Neurogenese ved hjælp af P19 embryonal carcinoma celler

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Den P19 mus embryonale karcinom cellelinje (P19 cellelinje) er almindeligt anvendt til at studere den molekylære mekanisme af neurogenese med stor forenkling i forhold til in vivo-analyse. Her præsenterer vi en protokol for retinoinsyre-induceret neurogenese i P19 cellelinje.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den P19 cellelinje afledt af en mus embryo-afledte teratocarcinoma har evnen til at differentiere sig i de tre kimlag. I nærværelse af retinsyre (RA), affjedring kultiveret P19 cellelinje er induceret til at differentiere sig til neuroner. Dette fænomen er grundigt undersøgt som en Neuro Genesis model in vitro. Derfor, den P19 cellelinje er meget nyttigt for molekylære og cellulære undersøgelser forbundet med Neurogenesis. Men, protokoller for neuronal differentiering af P19 cellelinje, der er beskrevet i litteraturen er meget komplekse. Den metode, der er udviklet i denne undersøgelse er enkel og vil spille en rolle i belyse de molekylære mekanismer i neuroudviklingsmæssige abnormiteter og neurodegenerative sygdomme.

Introduction

Under embryonal udvikling omdannes et enkelt celle lag til tre forskellige kimlag1,2,3. For at øge forskningsmulighederne for fænomener, der forekommer in vivo, er generering af tredimensionale aggregater (embryonale organer) blevet udviklet som en bekvem model. Cellulære aggregater dannet på denne måde kan blive udsat for forskellige betingelser, der forårsager Celledifferentiering, som afspejler udviklingen af embryonet4,5. Den P19 murine embryonale karcinom cellelinje (P19 cellelinje) er almindeligt anvendt som en cellulær model for Neuro Genesis undersøgelser in vitro6,7,8. Den P19 cellelinje udviser typiske pluripotente stamcelle funktioner og kan differentiere sig til neuroner i nærværelse af retinsyre (RA) under celle sammenlægning efterfulgt af neurite udvækst under vedtagtige betingelser. Desuden, den udifferentierede P19 cellelinje er også i stand til at danne muskler-og kardiomyocyte-lignende celler under påvirkning af dimethylsulfoxid (DMSO)9,10,11,12.

Mange metoder13,14,15,16 er blevet rapporteret for neuronal differentiering, men metoden er undertiden kompliceret og ikke let at forstå ved kun at læse beskrivelserne. For eksempel kræver protokoller nogle gange en kombination af Dulbecco's modificerede Eagle medium (DMEM) medium suppleret med en blanding af kalveserum (CS) og føtal bovint serum (FBS)13. Desuden, medier, der anvendes til neuronal udvikling er ofte sammensat af neurobasal og B27 kosttilskud13,14,15,16. Som sådan, eksisterende metoder indeholder kompleksitet i deres forberedelse og vores mål her er at forenkle protokollerne. I denne undersøgelse, vi viste, at DMEM med FBS kan udnyttes til at opretholde P19 cellelinje (DMEM + 10% FBS) samt for neuronal udvikling (DMEM + 5% FBS + RA). Denne forenklede metode til neurogenese ved hjælp af P19 cellelinje giver os mulighed for at studere den molekylære mekanisme af, hvordan neuroner er udviklet. Desuden er forskning i neurodegenerative sygdomme som Alzheimers sygdom også gennemført ved hjælp af P19 cellelinje17,18, og vi mener, at den metode, der er udviklet i denne undersøgelse vil spille en rolle i at belyse molekylære mekanismer i neuroudviklingsmæssige abnormiteter og neurodegenerative sygdomme.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. vedligeholdelse af kulturen

  1. Kultur den P19 cellelinje i vedligeholdelses medium (Dulbecco's modificerede Eagle's medium med 4.500 mg/L glucose suppleret med 10% FBS, 100 enheder/mL penicillin og 100 enheder/mL streptomycin). Inkubere ved 37 °C og 5% CO2.

2. sub-culturing celler

  1. Når cellerne når op på ca. 80% sammenløbet, fjernes det brugte medium fra cellekultur kolberne (overfladeareal 25 cm2).
  2. Cellerne vaskes med 2 mL phosphatbufferet saltvand (PBS), som er fri for calcium og magnesium.
  3. Tilsæt 1 mL 0,25% trypsin-EDTA (ethylenediaminetraeddikesyre) på celle-monolayer.
  4. Kolben anbringes i CO2 -inkubator (37 °c og 5% Co2) i 2-3 min.
  5. Vurder celle tilbehøret til kolbens overflade. Sørg for, at alle cellerne er løsrevet og flyder i mediet.
  6. Tilsæt 9 mL vedligeholdelses medium for at standse trypsins enzymatiske aktivitet.
  7. Resuspender cellerne i vedligeholdelses mediet.
  8. Overfør cellerne til et 15 mL rør og centrifugeres i 5 min ved 200 x g og rumtemperatur (RT).
  9. Supernatanten kasseres, og 10 mL frisk vedligeholdelses medium tilsættes til 15 mL røret.
  10. Brug cellesuspensionen til at bestemme celle nummeret ved hjælp af en celle tæller i henhold til producentens anvisninger.
  11. Frøceller ved 2 x 104 celler/cm2 i en ny 25 cm2 kolbe.
  12. Tilsæt vedligeholdelses mediet op til 10 mL.
  13. Kolben anbringes med celler i CO2 -inkubator (37 °c og 5% Co2) i 2-3 dage.

3. trypsin fordøjelse

  1. Aspirere vedligeholdelses mediet fra celle kolben. Cellerne vaskes én gang med 2 mL calcium og magnesium frit PBS.
  2. Tilsæt 1 mL 0,25% trypsin-EDTA.
  3. Kolben anbringes med celler i CO2 -inkubator ved 37 °c i 2-3 min.
  4. Brug 1 mL pipette til at adskille cellerne ved at afpipettere cellerne ti gange.
  5. Neutraliserer trypsin ved tilsætning af 9 mL differentierings medium (Dulbecco's modificerede ørne medium med 4500 mg/L glucose suppleret med 5% FBS, 100 enheder/mL penicillin og 100 enheder/mL streptomycin) uden RA til cellerne.
  6. Overfør cellerne til et 15 mL rør og centrifugeres i 5 min ved 200 x g og rt.
  7. Supernatanten kasseres, og 1 mL differentierings medium tilsættes uden retinsyre (RA). Resuspendere celle pellet.
  8. Brug cellesuspensionen til at bestemme celle nummeret ved hjælp af en celle tæller i henhold til producentens instruktion.

4. samlet generering

  1. Der tilsættes 5 μL RA (1 mM bestand opløst i 99,8% ethanol, opbevaret ved-20 °C) til 10 mL differentierings medium og blandes godt (slutkoncentration på 0,5 μM RA).
    Bemærk: RA er lysfølsomt. Lav koncentration af EtOH påvirker ikke Celledifferentiering19,20,21.
  2. Tilsæt 10 mL differentierings medium (med RA) til 100 mm ikke-behandlet kulturfad (dedikeret til suspensions kultur).
  3. Frø 1 x 106 celler i 100 mm skålen (parabol overfladeareal 56,5 cm2).
  4. Kolben anbringes med celler i inkubator ved 37 °C og 5% CO2 i 2 dage for at fremme dannelsen af aggregater.
  5. Efter 2 dage, udveksle differentierings mediet. Aspirér medium indeholdende aggregater ved hjælp af en 10 mL pipette og Overfør til et 15 mL rør ved RT.
  6. Lad aggregaterne udligne med tyngdekraften i 1,5 min ved RT.
  7. Kassér supernatanten.
  8. Tilsæt en frisk 10 mL differentierings medium med 0,5 μM RA ved hjælp af en 10 mL serologisk pipette.
    Forsigtig: Du må ikke pipettere celle aggregaterne op og ned.
  9. Frø aggregaterne i ny 100 mm ikke-behandlet kultur skål (dedikeret til suspension kultur).
  10. Pladen placeres i inkubator (ved 37 °C og 5% CO2) i 2 dage.

5. dissociation af aggregater

  1. Aspirér celle aggregaterne ved hjælp af en 10 mL pipette.
  2. Aggregaterne overføres til et 15 mL rør. Lad celle aggregaterne udligne med tyngdekraften i 1,5 min.
  3. Fjern supernatanten.
  4. Vask aggregaterne med DMEM alene (serum-og antibiotika-fri).
  5. Lad celle aggregaterne udligne med tyngdekraften sedimentering for 1,5 min ved RT.
  6. Du aspirerer supernatanten og tilsættes 2 mL trypsin-EDTA (0,25%).
  7. Placer celle aggregaterne i et vandbad (37 °C) i 10 min. omrystes forsigtigt hver 2 min. ved at tappe med en hånd.
  8. Stop trypsinization processen ved at tilføje 4 mL vedligeholdelses medium.
  9. Pipette aggregaterne op og ned 20 gange med 1 mL pipette.
  10. Centrifuge cellerne i 5 min ved 200 x g og rt.
  11. Supernatanten fjernes, og celle pellet opslæmmes i 5 mL vedligeholdelses medium.
  12. Bestem celle nummeret med en celle tæller.

6. plating celler

  1. Tilsæt 3 mL pr. brønd af vedligeholdelses medium til en 6-brønd plade.
  2. Frøceller i 6-brønd kultur pladen med en densitet på 0,5 x 106/Well.
  3. Inkubere ved 37 °C med 5% CO2 -koncentration.
  4. Seed cellerne på dækglas i 6 brønd kultur plade og udføre immun farvning med anti-MAP2 antistof (20% sammenløbet). Brug 6-brønd pladen til at isolere RNA og udføre RT-PCR for Map2, Neun, Oct4, nanogog gapdh (20% sammenløbet).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Den forenklede ordning for protokol for Neuro Genesis induktion i P19 cellelinje er præsenteret i figur 1. For at definere karakteren af den P19 cellelinje i en udifferentieret tilstand og under Neurogenesis, blev RT-PCR (reverse transkription-polymerase kædereaktion) metoden anvendt. Den udifferentierede P19 cellelinje udtrykte pluripotens gener såsom organisk kation/carnitin transporter4 (Oct4) og nanog homeobox (nanog). Neurogenese induceret af celler sammenlægning i suspension kultur i nærværelse af RA førte til en hurtig nedgang i Oct4 og nanog udtryk. I modsætning, ekspression af neuron markører: microtubule-associeret protein 2 (Map2), Neun (også kendt som RNA binding protein, Fox-1 ligner 3 (Rbfox3)) steg efter udløst neurogenese (figur 2)6 ,14,15,22. De primere, der anvendes til hvert gen, er indikeret sammen med nukleotidsekvensog produktets størrelse i tabel 1. Et mikroskopisk billede af den udifferentierede P19 cellelinje præsenterede en rund formet morfologi (figur 3a). Efter induktion af neurogenese, neuronal struktur af cellerne var klart synlige 4 dage efter plating (figur 3B). Figur 4 repræsenterer desuden fluorescens billedet af MAP2 ekspression i den differentierede P19 cellelinje (4 dage efter plating celler)14.

Figure 1
Figur 1 : Protokol skematisk til induktion af neurogenese i P19 embryonal karcinom celler. Neurogenese induceres ved dyrkning af P19 cellelinje i en 100 mm ikke-behandlet kultur skål med 5% af FBS og 0,5 μM RA. Efter 4 dage adskilles celle aggregaterne med trypsin og syes på klæbemiddel cellekultur plade i de næste 4 dage. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Ændringer af genekspression i P19 cellelinje. Bandet graf repræsenterer genekspression for udifferentieret P19 cellelinje (Oct4, nanog) og under neurogenese (Map2, Neun). Glyceraldehyd-3-fosfat dehydrogenase (Gapdh) blev anvendt som reference genet. Prøverne lastes i agrose gel (1,5%) i dobbelte replikationer. Forkortelser: udifferentieret repræsenterer den udifferentierede P19 cellelinje uden RA behandling; Dag 1-4 repræsenterer efterfølgende dage efter celle plating-efter 4 dage efter RA behandling og celle Sammenlægnings stadiet. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Repræsentative billeder af analyse af P19 cellelinje. A) lette mikroskopiske billeder af udifferentieret P19 cellelinje. (B) lyse mikroskopiske billeder af P19 cellelinje efter 4 dage af neurogenese-efter 4 dage efter RA behandling og celle aggregering fase. Scale bar = 100 μm. Klik her for at se en større version af dette tal.

Figure 4
Figur 4 : Repræsentativ immunofluorescens billede af differentieret P19 cellelinje. Fusioneret immunofluorescenstest billede af P19 cellelinje farvet med anti-MAP2 og dapi på 4 dage efter plating. Scale bar = 100 μm. Klik her for at se en større version af dette tal.

Primer Primer sekvens Produkt
størrelse (BP)
Gapdh F: TGACCTCAACTACATGGTCTACA
R: CTTCCCATTCTCGGCCTTG
85
Map2 F: GCTGAGATCATCACACAGTC
R: TCCTGCCAAGAGCTCATGCC
211
Oct4 F: GGCGTTCTCTTTGGAAAGGTGTTC
R: CTCGAACCACATCCTTCTCT
313
Neun F: GGCAAATGTTCGGGCAATTCG
R: TCAATTTTCCGTCCCTCTACGAT
160
Nanog F: AAAGGATGAAGTGCAAGCGGTGG
R: CTGGCTTTGCCCTGACTTTAAGC
520

Tabel 1: primere anvendt til RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Her beskriver vi en simpel protokol for neurogenese ved hjælp af P19 Cell line. Selv om mange rapporter er blevet offentliggjort i denne henseende, en detaljeret metodologi for Neuro Genesis induktion ved hjælp af P19 cellelinje forbliver uklar. Desuden har vi udnyttet en simpel høj glukose (4.500 mg/L) DMEM medium med 10% FBS for hele eksperimentet. Dette tillod os at udføre den neurogene eksperiment i en brugervenlig måde og udvide brugen af denne metode for fremtiden.

De mest kritiske punkter i denne protokol er RA-koncentrationen samt generering af celle aggregater i suspensions kulturen. Stimulering af neurogenese i P19 cellelinje kan udføres uden dannelsen af aggregater, men antallet af neuronal celler produceres vil blive reduceret med to tredjedele i cellen kultur22. Monzo et al. har vist Neuro Genesis induktion i P19 cellelinje ved at culturere dem i enkeltlags15. Selv om deres metode er ganske praktisk, da vi kan eliminere suspension kultur proces, yderligere undersøgelser er forpligtet til at sammenligne deres metode med andre velbeskrevne metoder. RA-koncentrationen af 0,5 μM i mediet producerede et stort antal celle aggregater samt neuroner efter plating i forhold til 1 μM RA. Det er også vigtigt at bemærke, at vi ikke kunne observere en effektiv neurogenese, når de fleste af aggregaterne er fastgjort til bunden af suspensionen kultur skålen under RA behandling. Det optimale antal P19-cellelinjer, der skal anvendes i begyndelsen af proceduren, er 1 x 106 for hver 10 ml differentierings medium. Under induktion af neurogenese, den P19 cellelinje former varierende størrelse aggregater og endda enkeltceller findes i kulturen. For at overvinde dette problem indsamlede vi celle aggregaterne efter 1,5 minutters frit fald i et 15 mL rør. Vi konstaterede, at denne fremgangsmåde gør det muligt at udelukke kontaminering af enkeltceller. Det anbefales også at udføre neuronal berigelse med cellekulturen ved hjælp af anti-mitotiske lægemidler (f. eks. cytosin arabinosid) for langsigtet kultur til at hæmme omfattende spredning af gliaceller celler23.

Neuroner afledt af P19 Cell line Express ionotropic glutamat receptorer af både N-methyl-D-aspartat (NMDA) og alpha-amino-3-hydroxy-5-methyl-4-isoxazol propionat (AMPA)/kainite (ka) typer24,25, samt funktionelle γ-aminosmørsyre (GABA) receptorer25. Derfor er P19 celle linjen meget udbredt i undersøgelserne af molekylære mekanismer, der regulerer neuronal differentiering26,27,28. Endnu vigtigere, tumor udvikling blev ikke observeret efter celletransplantation29,30.

Til dette formål, forskning i neurodegenerative sygdomme som Alzheimers sygdom17,18 er også udført ved hjælp af P19 cellelinje, og vi mener, at den metode, der er udviklet i denne undersøgelse vil således spille en rolle i belyse den molekylære mekanismer i neuroudviklingsmæssige abnormiteter og neurodegenerative sygdomme.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Undersøgelsen blev finansielt støttet af National Science Centre, Polen (Grant nr. UMO-2017/25/N/NZ3/01886) og KNOW (førende nationale Forskningscenter) videnskabeligt konsortium "sunde dyr-sikre fødevarer", afgørelse fra ministeriet for videnskab og videregående uddannelse nr. 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics