentielle de colonisation réussie rapportées sur l’interface de l’intestin. En effet, ce modèle peut être utilisé conjointement avec un modèle statique gut pour évaluer l’impact des communautés microbiennes sur signalisation surface hôte.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. les souches et les Conditions de la Culture

Remarque : La communauté orale synthétique a été composée par souches communément présents dans le microbiome oral3.

  1. Obtenir les souches suivantes de l’American Type Culture Collection (ATCC) : Aggregatibacter actinomycetemcomitans (ATCC 43718), Fusobacterium nucleatum (ATCC 10953), Porphyromonas gingivalis (ATCC 33277), Prevotella intermedia (ATCC 25611), Streptococcus mutans (ATCC 25175), Streptococcus sobrinus (ATCC 33478), Actinomyces naeslundii (ATCC 51655) Streptococcus gordonii (ATCC 49818), Actinomyces viscosus (ATCC 15987) et Streptococcus mitis (ATCC 49456).
  2. Acquérir Veillonella parvula du Leibniz Institute DSMZ-allemand Collection de micro-organismes et Cultures cellulaires (DSM 2007), Streptococcus sanguinis de la Collection de bactéries BCCM/LMG (LMG 14657) et d’utiliser Streptococcus salivarius souche TOVE-R9et Streptococcus oralis10.

2. développement d’un représentant communautaire multispécifique du Microbiome Oral

NOTE : Générer une communauté synthétique afin de simuler la capacité potentielle de l’adhérence des bactéries orales à l’épithélium du tube digestif en vitro . Cultiver des bactéries sur des géloses au sang additionnés de 5 hémine μg/mL, 1 ménadione μg/mL et défibriné stérile 5 % de sang de cheval, comme décrit dans Hernandez-Sanabria et al. (2017) 11. en bref :

  1. Dissoudre 100 mg d’hémine dans 2 mL de 1 NaOH M, ajouter 100 mL d’eau distillée d’autoclavés. Stocker dans un récipient sombre. Stériliser à travers un filtre de 0,22 µm, avant d’ajouter au milieu.
  2. Dissoudre 100 mg de ménadione dans 20 mL d’éthanol à 96 %. Stériliser à travers un filtre de 0,22 µm, avant d’ajouter au milieu.
  3. Préparer 1 L de sang Agar (voir Table des matières) selon les instructions du fabricant et les stériliser. Laisser refroidir avant d’ajouter du sang de cheval et les suppléments. Mélanger et verser les plaques.
  4. Préparer les mis à jour le cerveau coeur Infusion (BHI) bouillon comme indiqué précédemment12. Ajouter 5 μg/mL d’hémine et 1 μg/mL de ménadione après la stérilisation.
  5. Répartir 9 mL du milieu dans Hungate tubes et fermer avec un bouchon de caoutchouc et d’un aluminium. Rincer les tubes avec N2/co2 (90 % / 10 %).
  6. Récupérer 1 mL de milieu anaérobie avec une seringue et le placer dans un tube de microtubes de 1,5 mL. Choisir des colonies individuelles de chaque espèce bactérienne et remettre en suspension dans le milieu de transfert dans l’anaérobie BHI mis à jour le. Incuber pendant 48 h à 37 ° C, à l’exception de S. salivarius, qui doivent être incubées pendant 24h.
  7. Si nécessaire, vérifier la pureté des cultures avant d’assembler la communauté synthétique. En bref :
    1. Extraire l’ADN des cultures liquides comme Hernandez-Sanabria et al. (2010) 13 et amplifier le gène de l’ARNr 16 s en utilisant les amorces 27F (AGAGTTTGATYMTGGCTCAG) et 1492R (TACGGYTACCTTGTTACGACT) et le programme suivant : 5 minutes à 95 ° C, 30 cycles de 95 ° C pendant 1 min, 55 ° C pendant 1 min et 72 ° C pendant 1,5 min, suivi d’une extension finale de 5 min à 72 ° C.
    2. Purifier le produit PCR avec un commercial nécessaire (voir la Table des matières), suivant les instructions du fabricant.
    3. Effectuer la réaction de séquençage des produits purifiés dans un volume total de 10 μL contenant 0,5 μL de teindre (voir Table des matières), 3.2 pmol d’amorce de M13f (CGCCAGGGTTTTCCCAGTCACGAC), 2,0 μL de 5 x tampon de séquençage et 20 ng du modèle, en utilisant un système commercial séquençage avec kit (voir Table des matières).
      NOTE : Nous avons eu cette procédure réalisée sur le marché.
    4. Effectuer une recherche BLAST sur toutes les séquences (http://blast.ncbi.nlm.nih.gov/Blast.cgi) pour déterminer le taxon connu plus proche de vous et de comparer avec la séquence de la souche d’origine à l’aide de l’outil en ligne de classificateur de RDP (http://rdp.cme.msu.edu/) et le SINA Service d’alignement (https://www.arb-silva.de/aligner/).
  8. Mesurer le nombre de cellules à la fin de l’incubation, utilisant la cytométrie en flux et tache de SYBR Green/Propidium iodure comme décrit dans Hernandez-Sanabria et al. (2017) 11. diluer les cultures à 105 cellules mL-1, à l’aide de modification BHI.
  9. Ajouter 1 mL de S. mitis dans 75 mL de BHI anaérobie et incuber jusqu'à la phase stationnaire (6 h). Suite, recueillir 0,75 mL de chaque souche diluée et mélanger dans des conditions anaérobies.
  10. Une fois que toutes les cultures ont été mitigés, prélever 1 mL du microcosme et ajouter à la 75 mL de BHI. Incuber la communauté synthétique moins de 10 % de CO2, 10 % H2, 80 % N2 pendant 48 h à 37 ° C et 200 tr/min (voir Table des matières).
  11. Mesurer la densité des cellules comme 2.8. avant de présenter la communauté pour le modèle de cellule. Composition de la communauté pouvant être évaluée par quantitative PCR en temps réel, en utilisant les amorces et recuit de températures au tableau 1 de Slomka et al. (2017) 10. en outre, utiliser séquençage d’amplicon du gène ARNr 16 s pour fournir des informations sur les membres fondateurs présents13,14. Pour chaque protocole qui confirme l’identité, utilisez ARNC comme gabarit pour indiquer les bactéries activement transcription des protéines et utiliser l’ADN comme gabarit pour révéler la présence/absence des souches.

3. pratiques de Culture cellulaire générale

Remarque : Pour les aspects généraux de la culture cellulaire, les auteurs renvoient à maître et Stacey (2007)15. Obtenir des lignées de cellules utilisées à partir de la Collection d’authentifié Cell Cultures européennes (Caco-2 ECACC 86010202 et HT29-MTX-E12 ECACC 12040401, la santé publique en Angleterre, UK). Réactifs pour culture cellulaire peuvent être achetés (voir Table des matières), sauf indication contraire.

  1. Entretien et passage des lignées de cellules Caco-2 et HT29-MTX
    NOTE : Cellules Caco-2 et HT29-MTX sont couramment cultivées dans des flacons de culture de tissu 25 cm2 contenant le support DMEM supplémenté (tableau 1). Les cellules sont trypsinisées lorsque confluence de 60 à 70 % est atteint.
    1. Enlever le milieu de culture cellulaire de ces flacons. Laver deux fois avec 5 mL de PBS sans /Mg Ca++++.
    2. Ajouter 2 mL d’une solution de 0,5 mg/L de la trypsine et acide 0,22 g/L d’éthylène diamine tétraacétique (EDTA). Distribuer la solution de trypsine en déplaçant doucement la fiole. Prélever 1,5 mL de la solution de trypsine et incuber la fiole à 37 ° C pendant 10 min.
    3. Sous le microscope, vérifier si les cellules sont détachent de la surface du ballon. Incuber pendant 5 min supplémentaire si nécessaire.
    4. Ajouter 5 mL de milieux de culture cellulaire complétée dans le ballon pour inactiver la trypsine. Pipette de haut en bas pour obtenir une suspension homogène de cellule unique.
    5. Immédiatement, prendre un 50 µL aliquote de la suspension cellulaire et le mélanger avec une solution stérile de bleu Trypan 0,4 % dans une proportion de 1:1 (v/v) pour les cellules Caco-2 ou 1:5 v/v pour HT29-MTX. Mix de pipetage et de charge dans une chambre de comptage (voir Table des matières).
    6. Compter les cellules viables (globules blancs lumineux) au microscope (voir les instructions du fabricant).
    7. Semences dans une fiole de nouveau à une densité de 4 x 105 cellules/cm2 et 1 x 104 cellules/cm2, Caco-2 et HT29-MTX, respectivement.
      NOTE : (1) Caco-2 cellules se différencient et forment des jonctions serrées, atteignant une fois confluence. Il est extrêmement important d’éviter les over-confluence avant la trypsinisation. Prolifération de cellules dans ballon peut causer échec en détachement cellulaire après trypsinisation ou cellule de touffes. (2) les cellules HT29-MTX sont productrices de mucus des cellules à activité métabolique intense16. Ces fonctionnalités peuvent provoquer une acidification rapide des milieux de culture cellulaire, surtout si les cellules sont à haute densité. Un tampon HEPES peut être ajouté au milieu de culture cellulaire (tableau 1) pour maintenir le pH entre 7 et 7.2. Si le pH baisse, moyen peut être échangés lorsque confluency est inférieur à 50 %. Toutefois, si confluency > 50 %, la culture de cellule doit être fractionnée.

4. montage d’un modèle de cellule compartiments simulant l’Interface hôte-microbe de Gut

Remarque : Remplir la co-culture en double des puits de chambre (diamètre 24 mm, pore taille 0,4 μm ; voir Table des matières).

  1. Ajouter 1,5 mL de milieux de culture cellulaire complet au compartiment apical et 2 mL à la basale. Les incuber pendant 20 à 30 min obtenir une répartition uniforme de la suspension cellulaire lors de l’ensemencement.
  2. Trypsinize la culture de cellules Caco-2 et HT29-MTX tel que décrit à l’article 3. La procédure de la trypsinisation respecter avec précision pour obtenir une répartition homogène des deux lignées de cellules, dans une suspension monocellulaire, sans amas.
  3. Compter les cellules viables comme décrit dans 3.1.8.
  4. Ajuster la densité des cellules à 6,5 x 104 cellules/cm2 dans une proportion de 90/10 de cellules Caco-2/HT29-MTX.
  5. Homogénéiser les suspensions cellulaires et ajouter le volume correspondant de cellules Caco-2 et HT29-MTX dans un récipient stérile pré-remplie avec les milieux de culture cellulaire complétée. Retirez le support préalablement incubé du côté apical de la chambre par aspiration.
  6. Doucement la suspension cellulaire de la composition de pipetage et transférer 1,5 mL dans le compartiment apical des inserts chambre. La procédure d’amorçage nécessite une constante homogénéisation de la suspension cellulaire, car les cellules ont tendance à sédiments. Selon l’expérience de l’utilisateur et la vitesse de travail, suspension de cellules doit être mélangée après la distribution de 1 à 3 puits.
  7. Déplacer les plaques doucement vers l’arrière et vers l’avant, puis à droite à gauche à droite (5 à 10 fois) pour obtenir un même propagation des cellules dans le puits. Transfert à l’incubateur et répétez le mouvement des plaques.
  8. Maintenir la co-culture de cellules Caco-2/HT29-MTX pendant 15 jours, rafraîchissant basales et apicales compartiments tous les 2 jours avec DMEM supplémenté. Passé ce délai, les milieux de culture cellulaire peut être changé à DMEM supplémenté sans solution antibiotique/antimycosiques.
  9. Maintenir le système jusqu'à 20 à 21 jours après l’ensemencement en actualisant le milieu tous les 2 jours.
  10. Mesurer l’intégrité de la barrière épithéliale avant de commencer l’essai, à l’aide d’un système de résistance électrique (voir Table des matières), suivant les instructions du fabricant.
    1. S’assurer que les équipements TEER est entièrement chargée (> 24h) avant le début des mesures.
    2. L’équipement TEER débrancher de l’alimentation et la couverture avec un sac en plastique autoclave. Faire un trou dans le sac pour introduire l’électrode et la brancher dans le port d’entrée du compteur. Vaporiser d’eau/éthanol 70 % (v/v) avant d’introduire l’équipement TEER dans l’armoire de flux.
    3. Pour désinfecter l’électrode, plonger les extrémités des électrodes dans la solution d’éthanol/eau (v/v) de 70 % pendant 15 min. autoriser pour sécher à l’air pendant 15 s. Rincer l’électrode dans les milieux de culture cellulaire pré chauffé.
    4. Prenez les cellules hors de l’incubateur et permettre aux cellules à température ambiante à l’intérieur de l’enceinte à flux.
    5. Assurez-vous que le compteur est débranché du chargeur. Réglez le commutateur mode Ohms et tournez le commutateur d’alimentation sur.
    6. Mesurer la résistance de la cellule en immergeant l’électrode avec l’extrémité plus courte de la notice et la plus longue pointe du puits. Tenir l’électrode à un angle de 90° pour l’insert de la plaque.

5. bactérienne survie In Vitro Gastrointestinal Transit aux Conditions suivantes

NOTE : Préparer la digestion simulée fluides suivant le protocole de Minekus et al. (2014) 17, avec les modifications décrites ci-dessous. Préparer toutes les dilutions avec de l’eau ultrapure. Filtre-stériliser toutes les solutions à travers une 0,22 µm et effectuez la procédure de digestion dans des conditions stériles.

  1. Digestion par voie orale :
    1. Placer 3 mL des communautés bactériennes dans un tube stérile de 50 mL, mélanger avec 3 mL de liquide salive simulée (SSF), contenant (en mmol L-1) : KCl, 15.1 ; KH2PO4, 3,7 ; NaHCO3, 6,8 ; MgCl2(H2O)6, 0.5, (NH4) CO3, 0,06 ; HCl, 1.1 ; CaCl2(H2O)2, 0,75. Ajouter 75 U/mL de α-amylase de salive humaine Type IX-A et de la mucine de 2 g/L de type porcin estomac II à la SSF.
    2. Incuber le mélange pendant 2 min, à 37 ° C et 100 tr/min. Prélever un échantillon de 2 mL pour l’extraction d’ADN et la quantification de cytométrie en flux (S1).
  2. Digestion gastrique :
    1. Ajouter 4 mL de liquide gastrique simulé (SGF), contenant (en mmol L-1) : KCl, 6,9 ; KH2PO4, 0,9 ; NaHCO3, 25 ; NaCl, 47,2 ; MgCl2(H2O)6, 0,1, (NH4) CO3, 0,5 ; HCl, 15.6 ; CaCl2(H2O)2, 0,075. En outre, la SGF contenait 2 g/L de mucine de type porcin estomac II.
    2. Mesurer le pH et ajuster le pH 3 avec du 1 HCl M, si nécessaire. Incuber à 37 ° C et 100 tr/min. Prélever un échantillon de 2 mL (S2).
  3. Digestion de l’intestin grêle :
    1. Ajouter 4 mL de liquide intestinal simulé (SIF) contenant (en mmol L-1) : KCl, 6,8 ; KH2PO4, 0,8 ; NaHCO3, 85 ; NaCl, 38,4 ; MgCl2(H2O)6, 0,33 ; HCl, 8.4 ; CaCl2(H2O)2, 0,3 ; le tube de digestion.
    2. Ajuster le pH 7 avec 1 NaOH M, si nécessaire. Incuber à 37 ° C et 100 tr/min. Prélever un échantillon de 2 mL (S3).

6. capacité de colonisation bactérienne In Vitro Gastrointestinal Transit aux Conditions suivantes

  1. Centrifuger à 2 mL de la digestion de l’intestin grêle, pendant 10 min à 2 650 x g.
  2. Retirez le surnageant et le culot bactérien se mêlent 5 mL de milieu DMEM sans antibiotique et antimycosiques.
  3. Tache et quantifier les cellules intactes ou endommagées à l’aide d’un cytomètre de flux (voir Table des matières), tel que décrit par Hernandez-Sanabria et al. (2017) 11.
  4. Ajuster la densité cellulaire à 105 cellules viables/mL en diluant en DMEM supplémenté sans antibiotique et antimycosiques.
  5. Retirez le support apical du système transwell et ajouter 1,5 mL de la suspension bactérienne. Co-culture le système pendant 2 h dans des conditions de culture cellulaire générale (37 ° C, humidité de 95 %, 5 % de CO2).
    Remarque : Cette fois peut être prolongée jusqu'à 48 heures, selon le protocole expérimental requis. La co-culture peut être maintenue dans une étuve à différente de celui utilisé pour l’entretien de la cellule courante, pour éviter les contaminations.
  6. Mesurer les valeurs TEER après l’incubation, pour évaluer l’intégrité de la barrière épithéliale, comme décrit dans 4.11.
  7. À l’issue de la période d’incubation, retirez les supports apicales et recueillir 0,5 mL pour approfondir les analyses (S4). Un sous-échantillon de médias peut être utilisé pour l’évaluation de la viabilité cellulaire par dosage de Lactate déshydrogénase (LDH) (voir la Table des matières), suivant les instructions du fabricant.
  8. Ajouter 0,5 mL de 10 mM de N-acétylcystéine dans HBSS (CNA-tampon) pour solubiliser le mucus produit par la HT29-MTX et récupérer les bactéries adhérentes. Incuber les plaques à 37 ° C pendant 1 h, sous agitation (135 tr/min, voir Table des matières).
  9. Récupérer le CNA-HBSS dans un tube de microcentrifuge (S5) et laver deux fois par les cellules avec 1 mL SPD.
  10. Ajouter 0,5 mL de 0,5 % Triton X-100 (p/v) sur le dessus les monocouches, perturber les cellules en pipettant également, récupérer le liquide et le vortex pour 1 min. vitesse est crucial pour éviter d’endommager les cellules bactériennes avec du détergent.
  11. Centrifuger les cellules pendant 5 min à 2 650 x get séparez le surnageant (S6) et le culot (S7).

7. analyse de l’échantillon

NOTE : Analyser les échantillons recueillis (S1-S7) pour évaluer la viabilité bactérienne et adhérence potentiel aux cellules intestinales, suite à une digestion gastro-intestinale simulée.

  1. La viabilité bactérienne : passer les échantillons S1-S5 deux fois à travers un 0,45 µm et quantifier des cellules bactériennes à l’aide de live/dead cell coloration et cytométrie en flux, comme indiqué dans l’étape 2.811.
  2. Adhérence potentiel : préparer des dilutions en série (-1 à -8) pour S1-S6 et ensemencer 10 µL en gélose au sang et modifié les plaques BHI. Incuber à 37 ° C dans des conditions anaérobiques pendant 24 à 48 h. plaque le même volume de S7 non dilué.
    1. Identification taxonomique des bactéries adhérentes :
      1. Prélever des colonies individuelles avec une boucle de la culture et de resuspendre chacun sur 10 µL d’eau exempte de nucléase. Prélever 4 µL de cette suspension et utilisez-le comme modèle pour l’amplification PCR du gène de l’ARNr 16 s en utilisant les amorces et les conditions décrites au 2.7.1.
      2. Effectuer le séquençage suivant le protocole en 2.7.3 et la validation de la séquence à l’aide de la procédure incluse dans 2.7.4.
  3. Faire une analyse en aval telles que total extraction de l’ADN, séquençage qPCR quantification ou 16 s ARNr amplicon, extraction de l’ARN et transcriptomique profilage comme vous le souhaitez plus.
    NOTE : Quantification de cytométrie de flux a été réalisée immédiatement après le prélèvement. Comme un contrôle pour cellules perméabilisées de membrane, a été utilisé un échantillon exposé à 70 ° C pendant 3 min. Bruit de fond a été évaluée en mesurant avec la cytométrie en flux, les fluides de la digestion ou les échantillons obtenus à partir du modèle de culture cellulaire sans bactéries. Chaque échantillon a été mesuré en triple exemplaire.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Ce protocole entraîne la génération d’un modèle approprié pour élucider la survie et la viabilité des bactéries orales soumises à des conditions de transit gastrointestinal simulée. Les comtes de cellules intactes de souches individuelles est d’environ 108 piles avant-1 mL de la création de la communauté synthétique, tandis que le microcosme multi-espèces figurant au-dessus de 90 % des cellules viables durant l’établissement de la Communauté ( Figure 1 a et 1 b). Basée sur la quantification de Live/Dead, viabilité bactérienne diminue après chaque étape de la digestion (Figure 2). Cela peut être un résultat de pH acide lors du passage gastrique et des sels biliaires contenues dans les liquides de digestion intestin grêle, comme se produisant dans des conditions physiologiques. Viabilité durant le transit de la digestion gastro-intestinale fois in vitro et in vivo peut dépendre des variations de l’environnement (p. ex., nourris vs jeûné des conditions), ou même sur les processus de protection des bactéries (spores formation ou revêtements entériques).

Comtes de cytométrie en flux doivent être comparées avec des contrôles appropriés, tels que les bactéries tuées par la chaleur ou des échantillons de fond, pour effectuer de quantification précise de cellules viables18. Les conditions difficiles de la digestion de l’estomac et l’intestin grêle peuvent passer des bactéries à cellules viables mais non cultivable, qui sont des bactéries vivantes qui ne soit grandir ni diviser. Pour cette raison, dénombrements diffèrent du nombre de cellules viables obtenu par cytométrie en flux. Par exemple, dans la Figure 3, cellules viables récupérés depuis l’interface de muqueuse sont colorés en bleu dans l’intrigue de cytométrie de flux. Toutefois, aucune croissance n’a été observée lorsque ces échantillons de mucus étaient plaqués (résultats non présentés).

La fraction sur lequel les bactéries montrent des taux plus élevés de la viabilité est le débris cellulaires (S7), telle que révélée par plaque de comptage (Figure 4). Le nombre de colonies peut être variable, mais la présence de bactéries métaboliquement actives se trouve dans les échantillons moins dilués.

Figure 1
Figure 1 : Viabilité des bactéries composant la communauté microbienne multi-espèces au début de la digestion gastro-intestinale in vitro de cellules. (A) du nombre de cellules viables (unités logarithmiques) quantifié en live/mort souillure et écoulement cytometry (moyenne ± écart-type, n = 3). (B) terrain de cytométrie flux représentatif de la communauté microbienne multi-espèces après 48 h de culture mixte. Points en vert, rouge et noir représentent viable, endommagé et fond ou bactéries non classées, respectivement. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : viabilité des bactéries cellulaire après la digestion gastro-intestinale simulée. Barres représentent le nombre de cellules viables (unités logarithmiques) après les étapes de la digestion intestinale orale, gastrique et petite (moyenne ± écart-type, n = 3). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : parcelle représentatif de cellules bactériennes viables dans l’interphase muqueux. Points rouges représentent les points de bleu et de fond des cellules viables. Cytométrie en flux conditions ont été établies, basé sur les accessoires et al. (2016) 19. échantillons de muqueuse ont été dilués au 1/100 (v/v) et colorées avec l’iodure de Sybr Green/Propidium pendant 15 min et 100 µL de l’échantillon a été mesuré à FL1 : 533/30 nm, FL2 : 585/40 nm, LV3 : > 670 nm col long et FL4 : 675/25 nm. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : unités (UFC) est passées de débris cellulaires en formant des colonies modifiée plaques BHI. Trois réplicats biologiques ont été utilisées pour la détermination de l’adhérence bactérienne et trois répétitions techniques ont été réalisées pour la quantification de l’UFC. Deux plaques répétées contenant -1 à-6 dilutions des débris cellulaires (S7) sont indiquées sur la figure. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Culture cellulaire Adhérent / Suspension Milieu de culture Suppléments générales Compléments spécifiques Temps de doublement Conditions d’incubation
Caco-2 (ECACC 86010202) Adherent Modifié Eagle (DMEM de Dulbecco) avec 4,5 g/L de glucose Inactivé (10 % v/v) de sérum de veau fœtal
Pénicilline (100 U/mL) *
Streptomycine (0,1 mg/mL) *
Amphotéricine (0,0025 mg/mL) *
Glutamax (4 mM)
Acides aminés non essentiels (1 % v/v)
Pyruvate (1 mM)
65 à 72 h 95 % humidité et 10 % de CO2
Incubateur à CO2 (voir la Table des matières)
HT29-MTX (ECACC 12040401) Adherent HEPES (1 mM) 20 à 24 h
* Les antibiotiques et les antifongiques ont été retirés les milieux de culture cellulaire 2 jours avant de commencer les essais.

Tableau 1 : Description de la composition cellulaire de lignes et des médias pour l’entretien de la culture cellulaire.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Le microbiome oral est un élément clé dans la santé humaine, comme l’a récemment rapportée par plusieurs auteurs20,21. Résultats antérieurs indiquent que l’ingestion de la salive contenant de grosses charges de bactéries peut influencer l’écosystème microbien de l’intestin grêle, qui est l’un des principaux sites pour amorcer la pompe système immunitaire. La combinaison d’un modèle de la digestion gastro-intestinale supérieure statique avec l’interface de l’hôte représentée par des cellules épithéliales et qui sécrètent du mucus intestinales, a servi à décortiquer l’impact de la composante microbienne sur l’hôte.

Les modèles in vitro sont des outils de base pour la recherche, permettant de mener des études mécanistes et parvenir à des connaissances de base visant à réduire, faire des études in vivo cible plus efficace et mieux. Pour cette raison, il est essentiel de garantir la pureté, la viabilité et la croissance optimale des cultures axéniques avant d’établir la communauté microbienne synthétique. Il est recommandé d’évaluer la viabilité et la composition des communautés bactériennes avant l’exposition à des cultures de cellules, pour éviter le biais dans l’analyse. Un nombre élevé de bactéries endommagés peut nuire à l’adhérence et davantage sur l’intégrité du modèle de cellule. En outre, l’utilisation d’une source fiable de lignées cellulaires minimisera mauvaise ligne cellulaire, contamination et mauvaise annotation, améliorer la reproductibilité expérimental22.

Y compris les cellules productrices de mucus permet de ressemblance avec l’intestin grêle, comme le mucus et les mucines fournissent la première ligne de défense de l' appareil gastro-intestinal23. En outre, la couche muqueuse est adaptée pour une colonisation bactérienne, permettant la caractérisation transport bilatéral des métabolites bactériens. En outre, des conditions simulées gastro-intestinal augmentent la capacité d’adhérence des souches de Lactobacillus paracasei de Caco-2 et la mucine24, soutenir la pertinence de l’intégration des processus digestifs dans notre modèle.

D’autres améliorations dans le modèle peuvent être introduites pour intégrer la composante immunitaire hôte, comme précédemment examiné25. Cependant, les systèmes actuels de co-culture de cellules épithéliales et immunitaires n’ont pas été utilisés pour des applications d’interaction hôte-microbe (p. ex., évaluation de composés bioactifs alimentaires ou probiotiques), qui pourraient indiquer que ces systèmes peuvent manquer 25de reproductibilité.

Des recherches antérieures avec Caco-2, HT29-MTX ou co-cultures évalué l’adhésion des probiotiques ou des souches pathogènes pour les cellules mammifères26,27. À l’aide de simples taches ou associations de quelques micro-organismes peuvent fournir un aperçu limité sur l’hôte-microbe interactions, et il n’est pas représentative de la complexité de l’appareil gastro-intestinal humain. Bien que l’utilisation des communautés microbiennes naturelles peut être plus représentatif du scénario en vivo , elles sont difficiles à caractériser et à étudier. En revanche, notre méthodologie offre la possibilité d’évaluer les interactions hôte-microbe multiples, à l’aide d’un microcosme complex et représentatif. L’utilisation d’une communauté microbienne synthétique définie permet la génération d’un système avec complexité réduite28. Changements dans la Communauté peuvent être le résultat des conditions micro-environnementales dans le cadre d’expériences individuelles. Ainsi, la composante microbienne de ce modèle peut facilement évoluer vers le haut ou vers le bas pour déconstruire l’impact de l’environnement comme une force sélective. Enfin, l’accessibilité d’échantillonnage garantit davantage caractérisation des activités fonctionnelles des cellules humaines et de la communauté microbienne associée.

Dans les dernières années, les nouveaux modèles in vitro basés sur la technologie organoïde ont été développés. Organoïdes sont des cultures de cellules 3D qui intègrent certaines des caractéristiques clés du tissu principal représenté. Bien qu’organoïdes intestinaux sont un système près-physiologique pour l’étude des cellules souches adultes et des tissus, ce modèle a également quelques limitations. Organoïdes intestinaux ont un usage limité en ressemblant à des réactions inflammatoires à des infections ou des médicaments, car ils manquent de cellules immunitaires. En outre, les organoïdes sont hétérogènes au sujet de la viabilité, la taille et forme, qui empêchent le dépistage du phénotype et rendre la normalisation complexes. Malgré la limitation des lignées cellulaires immortalisées dans vitro modélisation des tissus sains, l’utilisation de lignées cellulaires bien caractérisés et stable offre également des avantages tels que la répétabilité, la reproductibilité et faible coût. Ces avantages permettent pour le dépistage simultané de plusieurs conditions, mais l’utilisation translationnelle des données est controversée. Les cellules primaires peuvent être plus représentatif de la physiologie en vivo ; Cependant, ils ont une variabilité interindividuelle élevée, ne sont pas entièrement caractérisés, sont hétérogènes et ont un nombre limité de période. Ces facteurs sont un inconvénient pour plusieurs conditions, y compris ou reproduit dans un essai.

Comme la combinaison de lignées cellulaires avec des communautés microbiennes complexes peut représenter un défi, nous nous sommes concentrés sur l’élaboration d’un modèle reproductible et reproductible avec une grande flexibilité et applicabilité dans les laboratoires avec des équipements de la cellule de base, jusqu’au plus représentatif modèles est devenu disponible et bien caractérisées. Nous avons évalué la fonctionnalité des diverses communautés bactériennes à l’aide de ces modèles à compartiments, par exemple, pour évaluer le comportement de probiotiques dans le tube digestif supérieur et de la caractérisation impact xénobiotique sur l’interface de l’intestin. Ainsi, nous proposons ce modèle comme base pour des analyses supplémentaires avec une grande variété de probiotiques, de drogues ou de composés alimentaires, au sein d’un écosystème pertinents définis et in vitro .

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer

Acknowledgments

Les auteurs remercient le soutien financier de la Fondation de recherche de Flandre à Marta Calatayud Arroyo (FWO postdoctoral fellowship-12N2815N). Emma Hernandez-Sanabria est doctorant pris en charge par la Flandre Innovation et entrepreneuriat (Agentschap voor Innovatie door Wetenschap en Technologie, transport fluvial).

Materials

Name Company Catalog Number Comments
STRAINS
Aggregatibacter actinomycetemcomitans American Type Culture Collection ATCC 43718
Fusobacterium nucleatum American Type Culture Collection ATCC 10953
Porphyromonas gingivalis American Type Culture Collection ATCC 33277
Prevotella intermedia American Type Culture Collection ATCC 25611
Streptococcus mutans American Type Culture Collection ATCC 25175
Streptococcus sobrinus American Type Culture Collection ATCC 33478
Actinomyces viscosus American Type Culture Collection ATCC 15987
Streptococcus salivarius  TOVE-R
Streptococcus mitis American Type Culture Collection ATCC 49456
Streptococcus sanguinis BCCM/LMG Bacteria Collection LMG 14657
Veillonella parvula Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures DSM 2007
Streptococcus gordonii American Type Culture Collection ATCC 49818
CELL LINES
Caco-2 cells European Collection of Authenticated Cell Cultures 86010202
HT29-MTX cells European Collection of Authenticated Cell Cultures 12040401
REAGENTS AND CONSUMABLES
Brain Heart Infusion (BHI) broth Oxoid CM1135
Blood Agar 2 Oxoid CM0055 Blood Agar medium
Menadione Sigma M9429
Hemin Sigma H9039
5% sterile defibrinated horse blood E&O Laboratories Ltd, P030
InnuPREP PCRpure Kit Analytik Jena 845-KS-5010250 PCR purification kit
Big Dye Applied Biosystems 4337454 Dye for sequencing
ABI Prism BigDye Terminator v3.1 cycle sequencing kit Applied Biosystems 4337456
SYBR Green I Invitrogen S7585
Propidium Iodide Invitrogen P1304MP
T25 culture flasks uncoated, cell-culture treated, vented, sterile VWR 734-2311
Trypsin-EDTA solution Sigma-Aldrich T3924-100ML
Trypan Blue solution
0.4%, liquid, sterile-filtered
Sigma-Aldrich T8154 
PBS Gibco 14190250
DMEM cell culture media, with GlutaMAX and Pyruvate Life technologies 31966-047
Corning Transwell polyester membrane cell culture inserts Sigma-Aldrich CLS3450-24EA
Mucin from porcine stomach Type II   Sigma-Aldrich M2378
Inactivated fetal bovine serum Greiner Bio One 758093
Antibiotic-Antimycotic (100X) Gibco 15240062
Triton X 100 for molecular biology Sigma-Aldrich T8787 
DPBS without calcium, magnesium Gibco 14190-250
Pierce LDH Cytotoxicity Assay Kit Thermo Fisher Scientific 88953
Corning HTS Transwell-24 well, pore size 0.4 µm Corning Costar Corp 3450
Nuclease-free water Serva Electrophoresis 28539010
EQUIPMENT
Neubauer counting chamber improved Carl Roth T729.1
BD Accuri C6 Flow cytometer BD Biosciences 653118
PowerLyzer 24 Homogenizer MoBio 13155
T100 Thermal Cycler BioRad 186-1096
Flush system Custom made -
InnOva 4080 Incubator Shaker New Brunswick Scientific 8261-30-1007 Shaker for 2.10
Memmert CO2 incubator Memmert GmbH & Co. ICO150med
Millicell ERS (Electrical Resistance System) EMD Millipore, Merck KGaA MERS00002
Millipore Milli-Q academic, ultra pure water system Millipore, Merck KGaA -
Shaker (ROCKER 3D basic) IKA 4000000 Shaker for 6.10

DOWNLOAD MATERIALS LIST

References

  1. Sender, R., Fuchs, S., Milo, R. Revised estimates for the number of human and bacteria cells in the body. PLoS Biology. 14, e1002533 (2016).
  2. Kelly, D., King, T., Aminov, R. Importance of microbial colonization of the gut in early life to the development of immunity. Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis. 58-69 (2007).
  3. Aas, J. A., Paster, B. J., Stokes, L. N., Olsen, I., Dewhirst, F. E. Defining the normal bacterial flora of the oral cavity. Journal of Clinical Microbiology. 43, 5721-5732 (2005).
  4. Marsh, P. D., Head, D. A., Devine, D. A. Dental plaque as a biofilm and a microbial community-Implications for treatment. Journal of Oral Biosciences. 57, 185-191 (2015).
  5. Socransky, S. S., Haffajee, A. D., Cugini, M. A., Smith, C., Kent, R. L. Microbial complexes in subgingival plaque. Journal of Clinical Periodontology. 25, 134-144 (1998).
  6. Haffajee, A. D., et al. Subgingival microbiota in healthy, well-maintained elder and periodontitis subjects. Journal of Clinical Periodontology. 25, 346-353 (1998).
  7. Venema, K. Microbial metabolites produced by the colonic microbiota as drivers for immunomodulation in the host. The FASEB Journal. 27, (2013).
  8. Marzorati, M., et al. The HMI (TM) module: A new tool to study the Host-Microbiota Interaction in the human gastrointestinal tract in vitro. BMC Microbiology. 14, 133 (2014).
  9. Tanzer, J. M., Kurasz, A. B., Clive, J. Competitive displacement of mutans streptococci and inhibition of tooth-decay by Streptococcus-Salivarius Tove-R. Infection and Immunity. 48, 44-50 (1985).
  10. Slomka, V., et al. Nutritional stimulation of commensal oral bacteria suppresses pathogens: the prebiotic concept. Journal of Clinical Periodontology. 44, 344-352 (2017).
  11. Hernandez-Sanabria, E., et al. In vitro increased respiratory activity of selected oral bacteria may explain competitive and collaborative interactions in the oral microbiome. Frontiers in Cellular and Infection Microbiology. 7, 235 (2017).
  12. Alvarez, G., Gonzalez, M., Isabal, S., Blanc, V., Leon, R. Method to quantify live and dead cells in multi-species oral biofilm by real-time PCR with propidium monoazide. AMB Express. 3, (2013).
  13. Ehsani, E., et al. Initial evenness determines diversity and cell density dynamics in synthetic microbial ecosystems. Scientific Reports. 8, 340 (2018).
  14. Hernandez-Sanabria, E., et al. Correlation of particular bacterial PCR-denaturing gradient gel electrophoresis patterns with bovine ruminal fermentation parameters and feed efficiency traits. Applied and Environmental Microbiology. 76, 6338-6350 (2010).
  15. Masters, J. R., Stacey, G. N. Changing medium and passaging cell lines. Nature Protocols. 2, 2276-2284 (2007).
  16. Calatayud, M., Velez, D., Devesa, V. Metabolism of inorganic arsenic in intestinal epithelial cell lines. Chemical Research in Toxicology. 25, 2402-2411 (2012).
  17. Minekus, M., et al. A standardised static in vitro digestion method suitable for food - an international consensus. Food & Function. 5, 1113-1124 (2014).
  18. Berney, M., Hammes, F., Bosshard, F., Weilenmann, H. U., Egli, T. Assessment and interpretation of bacterial viability by using the LIVE/DEAD BacLight kit in combination with flow cytometry. Applied and Environmental Microbiology. 73, 3283-3290 (2007).
  19. Props, R., Monsieurs, P., Mysara, M., Clement, L., Boon, N. Measuring the biodiversity of microbial communities by flow cytometry. Methods in Ecology and Evolution. 7, 1376-1385 (2016).
  20. Yamashita, Y., Takeshita, T. The oral microbiome and human health. Journal of Oral Science. 59, 201-206 (2017).
  21. Wade, W. G. The oral microbiome in health and disease. Pharmacological Research. 69, 137-143 (2013).
  22. Yu, M., et al. A resource for cell line authentication, annotation and quality control. Nature. 520, 307 (2015).
  23. Pelaseyed, T., et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunological Reviews. 260, 8-20 (2014).
  24. Bengoa, A. A., et al. Simulated gastrointestinal conditions increase adhesion ability of Lactobacillus paracasei strains isolated from kefir to Caco-2 cells and mucin. Food Research International. 103, 462-467 (2018).
  25. Kleiveland, C. R., et al. The Impact of Food Bioactives on Health: in vitro and ex vivo models. Verhoeckx, K., et al. Springer International Publishing. 197-205 (2015).
  26. Laparra, J. M., Sanz, Y. Comparison of in vitro models to study bacterial adhesion to the intestinal epithelium. Letters in Applied Microbiology. 49, 695-701 (2009).
  27. Gagnon, M., Berner, A. Z., Chervet, N., Chassard, C., Lacroix, C. Comparison of the Caco-2, HT-29 and the mucus-secreting HT29-MTX intestinal cell models to investigate Salmonella adhesion and invasion. Journal of Microbiological Methods. 94, 274-279 (2013).
  28. Großkopf, T., Soyer, O. S. Synthetic microbial communities. Current Opinion in Microbiology. 18, 72-77 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics