Neurogénesis con células de carcinoma embrionario P19

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

La línea celular de carcinoma embrionario de ratón P19 (línea celular P19) es ampliamente utilizada para estudiar el mecanismo molecular de la neurogénesis con gran simplificación en comparación con el análisis in vivo. Aquí, presentamos un protocolo para la neurogénesis inducida por ácido retinoico en la línea celular P19.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La línea celular P19 derivada de un teratocarcinoma derivado del embrión de ratón tiene la capacidad de diferenciarse en las tres capas germinales. En presencia de ácido retinoico (RA), la línea celular P19 cultivada en suspensión se induce a diferenciarse en las neuronas. Este fenómeno se investiga ampliamente como un modelo de neurogénesis in vitro. Por lo tanto, la línea celular P19 es muy útil para estudios moleculares y celulares asociados con la neurogénesis. Sin embargo, los protocolos para la diferenciación neuronal de la línea celular P19 descrita en la literatura son muy complejos. El método desarrollado en este estudio es sencillo y desempeñará un papel en la esclarecimiento de los mecanismos moleculares en anomalías del neurodesarrollo y enfermedades neurodegenerativas.

Introduction

Durante el desarrollo embrionario, una sola capa celular se transforma en tres capas de gérmenes separadas1,2,3. Para aumentar las posibilidades de investigación de los fenómenos que ocurren in vivo, la generación de agregados tridimensionales (cuerpos embrionarios) se ha desarrollado como un modelo conveniente. Los agregados celulares formados de esta manera pueden ser expuestos a diversas condiciones que causan diferenciación celular, que reflejan el desarrollo del embrión4,5. La línea celular de carcinoma embrionario de murine P19 (línea celular P19) se utiliza comúnmente como modelo celular para estudios de neurogénesis in vitro6,7,8. La línea celular P19 presenta características típicas de células madre pluripotentes y puede diferenciarse en neuronas en presencia de ácido retinoico (RA) durante la agregación celular seguida de un crecimiento de neurita en condiciones adherentes. Además, la línea celular P19 indiferenciada también es capaz de formar células similares a los músculos y cardiomiocitos bajo la influencia de dimetil sulfóxido (DMSO)9,10,11,12.

Muchos métodos13,14,15,16 se han reportado para la diferenciación neuronal, pero la metodología a veces es complicada y no es fácil de entender sólo leyendo las descripciones. Por ejemplo, los protocolos a veces requieren una combinación del medio de águila modificada (DMEM) de Dulbecco complementado con una mezcla de suero de ternero (CS) y suero bovino fetal (FBS)13. Por otra parte, los medios utilizados para el desarrollo neuronal se componen a menudo de Neurobasal y B27 suplementos13,14,15,16. Como tal, los métodos existentes contienen complejidad en su preparación y nuestro objetivo aquí es simplificar los protocolos. En este estudio, demostramos que DMEM con FBS se puede utilizar para mantener la línea celular P19 (DMEM + 10% FBS) así como para el desarrollo neuronal (DMEM + 5% FBS + RA). Este método simplificado para la neurogénesis utilizando la línea celular P19 nos permite estudiar el mecanismo molecular de cómo se desarrollan las neuronas. Por otra parte, la investigación sobre enfermedades neurodegenerativas como la enfermedad de Alzheimer también se lleva a cabo utilizando P19 célula según la línea17,18, y creemos que el método desarrollado en este estudio desempeñará un papel en el esclarecimiento de la mecanismos moleculares en anomalías del neurodesarrollo y enfermedades neurodegenerativas.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Mantenimiento de la cultura

  1. Cultivo de la línea celular P19 en medio de mantenimiento (medio eagle modificado de Dulbecco con 4.500 mg/L de glucosa complementada con 10% FBS, 100 unidades/ml de penicilina y 100 unidades/ml de estreptocina). Incubar a 37oC y 5% CO2.

2. Células de cultivo sub-cultivo

  1. Cuando las células alcancen aproximadamente el 80% de confluencia, retire el medio gastado de los matraces de cultivo celular (área de superficie 25 cm2).
  2. Lavar las células con 2 ml de solución salina tamponada de fosfato (PBS) libre de calcio y magnesio.
  3. Añadir 1 mL de 0,25% de trippsina-EDTA (ácido etilendiaminetetraacético) a la monocapa celular.
  4. Colocar el matraz en la incubadora de CO2 (37oC y 5% CO2)durante 2-3 min.
  5. Evalúe el accesorio de la célula a la superficie del matraz. Asegúrese de que todas las celdas estén separadas y flotando en el medio.
  6. Añadir 9 ml de medio de mantenimiento para detener la actividad enzimática de la trippsina.
  7. Resuspenda las celdas en el medio de mantenimiento.
  8. Transfiera las células a un tubo de 15 ml y centrífuga durante 5 min a 200 x g y temperatura ambiente (RT).
  9. Deseche el sobrenadante y agregue 10 ml de medio de mantenimiento fresco en el tubo de 15 ml.
  10. Utilice la suspensión celular para determinar el número de celda utilizando un contador de celdas de acuerdo con las instrucciones del fabricante.
  11. Células de semillas a 2 x 104 células/cm2 en un nuevo matraz de 25 cm2.
  12. Agregue el medio de mantenimiento hasta 10 mL.
  13. Coloque el matraz con células en la incubadora de CO2 (37oC y 5% CO2)durante 2-3 días.

3. Digestión de trippsina

  1. Aspirar medio de mantenimiento del matraz de la célula. Lave las células una vez con 2 ml de PBS sin calcio y magnesio.
  2. Añadir 1 mL de 0,25% de trippsina-EDTA.
  3. Coloque el matraz con células en la incubadora de CO2 a 37oC durante 2-3 min.
  4. Utilice una pipeta de 1 ml para disociar las células pipeteando las células diez veces.
  5. Neutralice la trippsina añadiendo 9 ml de medio de diferenciación (medio de águila modificado de Dulbecco con 4500 mg/L de glucosa suplementada con 5% DE FBS, 100 unidades/ml de penicilina y 100 unidades/ml de estreptomicina) sin RA a las células.
  6. Transfiera las células a un tubo de 15 ml y centrífuga durante 5 min a 200 x g y RT.
  7. Deseche el sobrenadante y agregue 1 ml de medio de diferenciación sin ácido retinoico (RA). Resuspenda el pellet celular.
  8. Utilice la suspensión celular para determinar el número de celda utilizando un contador de celdas de acuerdo con las instrucciones del fabricante.

4. Generación agregada

  1. Añadir 5 ml de RA (1 mM de stock disuelto en etanol al 99,8%, almacenado a -20 oC) a los 10 ml de medio de diferenciación y mezclar bien (concentración final de 0,5 m de RA).
    NOTA: La RA es sensible a la luz. La baja concentración de EtOH no afecta a la diferenciación celular19,20,21.
  2. Añadir 10 ml de medio de diferenciación (con RA) al plato de cultivo no tratado de 100 mm (dedicado al cultivo de suspensión).
  3. Semilla de las 1 x 106 células en el plato de 100 mm (superficie de la superficie del plato 56,5 cm2).
  4. Poner el matraz con células en la incubadora a 37oC y 5% CO2 durante 2 días con el fin de promover la formación de áridos.
  5. Después de 2 días, cambie el Medio de Diferenciación. Aspirar el medio que contiene agregados utilizando una pipeta de 10 ml y transferir a un tubo de 15 ml en RT.
  6. Permita que los agregados se asienten por gravedad durante 1,5 min en RT.
  7. Descarta el sobrenadante.
  8. Añadir un nuevo medio de diferenciación de 10 ml con RA de 0,5 m utilizando una pipeta serológica de 10 ml.
    PRECAUCION: No pipetee los agregados de celda hacia arriba y hacia abajo.
  9. Sembrar los agregados en un nuevo plato de cultivo no tratado de 100 mm (dedicado al cultivo de suspensión).
  10. Colocar la placa en la incubadora (a 37oC y 5% CO2)durante 2 días.

5. Disociación de agregados

  1. Aspirar los agregados de celda utilizando una pipeta de 10 ml.
  2. Transfiera los agregados a un tubo de 15 ml. Permita que los agregados de celda se asienten por gravedad durante 1,5 min.
  3. Retire el sobrenadante.
  4. Lave los agregados con DMEM solo (sin suero y antibióticos).
  5. Permita que los agregados de celda se asienten por sedimentación por gravedad durante 1,5 min en RT.
  6. Aspirar el sobrenadante y añadir 2 ml de trippsina-EDTA (0,25%).
  7. Colocar los agregados de celda en un baño de agua (37 oC) durante 10 minutos.
  8. Detenga el proceso de tripinización agregando 4 mL de medio de mantenimiento.
  9. La pipeta se agrega hacia arriba y hacia abajo 20 veces usando pipeta de 1 ml.
  10. Células centrífugas durante 5 min a 200 x g y RT.
  11. Retire el sobrenadante y vuelva a suspender el pellet celular en 5 ml de medio de mantenimiento.
  12. Determine el número de celda con un contador de celdas.

6. Células de chapado

  1. Añadir 3 ml por pozo de medio de mantenimiento a una placa de 6 pocillos.
  2. Células de semillas en la placa de cultivo de 6 pocillos a una densidad de 0,5 x 106/pozo.
  3. Incubar a 37oC con una concentración de CO2 al 5%.
  4. Sembrar las células en el vidrio de cubierta en placa de cultivo de 6 pozos y realizar inmunomanchas con anticuerpo anti-MAP2 (20% de confluencia). Utilice la placa de 6 pocillos para aislar el ARN y realizar RT-PCR para Map2, NeuN, Oct4, Nanogy Gapdh (20% de confluencia).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

El esquema simplificado de protocolo para la inducción de la neurogénesis en la línea celular P19 se presenta en la Figura1. Para definir el carácter de la línea celular P19 en un estado indiferenciado y durante la neurogénesis, se utilizó el método RT-PCR (reacción en cadena de transcripción inversa-polimerasa). La línea celular P19 indiferenciada expresaba los genes de la pluripotencia como el transportador orgánico catión/carnitina4 (Oct4) y el homeobox Nanog (Nanog). Neurogénesis inducida por la agregación de células en el cultivo de suspensión en presencia de RA condujo a una rápida disminución de Oct4 y Nanog expresión. Por el contrario, la expresión de marcadores de neuronas: proteína asociada a microtúbulos 2 (Map2), NeuN (también conocida como proteína de unión al ARN, homólogo fox-1 3 (Rbfox3)) aumentó después de la neurogénesis activada (Figura2)6 ) ,14,15,22. Las imprimaciones utilizadas para cada gen se indican junto con secuencias de nucleótidos y el tamaño del producto en la Tabla 1. Una imagen microscópica de la línea celular P19 indiferenciada presentó una morfología de forma redonda (Figura3A). Después de la inducción de la neurogénesis, la estructura neuronal de las células era claramente visible 4 días después del enchapado (Figura3B). Además, la Figura 4 representa la imagen de fluorescencia de la expresión MAP2 en la línea celular P19 diferenciada (4 días después de las células de chapado)14.

Figure 1
Figura 1 : Protocolo esquemático para la inducción de neurogénesis en células de carcinoma embrionario P19. La neurogénesis se induce mediante el cultivo de la línea celular P19 en un plato de cultivo no tratado de 100 mm con 5% de FBS y 0,5 m de RA. Después de 4 días, los agregados celulares se disocian con trippsina y sembran en la placa de cultivo celular adherente para seguir los próximos 4 días. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Cambios de expresión génica en la línea celular P19. El gráfico de banda representa la expresión génica para la línea celular P19 indiferenciada (Oct4, Nanog) y durante la neurogénesis (Map2, NeuN). El gliceraldehído-3-fosfato deshidrogenasa (Gapdh) se utilizó como gen de referencia. Las muestras se cargan en el gel de agarosa (1,5%) en doble replicación. Abreviaturas: Undifferentiated representa la línea celular P19 indiferenciada sin tratamiento de RA; El día 1-4 representa los días siguientes después del revestimiento celular- después de 4 días después del tratamiento con AR y la etapa de agregación celular. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Imágenes representativas del análisis de la línea celular P19. (A) Imágenes microscópicas de luz de la línea celular P19 indiferenciada. (B) Imágenes microscópicas ligeras de la línea celular P19 después de 4 días de neurogénesis- después de 4 días después del tratamiento con RA y la etapa de agregación celular. Barra de escala a 100 m. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 : Imagen representativa de la inmunofluorescencia de la línea celular P19 diferenciada. Imagen de inmunofluorescencia fusionada de la línea celular P19 teñida con anti-MAP2 y DAPI a los 4 días después del enchapado. Barra de escala a 100 m. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Cartilla Secuencia de imprimación Producto
tamaño (bp)
Gapdh F: TGACCTCAACTACATGCTACA
R: CTTCCCATTCTCGGCCTTG
85
Mapa2 F: GCTGAGATCATCACACAGTC
R: TCCTGCCAAGAGCTCATGCC
211
Oct4 F: GGCGTTCTCTTTGGAAAGGTTC
R: CTCGAACCACCTTCTCT
313
Neun F: GGCAAATGTTCGGGCAATTCG
R: TCAATTTTCCGTCCCTCTACGAT
160
Nanog F: AAAGGATGAAGTGCAAGCGGTGG
R: CTGGCTTTTCCCTGACTTTAAGC
520

Tabla 1: Imprimaciones utilizadas para RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Aquí, describimos un protocolo simple para la neurogénesis usando la línea celular P19. Aunque se han publicado muchos informes a este respecto, una metodología detallada para la inducción de la neurogénesis utilizando la línea celular P19 sigue sin estar clara. Además, utilizamos un medio DMEM simple de glucosa alta (4.500 mg/L) con 10% DE FBS para todo el experimento. Esto nos permitió realizar el experimento neurogénico de una manera fácil de usar y ampliar el uso de este método para el futuro.

Los puntos más críticos dentro de este protocolo son la concentración de RA, así como la generación de agregados celulares en el cultivo de suspensión. La estimulación de la neurogénesis en la línea celular P19 se puede llevar a cabo sin la formación de agregados, pero el número de células neuronales producidas se reducirá en dos tercios en el cultivo celular22. Monzo et al. han demostrado la inducción de la neurogénesis en la línea celular P19 al cultivarlos en monocapa15. Aunque su método es bastante conveniente, ya que podemos eliminar el proceso de cultivo de suspensión, se requieren más estudios para comparar su método con otros métodos bien descritos. La concentración de RA de 0,5 m en el medio produjo un alto número de agregados celulares, así como neuronas después del revestimiento en comparación con 1 M de RA. También es importante tener en cuenta que no pudimos observar una neurogénesis eficiente cuando la mayoría de los agregados están unidos a la parte inferior del plato de cultivo de suspensión durante el tratamiento de RA. El número óptimo de la línea celular P19 que se utilizará al principio del procedimiento es de 1 x 106 por cada 10 ml de medio de diferenciación. Durante la inducción de la neurogénesis, la línea celular P19 forma agregados de diferentes tamaños e incluso se encuentran células individuales en el cultivo. Para superar este problema, recogimos los agregados celulares después de 1,5 minutos de caída libre en un tubo de 15 ml. Encontramos que este enfoque permite la exclusión de la contaminación de células individuales. También se recomienda realizar el enriquecimiento neuronal con el cultivo celular utilizando fármacos antimitóticos (por ejemplo, citosina arabinósido) para el cultivo a largo plazo para inhibir la proliferación extensa de células gliales23.

Las neuronas derivadas de la línea celular P19 expresan receptores de glutamato ionotrópico de ambos N-metil-D-aspartato (NMDA) y alfa-amino-3-hidroxi-5-metil-4-isoxazol propionato (AMPA)/kainite (KA) tipos24,25, así como funcional -ácido aminobutírico (GABA) receptores25. Por lo tanto, la línea celular P19 es ampliamente utilizada en los estudios sobre mecanismos moleculares que rigen la diferenciación neuronal26,27,28. Más importante aún, el desarrollo tumoral no se observó después del trasplante de células29,30.

Con este fin, la investigación sobre enfermedades neurodegenerativas como la enfermedad de Alzheimer17,18 también se lleva a cabo utilizando la línea celular P19, y creemos que el método desarrollado en este estudio jugará así un papel en la difusión de la mecanismos en las anomalías del neurodesarrollo y las enfermedades neurodegenerativas.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

El estudio fue apoyado financieramente por el Centro Nacional de Ciencias, Polonia (concesión no. UMO-2017/25/N/NZ3/01886) y KNOW (Leading National Research Centre) Consorcio Científico "Animal Saludable - Alimentos Seguros", decisión del Ministerio de Ciencia y Educación Superior No 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics