Neurogenesi con cellule carcinoma embrionale P19

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

La linea cellulare del carcinoma embrionale del topo P19 (linea cellulare P19) è ampiamente utilizzata per studiare il meccanismo molecolare della neurogenesi con grande semplificazione rispetto all'analisi in vivo. Qui, presentiamo un protocollo per la neurogenesi indotta da acido retinoico nella linea cellulare P19.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La linea cellulare P19 derivata da un teratocarcinoma derivato da un embrione di topo ha la capacità di differenziarsi nei tre strati germinali. In presenza di acido retinoico (RA), la linea cellulare P19 coltivata in sospensione è indotta a differenziarsi in neuroni. Questo fenomeno è ampiamente studiato come un modello di neurogenesi in vitro. Pertanto, la linea cellulare P19 è molto utile per gli studi molecolari e cellulari associati alla neurogenesi. Tuttavia, i protocolli per la differenziazione neuronale della linea cellulare P19 descritti nella letteratura sono molto complessi. Il metodo sviluppato in questo studio è semplice e giocherà un ruolo nel chiarire i meccanismi molecolari nelle anomalie del neurosviluppo e nelle malattie neurodegenerative.

Introduction

Durante lo sviluppo embrionale, uno strato a cella singola viene trasformato in tre strati germinali separati1,2,3. Per aumentare le possibilità di ricerca dei fenomeni che si verificano in vivo, la generazione di aggregati tridimensionali (corpi embrionali) è stata sviluppata come un modello conveniente. Gli aggregati cellulari formati in questo modo possono essere esposti a varie condizioni causando differenziazione cellulare, che riflettono lo sviluppo dell'embrione4,5. La linea cellulare p19 murina carcinoma embrionale (linea cellulare P19) è comunemente usata come modello cellulare per studi di neurogenesi in vitro6,7,8. La linea cellulare P19 presenta le caratteristiche tipiche delle cellule staminali pluripotenti e può differenziarsi in neuroni in presenza di acido retinoico (RA) durante l'aggregazione cellulare seguita da escrescenza neurite in condizioni aderenti. Inoltre, la linea cellulare P19 indifferenziata è anche in grado di formare cellule muscolo-e cardiomiociti-come sotto l'influenza di solforo dimetilo (DMSO)9,10,11,12.

Molti metodi13,14,15,16 sono stati segnalati per la differenziazione neuronale, ma la metodologia è a volte complicata e non facile da comprendere leggendo solo le descrizioni. Ad esempio, i protocolli a volte richiedono una combinazione del mezzo DMEM (Modified Eagle Medium) di Dulbecco,minedante, integrato con una miscela di siero di vitello (CS) e siero bovino fetale (FBS)13. Inoltre, i media utilizzati per lo sviluppo neuronale sono spesso composti da Neurobasal e B27 integratori13,14,15,16. Come tale, i metodi esistenti contengono complessità nella loro preparazione e il nostro obiettivo qui è quello di semplificare i protocolli. In questo studio, abbiamo dimostrato che DMEM con FBS può essere utilizzato per mantenere la linea cellulare P19 (DMEM - 10% FBS) così come per lo sviluppo neuronale (DMEM - 5% FBS - RA). Questo metodo semplificato per la neurogenesi utilizzando la linea cellulare P19 ci permette di studiare il meccanismo molecolare di come vengono sviluppati i neuroni. Inoltre, la ricerca sulle malattie neurodegenerative come il morbo di Alzheimer è condotta anche utilizzando la linea cellulare P1917,18, e crediamo che il metodo sviluppato in questo studio giocherà un ruolo nel chiarire il meccanismi molecolari nelle anomalie del neurosviluppo e nelle malattie neurodegenerative.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Manutenzione della cultura

  1. Cultura la linea cellulare P19 in Maintenance Medium (il mezzo di Aquila modificato di Dulbecco con 4.500 mg/L di glucosio integrato con 10% FBS, 100 unità / mL penicillina e 100 unità / mL streptomicina). Incubare a 37 gradi centigradi e il 5% di CO2.

2. Cellule sottocoltura

  1. Quando le cellule raggiungono circa l'80% di confluenza, rimuovere il mezzo esaurito dai flaconi di coltura cellulare (superficie 25 cm2).
  2. Lavare le cellule con 2 mL di fosfato tamponato salina (PBS) senza calcio e magnesio.
  3. Aggiungere 1 mL di 0,25% di trypsin-EDTA (acido etilenediaminetracetico) sul monostrato cellulare.
  4. Mettere il pallone nell'incubatrice di CO2 (37 e 5% CO2)per 2-3 min.
  5. Valutare l'attaccamento cellulare alla superficie del pallone. Assicurarsi che tutte le celle siano scollegate e galleggianti nel mezzo.
  6. Aggiungere 9 mL di Manutenzione Media per interrompere l'attività ezimatica della trypsin.
  7. Risospendere le celle in Maintenance Medium.
  8. Trasferire le cellule in un tubo da 15 mL e centrifugare per 5 min a 200 x g e temperatura ambiente (RT).
  9. Scartare il supernatante e aggiungere 10 mL di fresco mezzo di manutenzione nel tubo da 15 mL.
  10. Utilizzare la sospensione cellulare per determinare il numero di cella utilizzando un contatore di celle in base alle istruzioni del produttore.
  11. Cellule di semi a 2 x 104 cellule/cm2 in un nuovo flacone di 25 cm2.
  12. Aggiungere il mezzo di manutenzione fino a 10 mL.
  13. Mettere il pallone con le cellule nell'incubatrice di CO2 (37 e 5% di CO2)per 2-3 giorni.

3. Digestione di Trypsin

  1. Mezzo di manutenzione aspirato dal pallone cellulare. Lavare le cellule una volta con 2 mL di calcio e PBS senza magnesio.
  2. Aggiungere 1 mL di 0,25% trypsin-EDTA.
  3. Mettere il flacone con le cellule nell'incubatrice di CO2 a 37 gradi centigradi per 2-3 min.
  4. Utilizzare 1 mL pipette per dissociare le cellule convogliando le cellule dieci volte.
  5. Neutralizza la trippsina aggiungendo 9 mL di Differentiation Medium (il mezzo di Eagle modificato di Dulbecco con 4500 mg/L di glucosio integrato con 5% FBS, 100 unità / mL penicillina e 100 unità / streptomicina) senza RA alle cellule.
  6. Trasferire le cellule in un tubo da 15 mL e centrifugare per 5 min a 200 x g e RT.
  7. Scartare il supernatante e aggiungere 1 mL di Differenziazione Media senza acido retinoico (RA). Risospendere il pellet cellulare.
  8. Utilizzare la sospensione cellulare per determinare il numero di cella utilizzando un contatore di celle in base alle istruzioni del produttore.

4. Generazione aggregata

  1. Aggiungete 5-L di RA (1 mM disciolto nel 99,8% di etanolo, immagazzinato a -20 gradi centigradi) ai 10 mL di Differenziazione Media e mescolate bene (concentrazione finale di 0,5 gradi RA).
    NOT: L'AR è sensibile alla luce. La bassa concentrazione di EtOH non influisce sulla differenziazione cellulare19,20,21.
  2. Aggiungere 10 mL di Mezzo di differenziazione (con RA) al piatto di coltura non trattato di 100 mm (dedicato alla coltura delle sospensioni).
  3. Seme 1 x 106 celle nel piatto da 100 mm (area di superficie del piatto 56,5 cm2).
  4. Mettere il pallone con le cellule nell'incubatrice a 37 e 5% di CO2 per 2 giorni al fine di promuovere la formazione di aggregati.
  5. Dopo 2 giorni, scambiare il mezzo di differenziazione. Mezzo aspirato contenente aggregati utilizzando una pipetta da 10 mL e trasferito in un tubo da 15 mL a RT.
  6. Lasciare che gli aggregati si stabilizzino per gravità per 1,5 min a RT.
  7. Scartare il super-attardato.
  8. Aggiungere un nuovo 10 mL di differenziazione Media con 0,5 M RA utilizzando una pipetta sierologica da 10 mL.
    ATTENZIONE: Non pipette la cella aggrega su e giù.
  9. Seme gli aggregati in nuovo piatto di coltura non trattata 100 mm (dedicato alla coltura delle sospensioni).
  10. Collocare la piastra nell'incubatrice (a 37gradi centigradi e al 5% di CO 2) per 2 giorni.

5. Dissociazione aggregato

  1. Aspirare gli aggregati cellulari utilizzando una pipetta da 10 mL.
  2. Trasferire gli aggregati in un tubo da 15 mL. Consentire agli aggregati cellulari di stabilirsi per gravità per 1,5 min.
  3. Togliete il super-acletterante.
  4. Lavare gli aggregati con DMEM da solo (senza siero e antibiotici).
  5. Consentire agli aggregati cellulari di stabilirsi per sedimentazione gravitazionale per 1,5 min a RT.
  6. Aspirare il supernatante e aggiungere 2 mL di trypsin-EDTA (0,25%).
  7. Mettere gli aggregati cellulari in un bagno d'acqua (37 gradi centigradi) per 10 min. Agitte gli aggregati delicatamente ogni 2 min toccando con una mano.
  8. Interrompere il processo di prova con l'aggiunta di 4 mL di Manutenzione Media.
  9. Pipette si aggrega su e giù 20 volte utilizzando 1 mL pipette.
  10. Centrifuga cellule per 5 min a 200 x g e RT.
  11. Rimuovere il supernatante e risospendere il pellet cellulare in 5 mL di Manutenzione Media.
  12. Determinare il numero di cella con un contatore di celle.

6. Cellule di placcatura

  1. Aggiungere 3 mL per pozzetto di Manutenzione Media a una piastra a 6 pozzetti.
  2. Cellule di semi nella piastra di coltura a 6 pozze a una densità di 0,5 x 106/well.
  3. Incubare a 37 gradi centigradi con concentrazione di CO2 del 5%.
  4. Semina le cellule sul vetro di copertura in 6 piastra di coltura del pozzo ed esegue l'immunostaining con anticorpi anti-MAP2 (20% di confluenza). Utilizzare la piastra 6-well per isolare l'RNA ed eseguire RT-PCR per Map2, NeuN, Oct4, Nanoge Gapdh (20% di confluenza).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Lo schema semplificato del protocollo per l'induzione della neurogenesi nella linea cellulare P19 è presentato nella Figura 1. Per definire il carattere della linea cellulare P19 in uno stato indifferenziato e durante la neurogenesi, è stato utilizzato il metodo RT-PCR (reverse transcription-polymerase chain reaction). La linea cellulare P19 indifferenziata esprimeva i geni di pluripotenza come cation organica/carnitina trasportatore4 (Oct4) e Omeobox Nanog (Nanog). La neurogenesi indotta dall'aggregazione delle cellule nella coltura delle sospensioni in presenza di RA ha portato ad una rapida diminuzione dell'espressione di Oct4 e Nanog. Al contrario, l'espressione dei marcatori neuronali: proteina associata ai microtubuli 2 (Map2), NeuN (nota anche come proteina legante all'RNA, omologa volpe 3 (Rbfox3)) è aumentata dopo la neurogenesi innescata (Figura 2)6 ,14,15,22. I primer utilizzati per ogni gene sono indicati insieme alle sequenze nucleotidiche e alle dimensioni del prodotto nella Tabella 1. Un'immagine microscopica della linea cellulare P19 indifferenziata presentava una morfologia a forma rotonda (Figura 3A). Dopo l'induzione della neurogenesi, la struttura neuronale delle cellule era chiaramente visibile 4 giorni dopo la placcatura (Figura 3B). Inoltre, Figura 4 rappresenta l'immagine a fluorescenza dell'espressione MAP2 nella linea di celle P19 differenziata (4 giorni dopo le celle di placcatura)14.

Figure 1
Figura 1 : Schema del protocollo per l'induzione della neurogenesi nelle cellule carcinoma embrionale P19. La neurogenesi viene indotta coltindo la linea cellulare P19 in un piatto di coltura non trattato di 100 mm con il 5% di FBS e 0,5 M DI RA. Dopo 4 giorni, gli aggregati cellulari vengono dissociati con la trypsina e semizzati sulla piastra di coltura cellulare aderente per i successivi 4 giorni. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 : cambiamenti dell'espressione genica nella linea cellulare P19. Il grafico a banda rappresenta l'espressione genica per la linea cellulare P19 indifferenziata (Oct4, Nanog) e durante la neurogenesi (Map2, NeuN). La gliceraldeide-3-fosfato dehydrogenase (Gapdh) è stata utilizzata come gene di riferimento. I campioni vengono caricati nel gel di agarose (1,5%) in doppie repliche. Abbreviazioni: Indifferenziato rappresenta la linea cellulare P19 indifferenziata senza trattamento RA; Giorno 1-4 rappresenta i giorni successivi dopo la placcatura cellulare- dopo 4 giorni dopo il trattamento RA e la fase di aggregazione cellulare. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 : Immagini rappresentative dell'analisi della linea cellulare P19. (A) Immagini microscopiche chiare di linea cellulare P19 indifferenziata. (B) Immagini microscopiche leggere della linea cellulare P19 dopo 4 giorni di neurogenesi- dopo 4 giorni dopo il trattamento ra e lo stadio di aggregazione cellulare. Barra di scala: 100 m. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4 : immagine immunofluoreescenza rappresentativa della linea cellulare P19 differenziata. Immagine di immunofluorescenza risultante dalla placcatura P19 macchiata con anti-MAP2 e DAPI a 4 giorni dalla placcatura. Barra di scala: 100 m. Fare clic qui per visualizzare una versione più grande di questa figura.

testo elementare Sequenza primer prodotto
dimensione (bp)
Gapdh F: TGACCTCAACTACATGGTCTACA
R: CTTCCCATCTCTCGGCCTG
85 (in questo stato del sistema
Mappa2 F: GCTGAGATCATCACACAGTC
R: TCCTGCCAAGAGCTCATGCC
211 Del 241
Ottobre4 F: GGCGTTCTCTTTGGAAAGGTTC
R: CTCGAACCACATCCTCTCT
313 Mi lasa 34 del 2
Neun F: GGCAAATGTTCGGGCAATTCG
R: TCAATTTTCCGTCCCTTAC
160
Nanog F: AAAGGATGAAGTGCAAGCGGTGG
R: CTGGCTTTGCCCTGACTTTAAGC
520 anni

Tabella 1: Primer utilizzati per RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Qui, descriviamo un semplice protocollo per la neurogenesi usando la linea cellulare P19. Anche se molti rapporti sono stati pubblicati a questo proposito, una metodologia dettagliata per l'induzione della neurogenesi utilizzando la linea cellulare P19 rimane poco chiara. Inoltre, abbiamo utilizzato un semplice mezzo DMEM ad alto glucosio (4.500 mg/L) con 10% FBS per l'intero esperimento. Questo ci ha permesso di eseguire l'esperimento neurogenico in modo user-friendly ed espandere l'uso di questo metodo per il futuro.

I punti più critici all'interno di questo protocollo sono la concentrazione di RA e la generazione di aggregati cellulari nella coltura delle sospensioni. La stimolazione della neurogenesi nella linea cellulare P19 può essere effettuata senza la formazione di aggregati, ma il numero di cellule neuronali prodotte sarà ridotto di due terzi nella coltura cellulare22. Monzo e altri hanno mostrato l'induzione della neurogenesi nella linea cellulare P19 coltendoli nel monostrato15. Anche se il loro metodo è abbastanza conveniente in quanto possiamo eliminare il processo di coltura delle sospensioni, sono necessari ulteriori studi per confrontare il loro metodo con altri metodi ben descritti. La concentrazione di RA di 0,5 M nel mezzo ha prodotto un elevato numero di aggregati cellulari, nonché neuroni dopo la placcatura rispetto a 1 M di RA. È anche importante notare che non abbiamo potuto osservare una neurogenesi efficiente quando la maggior parte degli aggregati sono attaccati al fondo del piatto di coltura delle sospensioni durante il trattamento con RA. Il numero ottimale della linea cellulare P19 da utilizzare all'inizio della procedura è 1 x 106 per ogni 10 mL di Differenziazione Media. Durante l'induzione della neurogenesi, la linea cellulare P19 forma aggregati di dimensioni variabili e anche singole cellule si trovano nella coltura. Per superare questo problema, abbiamo raccolto gli aggregati cellulari dopo 1,5 min di caduta libera in un tubo da 15 mL. Abbiamo scoperto che questo approccio consente l'esclusione della contaminazione di singole cellule. Si raccomanda inoltre di eseguire l'arricchimento neuronale con la coltura cellulare utilizzando farmaci anti-mitotici (ad esempio, citosina arabinoside) per la coltura a lungo termine per inibire l'ampia proliferazione delle cellule gliali23.

I neuroni derivati dalla linea cellulare P19 esprimono i recettori del glutammato ionotropico di entrambi i tipi di n-metil-d-aspartate (NMDA) e alfa-amino-3-idrossi-5-metil-4-isoxazole (AMPA)/kainite (KA) di tipo24,25, recettori funzionali dell'acido-aminobutyrico (GABA)25. Pertanto, la linea cellulare P19 è ampiamente utilizzata negli studi sui meccanismi molecolari che regolano la differenziazione neuronale26,27,28. Ancora più importante, lo sviluppo del tumore non è stato osservato dopo il trapianto di cellule29,30.

A tal fine, la ricerca sulle malattie neurodegenerative come il morbo di Alzheimer17,18 è condotta anche utilizzando la linea cellulare P19, e crediamo che il metodo sviluppato in questo studio giocherà quindi un ruolo nel chiarire la molecolare nelle anomalie del neurosviluppo e nelle malattie neurodegenerative.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Lo studio è stato sostenuto finanziariamente dal Centro nazionale di scienze, Polonia (n. di sovvenzione. UMO-2017/25/N/N/N-N/3/01886) e KNOW (Leading National Research Centre) Consorzio scientifico "Animale sano - Cibo sicuro", decisione del Ministero della Scienza e dell'Istruzione Superiore n. 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics