P19 배아 암종을 이용한 신경 발생

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

P19 마우스 배아 암세포주(P19 세포주)는 생체내 분석에 비해 매우 단순화된 신경발생의 분자 기전을 연구하는데 널리 사용된다. 여기서, 우리는 P19 세포주에서 레티노산 유도 신경발생에 대한 프로토콜을 제시한다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

마우스 배아 유래 기형암유래 P19 세포주들은 3개의 세균 층으로 분화하는 능력을 가지고 있다. 레티노산(RA)의 존재에서, 현탁액 배양된 P19 세포주들은 뉴런으로 분화하도록 유도된다. 이 현상은 시험관에서 신경 발생 모델로 광범위하게 조사된다. 따라서, P19 세포주신경발생과 관련된 분자 및 세포 연구에 매우 유용하다. 그러나, 문헌에 기재된 P19 세포주신경 분화를 위한 프로토콜은 매우 복잡하다. 이 연구에서 개발 된 방법은 간단 하 고 신경 발달 이상 및 신경 퇴행 성 질환에 분자 메커니즘을 해명에 역할을 할 것 이다.

Introduction

배아 발달 도중, 단 하나 세포 층은 3개의 개별적인 세균 층 1,2,3로변환됩니다. 생체 내에서 발생하는 현상의 연구 가능성을 높이기 위해 3차원 응집체(배아 체)의 생성이 편리한 모델로 개발되었습니다. 이러한 방식으로 형성된 세포 응집체는 배아4,5의발달을 반영하는 세포 분화를 유발하는 다양한 조건에 노출될 수 있다. P19 뮤린 배아 암종 세포주(P19 세포주)는 일반적으로 시험관내 신경발생 연구를 위한 세포모델로서 사용된다 6,7,8. P19 세포주 전형적인 다능성 줄기 세포 특징을 전시하고 부착 조건하에서 신경 쇠산 다음에 세포 응집 도중 레티노산 (RA)의 존재에 있는 신경으로 분화할 수 있습니다. 더욱이, 미분화 P19 세포주또한 디메틸 설폭사이드(DMSO)9,10,11,12의영향을 받아 근육-및 심근세포 유사 세포를 형성할 수 있다.

많은 방법13,14,15,16은 신경 분화에 대해 보고되었지만, 방법론은 때때로 복잡하고 설명만 읽음으로써 파악하기가 쉽지 않다. 예를 들어, 프로토콜은 때때로 종아리 혈청(CS) 및 태아 소 혈청(FBS)13의혼합물로 보충된 덜베코의 변형 된 독수리 배지 (DMEM) 배지의 조합을 필요로한다. 더욱이, 신경 발달에 사용되는 매체는 종종 신경분과 B27 보충제13,14,15,16으로구성된다. 따라서 기존 메서드에는 준비의 복잡성이 포함되어 있으며 여기서의 목표는 프로토콜을 단순화하는 것입니다. 본 연구에서, 우리는 FBS를 가진 DMEM이 P19 세포주 (DMEM + 10% FBS)뿐만 아니라 신경 발달 (DMEM + 5% FBS + RA)을 유지하는 데 이용될 수 있음을 입증하였다. P19 세포주를 사용하여 신경 발생을 위한 이 단순화한 방법은 우리가 신경세포가 어떻게 개발되는지의 분자 기계장치를 공부하는 것을 허용합니다. 더욱이, 알츠하이머병과 같은 신경퇴행성 질환에 대한 연구도 P19 세포주17,18을이용하여 진행되고 있으며, 본 연구에서 개발된 방법이 이를 해명하는 데 한 몫을 할 것으로 믿습니다. 신경 발달 이상 및 신경 퇴행성 질환의 분자 메커니즘.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. 문화유지

  1. 유지 보수 매체에서 P19 세포주 배양 (Dulbecco의 수정 된 독수리의 배지와 4,500 포도당 의 mg /L 보충 10% FBS, 100 단위 / mL 페니실린 과 100 단위 / mL 연쇄상 구균). 37 °C 및 5 %CO2에서 배양하십시오.

2. 하위 배양 세포

  1. 세포가 약 80% 합류에 도달하면, 세포 배양 플라스크(표면적 25 cm2)로부터 소비배지를 제거한다.
  2. 칼슘과 마그네슘이 없는 인산완충식염수(PBS)2 mL로 세포를 세척합니다.
  3. 세포 단층에 0.25% 트립신-EDTA(에틸렌디아민테트라아세트산)의 1 mL를 첨가합니다.
  4. 플라스크를 CO2 인큐베이터(37°C 및 5% CO2)에 2-3분 동안 넣습니다.
  5. 플라스크 표면에 대한 세포 부착을 평가합니다. 모든 셀이 매매체에 분리되고 부동되어 있는지 확인합니다.
  6. 트립신의 효소 활동을 중지 유지 보수 매체의 9 mL를 추가합니다.
  7. 유지 관리 매체에서 셀을 다시 일시 중단합니다.
  8. 세포를 200 x g 및 실온(RT)에서 5분 동안 15 mL 튜브 및 원심분리기로 옮긴다.
  9. 상급을 버리고 15 mL 튜브에 신선한 유지 보수 매체 10 mL를 추가하십시오.
  10. 셀 서스펜션을 사용하여 제조업체의 지침에 따라 셀 카운터를 사용하여 셀 번호를 확인합니다.
  11. 새로운 25 cm2 플라스크에서 2 x 104 세포 / cm2에서 종자 세포.
  12. 유지 보수 매체를 최대 10mL까지 추가합니다.
  13. 플라스크를CO2 인큐베이터(37°C 및 5% CO2)에 2-3일 동안 넣습니다.

3. 트립신 소화

  1. 세포 플라스크로부터 흡인 유지 보수 배지. 칼슘 과 마그네슘이없는 PBS의 2 mL로 한 번 세포를 씻어.
  2. 0.25% 트립신-EDTA의 1 mL을 추가합니다.
  3. 세포가 있는 플라스크를 37°C에서 CO2 인큐베이터에 넣고 2-3분 동안 넣습니다.
  4. 1 mL 파이펫을 사용하여 셀을 10번 파이펫팅하여 세포를 해리합니다.
  5. 세포에 RA없이 9 mL의 분화 매체 (Dulbecco의 수정 된 독수리 배지와 포도당 4500 mg / L을 5 % FBS, 100 단위 / mL 페니실린 및 100 단위 / mL 연쇄상 구균)로 보충하여 트립신을 중화하십시오.
  6. 세포를 15 mL 튜브및 원심분리기로 200 x g 및 RT에서 5분 동안 이송합니다.
  7. 상온제를 버리고 레티노산(RA)없이 분화 배지 1 mL를 첨가합니다. 세포 펠릿을 다시 일시 중단합니다.
  8. 셀 서스펜션을 사용하여 제조업체의 지시에 따라 셀 카운터를 사용하여 셀 번호를 결정합니다.

4. 집계 생성

  1. 5 μL의 RA (99.8 % 에탄올에 용해 된 1 mMM 스톡을 -20 °C에서 저장)를 분화 매체의 10 mL에 넣고 잘 혼합하십시오 (0.5 μM RA의 최종 농도).
    참고: RA는 빛에 민감합니다. EtOH의 낮은 농도는 세포 분화에 영향을 미치지 않습니다19,20,21.
  2. 100mm 비처리 배양 접시(서스펜션 배양 전용)에 10 mL의 분화 배지(RA)를 추가합니다.
  3. 100mm 접시에 1 x 106 세포를 시드 (접시 표면적 56.5 cm 2).
  4. 응집체 형성을 촉진하기 위해 세포를 37°C 및 5% CO2에서 인큐베이터에 넣고 2일 동안.
  5. 2일 후, 분화 매체를 교환한다. 10 mL 파이펫을 사용하여 응집체를 함유하는 흡인 배지를 RT에서 15 mL 튜브로 전달한다.
  6. RT에서 1.5분 동안 응집체가 중력에 의해 정착되도록 합니다.
  7. 상급제는 버리십시오.
  8. 10 mL 의 세레학적인 파이펫을 사용하여 0.5 μM RA로 신선한 10 mL의 분화 매체를 추가하십시오.
    주의 사항: 셀이 위아래로 응집되지 않도록 피펫을 설치하지 마십시오.
  9. 새로운 100 mm 비 처리 배양 접시에 응집체를 종자 (서스펜션 배양 전용).
  10. 플레이트를 인큐베이터(37°C 및 5% CO2)에서 2일 동안 놓습니다.

5. 응집체 해리

  1. 10 mL 파이펫을 사용하여 셀 응집체를 흡인합니다.
  2. 응집체를 15 mL 튜브로 옮김을 옮김으로 옮김을 옮김. 셀 응집체가 중력에 의해 1.5 분 동안 정착할 수 있도록 합니다.
  3. 상급체를 제거합니다.
  4. 단독으로 DMEM으로 응집체를 세척하십시오 (혈청 및 항생제 - 무료).
  5. RT에서 1.5분 동안 중력 침전에 의해 세포 응집체가 침전되도록 합니다.
  6. 상한을 흡인하고 트립신-EDTA(0.25%)의 2 mL을 추가합니다.
  7. 세포 응집체를 수조(37°C)에 10분 동안 넣고 손으로 두드려 2분마다 응고물을 부드럽게 교반합니다.
  8. 유지 보수 매체의 4 mL를 추가하여 트립시니화 프로세스를 중지합니다.
  9. 파이펫은 1mL 파이펫을 사용하여 20회 위아래로 응집됩니다.
  10. 200 x g 및 RT에서 5 분 동안 원심 분리지 세포.
  11. 상급체를 제거하고 유지 보수 매체의 5 mL에서 세포 펠릿을 다시 일시 중단하십시오.
  12. 셀 카운터를 사용하여 셀 번호를 확인합니다.

6. 도금 세포

  1. 6웰 플레이트에 유지 보수 매체당 3 mL를 추가합니다.
  2. 종자 세포는 0.5 x 10 6/well의밀도로 6웰 배양 플레이트에서.
  3. 37°C에서 5% CO2 농도로 배양합니다.
  4. 6웰 배양플레이트에서 커버 글라스상에 세포를 시드하고 항MAP2 항체(20% 합류)로 면역염색을 수행한다. 6웰 플레이트를 사용하여 RNA를 분리하고 Map2, NeuN, Oct4, Nano및 Gapdh (20 % 합류)에 대한 RT-PCR을 수행하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

P19 세포주에서 신경 발생 유도에 대한 프로토콜의 단순화 된 계획은 1에 제시되어 있다. P19 세포주의 특성을 미분화 상태 및 신경 발생 시 정의하기 위해 RT-PCR(역전사-폴리머라제 연쇄 반응) 방법을 사용하였다. 미분화 P19 세포주들은 유기 양이온/카르니틴 트랜스포터4(Oct4) 및 나노홈박스(Nanog)와 같은 다능성 유전자를 발현하였다. RA의 존재에서 현탁액 배양에서 세포 응집에 의해 유도된 신경발생은 Oct4 및 나노발현의 급격한 감소를 이끌었다. 반대로, 뉴런 마커의 발현: 미세투관 관련 단백질 2(Map2) 및 NeuN(RNA 결합 단백질이라고도 함, 폭스-1 호몰로그 3(Rbfox3)))은 신경 발생 유발 후 증가 (도2) 6 ,14,15,22. 각 유전자에 사용되는 프라이머는 뉴클레오티드 서열과 함께 표 1에 있는 생성물의 크기와 함께 표시된다. 미분화 P19 세포강의 현미경 이미지는 둥근 모양의 형태를 제시했다(도3A). 신경 발생의 유도 후, 세포의 신경 구조는 도금 후 4일 후에 명확하게 볼 수 있었다(도3B). 부가적으로, 4는 분화된 P19 세포주(도금 세포 후 4일)14에서MAP2 발현의 형광 영상을 나타낸다.

Figure 1
그림 1 : P19 배아암 세포에서 신경발생 유도를 위한 프로토콜 회로도. 신경발생은 FBS 및 0.5 μM RA의 5%로 100 mm 비처리 배양 접시에서 P19 세포주배양에 의해 유도된다. 4일 후, 세포 응집체는 트립신과 해리되고 다음 4일 동안 부착 세포 배양 플레이트상에 시드된다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 2
그림 2 : P19 세포주에서 유전자 발현의 변화. 밴드 그래프는 미분화 P19 세포주(Oct4,Nanog)와신경발생 시(Map2,NeuN)에대한 유전자 발현을 나타낸다. 글리세랄데히드-3-인산탈수소효소(Gapdh)를 기준 유전자로 사용하였다. 샘플은 아가로즈 젤 (1.5 %)에로드됩니다 이중 복제에 있습니다. 약어: 미분화는 RA 처리 없이 미분화 P19 세포주; 일째 1-4는 세포 도금 후 후속 일을 나타내며- RA 처리 및 세포 응집 단계 후 4일 후에. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 3
그림 3 : P19 세포주 분석의 대표적인 이미지. (A) 미분화 P19 세포선의 가벼운 현미경 이미지. (B) P19 세포주의 미세한 이미지는 4일 후 신경발생-RA 치료 및 세포 응집 단계 후 4일 후에. 배율 표시줄 = 100 μm. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 4
그림 4 : 분화된 P19 세포주들의 대표적인 면역형광영상. 도금 후 4일 만에 항MAP2 및 DAPI로 염색된 P19 세포주의 면역형광 이미지를 병합한다. 배율 표시줄 = 100 μm. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

뇌관 프라이머 시퀀스 제품
크기(bp)
갭드 (것)가 F: TGACCTCAACTACATTTCTACA
R: CTTCCCATCTCTCTTG
85세
지도2 F: GCT가카트카카카GTC
R: TCCGCCAAGAGCTCATGCC
211
10월 4일 F: GGCGTTCTTTTTTTC
R: CTCGAACCACATCTCTCTCT
313
뉴 (뉴) F: GGCAAATGTTCGCAATTCG
R: TCAATTTCCCTCTCTACGAT
160명
나노 (주) F: 아가가아GTGCAAGCGGG
R: CTGGCTTTGCTTTActTAGC
520

표 1: RT-PCR에 사용되는 프라이머.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

여기서, 우리는 P19 세포주를 사용하여 신경 발생에 대한 간단한 프로토콜을 기술한다. 많은 보고가 이 점에서 간행되었더라도, P19 세포주를 사용하여 신경 발생 유도를 위한 상세한 방법론은 불분명합니다. 또한, 우리는 전체 실험에 대해 10 % FBS를 가진 간단한 높은 포도당 (4,500 mg / L) DMEM 배지를 이용했습니다. 이를 통해 우리는 사용자 친화적 인 방식으로 신경 성 실험을 수행하고 미래를 위해이 방법의 사용을 확장 할 수있었습니다.

이 프로토콜 내에서 가장 중요한 점은 현탁액 배양내의 세포 응집체 의 생성뿐만 아니라 RA 농도이다. P19 세포주에서 신경발생의 자극은 응집체의 형성 없이 수행될 수 있지만, 생성된 뉴런 세포의 수는 세포 배양(22)에서 3분의 2로 감소될 것이다. Monzo 외. 단층15에서배양하여 P19 세포주에서 신경 발생 유도를 나타내고 있다. 그들의 방법은 우리가 현탁액 배양 과정을 제거할 수 있기 때문에 아주 편리하더라도, 추가 연구는 그밖 잘 기술된 방법과 그들의 방법을 비교하기 위하여 요구됩니다. 배지에서 0.5 μM의 RA 농도는 RA의 1 μM에 비해 도금 후 세포 응집체뿐만 아니라 뉴런의 높은 수를 생산하였다. 또한 RA 치료 동안 대부분의 골재가 현탁액 배양 접시의 바닥에 부착될 때 효율적인 신경 발생을 관찰할 수 없다는 점에 유의하는 것이 중요합니다. 시술 의 시작 부분에서 사용되는 P19 세포주의 최적 수는 분화 배지의 매 10 mL에 대해 1 x 10 6이다. 신경 발생의 유도 하는 동안, P19 세포 주 형성 다양 한 크기의 응집체 와 심지어 단일 세포 배양에서 발견 된다. 이 문제를 극복하기 위해, 우리는 15 mL 튜브에서 자유 낙하 1.5 분 후에 세포 응집체를 수집했습니다. 우리는 이 접근이 단 하나 세포의 오염의 배제를 허용한다는 것을 것을을 발견했습니다. 또한 신경교세포의 광범위한 증식을 억제하기 위해 장기간 배양용 항미소성 약물(예를 들어, 시토신 아라비노사이드)을 이용하여 세포배양을 이용한 신경농축을 수행하는 것이 권장된다.

P19 세포주에서 유래된 뉴런은 N-메틸-D-아스파르타테(NMDA) 및 알파-아미노-3-하이드록시-5-메톡사졸 프로피오네이트(AMPA)/카이니테(KA) 타입 모두의 이오노트로픽 글루타메이트 수용체를 표현하고 있으며, 24,25,뿐만 아니라 기능성 γ-아미노부티르산(GABA) 수용체25. 따라서, P19 세포주는 뉴런 분화26,27,28을지배하는 분자 기전연구에 널리 사용된다. 더 중요한 것은, 종양 발달은 세포 이식 후 관찰되지 않았다29,30.

이를 위해, 알츠하이머병17,18과 같은 퇴행성 신경질환에 대한 연구는 P19 세포주도 이용하여 진행되고 있으며, 본 연구에서 개발된 방법이 분자를 해명하는 데 한 몫을 할 것으로 믿는다. 신경 발달 이상 및 신경 퇴행성 질환의 메커니즘.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없다.

Acknowledgments

연구 결과는 국립 과학 센터에 의해 재정적으로 지원되었다, 폴란드 (부여 없음. UMO-2017/25/N/NZ3/01886) 및 KNOW (주요 국가 연구 센터) 과학 컨소시엄 "건강한 동물 - 안전한 식품", 과학 고등 교육부의 결정 No. 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics