Neurogênese usando células de Carcinoma embrionário P19

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

A linha celular da carcinoma embrionária do rato P19 (linha celular P19) é amplamente utilizada estudando o mecanismo molecular da neurogênese com grande simplificação comparada à análise in vivo. Aqui, nós apresentamos um protocolo para o neurogênese ácido-induzido retinóico na linha celular P19.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A linha celular P19 derivada de um teratocarcinoma embrião-derivado do rato tem a habilidade de diferenciar-se nas três camadas do germe. Na presença de ácido retinóico (RA), a suspensão cultivada linha celular P19 é induzida para diferenciar em neurônios. Este fenômeno é extensivamente investigado como um modelo de neurogênese in vitro. Portanto, a linha celular P19 é muito útil para estudos moleculares e celulares associados à neurogênese. Entretanto, os protocolos para a diferenciação neuronal da linha celular de P19 descritos na literatura são muito complexos. O método desenvolvido neste estudo é simples e vai desempenhar um papel na elucidatação dos mecanismos moleculares em anormalidades NEURODESENVOLVIMENTAIS e doenças neurodegenerativas.

Introduction

Durante o desenvolvimento embrionário, uma única camada de células é transformada em três camadas germinativas separadas1,2,3. Para aumentar as possibilidades de pesquisa de fenômenos ocorridos in vivo, a geração de agregados tridimensionais (corpos embrionários) tem sido desenvolvida como um modelo conveniente. Agregados celulares formados dessa forma podem ser expostos a várias condições que causam diferenciação celular, o que reflete o desenvolvimento do embrião4,5. A linha celular de Carcinoma embrionário P19 murino (linha celular P19) é comumente utilizada como modelo celular para estudos de neurogênese in vitro6,7,8. A linha celular P19 apresenta características de células-tronco pluripotentes típicas e pode diferenciar-se em neurônios na presença de ácido retinóico (RA) durante a agregação celular seguida de crescimento de neurite condições aderentes. Além disso, a linha celular P19 não diferenciada também é capaz de formar células do tipo músculo e cardiomiócitos a influência do dimetil sulfóxido (DMSO)9,10,11,12.

Muitos métodos13,14,15,16 foram relatados para a diferenciação neuronal, mas a metodologia é às vezes complicada e nao fácil de agarrar somente lendo as descrições. Por exemplo, os protocolos às vezes requerem uma combinação do meio modificado de águia de Dulbecco (DMEM) suplementado com uma mistura de soro de bezerro (CS) e soro fetal bovino (FBS)13. Além disso, os meios usados para o desenvolvimento neuronal são compor frequentemente de suplementos de neurobasal e de B2713,14,15,16. Como tal, os métodos existentes contêm complexidade em sua preparação e nosso objetivo aqui é simplificar os protocolos. Neste estudo, Nós demonstramos que DMEM com FBS pode ser utilizado para manter a linha celular P19 (DMEM + 10% FBS) assim como para o desenvolvimento neuronal (DMEM + 5% FBS + RA). Este método simplificado para a neurogênese usando a linha celular P19 nos permite estudar o mecanismo molecular de como os neurônios são desenvolvidos. Além disso, pesquisas sobre doenças neurodegenerativas, como a doença de Alzheimer, também são conduzidas usando P19 celular linha17,18, e acreditamos que o método desenvolvido neste estudo vai desempenhar um papel na elucidatação da mecanismos moleculares em anormalidades NEURODESENVOLVIMENTAIS e doenças neurodegenerativas.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. manutenção da cultura

  1. Cultura da linha celular P19 em meio de manutenção (Dulbecco ' s modificado meio Eagle ' s com 4.500 mg/L de glicose suplementada com 10% FBS, 100 unidades/mL de penicilina e 100 unidades/mL de estreptomicina). Incubar a 37 ° c e 5% CO2.

2. sub-culturas de células

  1. Quando as células atingem aproximadamente 80% de confluência, retire o meio gasto das garrafas de cultura celular (área de superfície 25 cm2).
  2. Lave as células com 2 mL de solução salina tamponada com fosfato (PBS) livre de cálcio e magnésio.
  3. Adicione 1 mL de 0,25% de tripsina-EDTA (ácido etilenodiaminotetracético) na monocamada celular.
  4. Coloque o balão na incubadora CO2 (37 ° c e 5% co2) por 2-3 min.
  5. Avalie o acessório da célula na superfície do balão. Certifique-se de que todas as células são desanexadas e flutuantes no meio.
  6. Adicione 9 mL de meio de manutenção para interromper a atividade enzimática da tripsina.
  7. Ressuscitem as células em meio de manutenção.
  8. Transfira as células para um tubo de 15 mL e centrifugue por 5 min a 200 x g e temperatura ambiente (RT).
  9. Descarte o sobrenadante e adicione 10 mL de meio de manutenção fresco no tubo de 15 mL.
  10. Use a suspensão da célula para determinar o número da célula usando um contador de células de acordo com as instruções do fabricante.
  11. Células de semente a 2 x 104 células/cm2 em um novo balão de 25 cm2 .
  12. Adicione o meio de manutenção até 10 mL.
  13. Coloque o balão com células na incubadora CO2 (37 ° c e 5% co2) por 2-3 dias.

3. digestão de tripsina

  1. Aspirar o meio de manutenção do balão celular. Lave as células uma vez com 2 mL de PBS de cálcio e livre de magnésio.
  2. Adicionar 1 mL de 0,25% de tripsina-EDTA.
  3. Coloque o balão com células na incubadora CO2 a 37 ° c por 2-3 min.
  4. Utilize uma pipeta de 1 mL para dissociar as células com pipetagem dez vezes.
  5. Neutralize a tripsina adicionando 9 mL de meio de diferenciação (o meio de Eagle modificado de Dulbecco com 4500 mg/L de glicose suplementado com 5% FBS, 100 unidades/mL de penicilina e 100 unidades/mL de estreptomicina) sem RA para as células.
  6. Transfira as células para um tubo de 15 mL e centrifugue por 5 min a 200 x g e RT.
  7. Descarte o sobrenadante e adicione 1 mL de meio de diferenciação sem ácido retinóico (RA). Ressuscitem o pellet celular.
  8. Use a suspensão celular para determinar o número da célula usando um contador de células de acordo com a instrução do fabricante.

4. geração agregada

  1. Adicionar 5 μL de ar (1 mM de estoque dissolvido em 99,8% etanol, armazenado a-20 ° c) para o 10 mL de meio de diferenciação e misture bem (concentração final de 0,5 μM RA).
    Nota: RA é sensível à luz. A baixa concentração de EtOH não afeta a diferenciação celular19,20,21.
  2. Adicionar 10 mL de meio de diferenciação (com RA) ao prato de cultura não tratada de 100 mm (dedicado à cultura de suspensão).
  3. Semeie as 1 x 106 células no prato de 100 mm (prato área de superfície 56,5 cm2).
  4. Coloque o balão com células na incubadora a 37 ° c e 5% CO2 por 2 dias, a fim de promover a formação de agregados.
  5. Após 2 dias, troque o meio de diferenciação. Meio aspirado contendo agregados usando uma pipeta de 10 mL e transferência para um tubo de 15 mL em RT.
  6. Permitir que os agregados para resolver por gravidade para 1,5 min em RT.
  7. Descarte o sobrenadante.
  8. Adicionar um novo 10 mL de meio de diferenciação com 0,5 μM de RA utilizando uma pipeta serológica de 10 mL.
    Atenção: Não pipete os agregados celulares para cima e para baixo.
  9. Semeie os agregados em um novo prato de cultura não tratado de 100 mm (dedicado à cultura de suspensão).
  10. Coloque a placa na incubadora (a 37 ° c e 5% CO2) durante 2 dias.

5. dissociação de agregados

  1. Aspirar os agregados celulares usando uma pipeta de 10 mL.
  2. Transfira os agregados para um tubo de 15 mL. Permitir que a célula agregados para resolver por gravidade para 1,5 min.
  3. Retire o sobrenadante.
  4. Lave os agregados com DMEM isoladamente (sem soro e antibiótico).
  5. Permita que os agregados da pilha estabelecam-se pela sedimentação da gravidade para 1,5 minutos no RT.
  6. Aspirar o sobrenadante e adicionar 2 mL de tripsina-EDTA (0,25%).
  7. Coloque os agregados celulares em um banho de água (37 ° c) por 10 min. agitar os agregados suavemente a cada 2 min tocando com uma mão.
  8. Interrompa o processo de tripsinização adicionando 4 ml de meio de manutenção.
  9. A pipeta agrega para cima e para baixo 20 vezes usando a pipeta de 1 mL.
  10. Células centrífugas por 5 min a 200 x g e RT.
  11. Retire o sobrenadante e ressuscitem o pellet celular em 5 mL de meio de manutenção.
  12. Determine o número da célula com um contador de células.

6. células de chapeamento

  1. Adicionar 3 mL por poço de meio de manutenção a uma placa de 6 poços.
  2. Células de semente na placa de cultura de 6 poços em uma densidade de 0,5 x 106/well.
  3. Incubar a 37 ° c com concentração de 5% de CO2 .
  4. Semente as pilhas no vidro da tampa na placa da cultura de 6 poços e executam a imunomarcação com anticorpo MAP2 (confluência de 20%). Use a placa 6-well para isolar o RNA e para executar RT-PCR para map2, Neun, Oct4, NANOG, e GAPDH (confluência de 20%).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

O esquema simplificado de protocolo para indução de neurogênese em linha celular P19 é apresentado na Figura 1. Para definir o caráter da linhagem celular P19 em um estado indiferenciado e durante a neurogênese, utilizou-se o método RT-PCR (reação em cadeia da transcrição-polimerase reversa). A linha celular P19 não diferenciada expressou os genes de pluripotência como cátion orgânico/carnitina transporter4 (Oct4) e NANOG homeobox (NANOG). A neurogênese induzida pela agregação de células em cultura de suspensão na presença de ar levou a uma rápida diminuição da expressão de Oct4 e NANOG . Em contrário, a expressão de marcadores de neurônio: proteína 2 associada a microtúse (map2), Neun (também conhecida como proteína de ligação de RNA, Fox-1 homólogo 3 (Rbfox3)) aumentou após a neurogênese desencadeada (Figura 2)6 ,14,15,22. Os primers utilizados para cada gene são indicados juntamente com as sequências nucleotídicas e o tamanho do produto na tabela 1. Uma imagem microscópica da linha celular P19 não diferenciada apresentou morfologia arredondada (Figura 3a). Após a indução da neurogênese, a estrutura neuronal das pilhas era claramente visível 4 dias após o chapeamento (Figura 3B). Além disso, a Figura 4 representa a imagem de fluorescência da expressão map2 na linha celular P19 diferenciada (4 dias após as células do chapeamento)14.

Figure 1
Figura 1 : Esquema de protocolo para indução de neurogênese em células de Carcinoma embrionário P19. A neurogênese é induzida pela cultura da linha celular P19 em um prato de cultivo não tratado de 100 mm com 5% de FBS e 0,5 μM de RA. Após 4 dias, os agregados da pilha são dissociados com tripsina e semeado na placa aderente da cultura de pilha para seguir próximos 4 dias. Por favor clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : Alterações da expressão gênica na linha celular P19. O gráfico de banda representa a expressão gênica para a linha celular P19 não diferenciada (Oct4, NANOG) e durante a neurogênese (map2, Neun). O gliceraldeído-3-fosfato desidrogenase (GAPDH) foi utilizado como gene de referência. As amostras são carregadas no gel do agarose (1,5%) em repetições duplas. Abreviaturas: indiferenciada representa a linha celular P19 não diferenciada sem tratamento com ar; O dia 1-4 representa dias subseqüentes após o chapeamento de pilha-após 4 dias após o tratamento do RA e fase da agregação da pilha. Por favor clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Imagens representativas da análise da linha celular P19. (A) luz imagens microscópicas de linha celular P19 indiferenciada. (B) luz imagens microscópicas de P19 linha celular após 4 dias de neurogênese-após 4 dias após o tratamento ra e fase de agregação celular. Barra de escala = 100 μm. por favor clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4 : Imagem representativa da imunofluorescência da linha celular P19 diferenciada. A imagem fundida da imunofluorescência da linha celular P19 manchou com o anti-MAP2 e o DAPI em 4 dias após o chapeamento. Barra de escala = 100 μm. por favor clique aqui para ver uma versão maior desta figura.

Primer Sequência de primer Produto
tamanho (BP)
GAPDH F: TGACCTCAACTACATGGTCTACA
R: CTTCCCATTCTCGGCCTTG
85
Map2 F: GCTGAGATCATCACACAGTC
R: TCCTGCCAAGAGCTCATGCC
211
Oct4 F: GGCGTTCTCTTTGGAAAGGTGTTC
R: CTCGAACCACATCCTTCTCT
313
Neun F: GGCAAATGTTCGGGCAATTCG
R: TCAATTTTCCGTCCCTCTACGAT
160
NANOG F: AAAGGATGAAGTGCAAGCGGTGG
R: CTGGCTTTGCCCTGACTTTAAGC
520

Tabela 1: primers utilizados para RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Aqui, nós descrevemos um protocolo simples para a neurogênese usando a linha celular P19. Embora muitos relatórios tenham sido publicados a este respeito, uma metodologia detalhada para a indução da neurogênese usando a linha celular P19 permanece obscura. Além disso, utilizou-se um meio DMEM de glicose (4.500 mg/L) de alta simples com 10% de FBS para todo o experimento. Isso nos permitiu realizar o experimento neurogênico de forma amigável e ampliar o uso desse método para o futuro.

Os pontos mais críticos dentro deste protocolo são a concentração de ar, bem como a geração de agregados celulares na cultura de suspensão. A estimulação da neurogênese na linha celular P19 pode ser realizada sem a formação de agregados, mas o número de células neuronais produzidas será reduzido em dois terços na cultura celular22. Monzo et al. mostraram indução de neurogênese em linha celular de P19, cultivando-as em monocamada15. Embora seu método seja bastante conveniente, pois podemos eliminar o processo de cultura de suspensão, estudos adicionais são necessários para comparar seu método com outros métodos bem descritos. A concentração de ar de 0,5 μM no meio produziu um elevado número de agregados celulares, bem como os neurônios após o revestimento, em comparação com 1 μM de RA. Também é importante notar que não pudemos observar uma neurogênese eficiente quando a maioria dos agregados são anexados ao fundo do prato de cultura de suspensão durante o tratamento de ar. O número ideal da linha celular P19 a ser usado no início do procedimento é 1 x 106 para cada 10 ml de meio de diferenciação. Durante a indução da neurogênese, a linha celular P19 forma variados agregados de tamanho e até mesmo células únicas são encontradas na cultura. Para superar esse problema, coletamos os agregados celulares após 1,5 min de queda livre em um tubo de 15 mL. Verificou-se que esta abordagem permite a exclusão da contaminação de células individuais. Também é recomendável realizar o enriquecimento neuronal com a cultura celular usando drogas antimitóticas (por exemplo, citosina arabinoside) para a cultura de longo prazo para inibir a proliferação extensiva de células gliais23.

Os neurônios derivados da linha celular P19 expressam receptores de glutamato ionotrópico de ambos os tipos de N-metil-D-aspartato (NMDA) e alfa-amino-3-hidroxi-5-metil-4-isoxazol (AMPA)/kainite (ka)24,25, bem como receptores funcionais de ácido γ-aminobutírico (GABA)25. Portanto, a linha celular P19 é amplamente utilizada nos estudos sobre mecanismos moleculares que regem a diferenciação neuronal26,27,28. Mais importante ainda, o desenvolvimento tumoral não foi observado após o transplante celular29,30.

Para isso, pesquisas sobre doenças neurodegenerativas, como a doença de Alzheimer17,18 , também são conduzidas usando a linha celular P19, e acreditamos que o método desenvolvido neste estudo desempenhe um papel para elucidar a em anormalidades NEURODESENVOLVIMENTAIS e doenças neurodegenerativas.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

O estudo foi apoiado financeiramente pelo National Science Centre, Polónia (n º de subvenção. UMO-2017/25/N/NZ3/01886) e KNOW (Centro Nacional de pesquisa líder) consórcio científico "alimentos saudáveis para animais seguros", decisão do Ministério da ciência e do ensino superior n º 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics