אסטרטגיית יעיל ליצירת מערכות רקמות ספציפיות שעתוק בינאריים ב דרוזופילה על-ידי עריכת הגנום

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

כאן, אנו מציגים שיטה ליצירת מערכות רקמות ספציפיות שעתוק בינאריים ב דרוזופילה על-ידי החלפת את אקסון קידוד הראשון של גנים עם מנהלי התקנים של שעתוק. השיטה מבוססת על CRISPR/Cas9 ממקם את רצף transactivator תחת ויסות גנים הוחלף אנדוגני, כתוצאה מכך ומקילה על ההתבטאות transctivator באופן בלעדי בדפוסי ייתכן גנים ספציפיים.

Cite this Article

Copy Citation | Download Citations

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

. המערכות כלים רבי-עוצמה גנטיים בשימוש נרחב עבור להמחיש וטיפול גורל התא והביטוי ג'ין בקבוצות מסוימות של תאים או רקמות אורגניזמים דגם שעתוק בינארי. מערכות אלו מכילות שני רכיבים כשורות נפרדות מהונדס. נהג קו מבטא מפעיל גנים ברמת השעתוק תחת השליטה של רקמות ספציפיות היזמים/מוצרי טיפוח טבעיים, נמלים שורה של הכתב/אפקטור גן המטרה להציב downstream לאתר איגוד של שעתוק activator. חיות מחסה שני הרכיבים לגרום transactivation רקמות ספציפיות של ביטוי גנים היעד. ייתכן ביטוי מדויק של הגן ברקמות יישוב חיוני לפרשנויות לא משוחדת של פעילות התא/ג'ין. לפיכך, פיתוח שיטה ליצירת קווים בלעדיים תא/רקמות ספציפיות הנהג הוא חיוני. כאן אנו מציגים שיטה ליצירת מערכת ביטוי ממוקד מאוד רקמות ספציפיות על-ידי העסקת "מקובצים באופן קבוע Interspaced קצר Palindromic חוזר/CRISPR-הקשורים" (CRISPR/Ca)-מבוסס גנום עריכה טכניקה. בשיטה זו, מדריך endonuclease Cas9 מכוון על ידי שניים chimeric RNAs (gRNA) אתרים ספציפיים אקסון קידוד הראשון של גנים בגנום דרוזופילה ליצירת מעברי כפול-סטרנד (DSB). לאחר מכן, באמצעות פלסמיד התורם אקסוגני של המכיל את רצף transactivator, המכונות תיקון תא-אוטונומית מאפשרת תיקון מכוון הומולוגיה (HDR) של DSB, וכתוצאה מכך למחיקה מדויקת החלפת אקסון עם transactivator רצף. Transactivator הפיל במתבטא אך ורק בתאים איפה חבר העמים-רגולציה מרכיבי הגן הוחלף פונקציונליים. פרוטוקול צעד אחר צעד מפורט המובאת כאן ליצירת נהג תעתיק בינארי לידי ביטוי דרוזופילה fgf/branchless-הפקת תאים אפיתל עצביים יכולים להיות מאומץ עבור כל ביטוי גנים - או רקמות ספציפיות.

Introduction

ארגז הכלים גנטי על ביטוי גנים יישוב פותחה טוב דרוזופילה, שהופך אותו לאחד מערכות המודל הטוב ביותר לחקור את הפונקציה של גנים המעורבים במגוון רחב של תהליכים תאיים. מערכות ביטוי בינארי, כגון שמרים Gal4/UAS (רצף הפעלה נגד הזרם), אומצה תחילה על רקמות ספציפיות משפר השמנה וסדר -ג'ין misexpression מודל גנטי דרוזופילה 1 (איור 1). מערכת זו הקל הפיתוח של מספר רב של טכניקות כגון ויסות זמן-מרחבי של ביטוי גנים, misexpression, נוקאאוט בקבוצות נבחרות של תאים כמו גם כמו אבלציה התא, התא סימון, עקיבה חיה של תאית ומולקולרית תהליכים בתוך העובר, רקמות, מעקב אחר שושלת היוחסין וניתוחים פסיפס במהלך הפיתוח. מספר של מערכת בינארית שעתוק, כגון חיידקי לקסה/לקסהניתוח המערכת (איור 1) ומערכת Neurospora Q-, הם כלים גנטיים רבי-עוצמה נמצאים כעת בשימוש נרחב דרוזופילה, בנוסף מערכת Gal4/UAS המקורי עבור ג'ין יישוב ביטוי1,2,3.

כאן, אנו מציגים שיטה ליצירת מערכת ואמינים רקמות ספציפיות ביטוי בינארי בהחלת טכניקה לעריכת הגנום. הפיתוחים האחרונים בתחום הטכנולוגיה העריכה של הגנום CRISPR/Cas9 אפשרו הזדמנויות חסר תקדים לעריכת שינויים הגנום מכוונת במגוון רחב של אורגניזמים. מערכת CRISPR/Cas9 לעומת אחרים זמינים הגנום טכניקות עריכה, הוא זול, יעיל ואמין. טכנולוגיה זו משתמשת מרכיבי מערכת החיסון מסתגלת חיידקי: Cas9 endonuclease של סטרפטוקוקוס הפישחה ינפל תומימת יוצר הפסקה כפולה-סטרנד (DSB), של RNA מדריך chimeric (gRNA), אשר ידריך את Cas9 אל אתר מסוים הגנום עבור יישוב DSB4. התאים מכילים את מכונות כדי לתקן את DSB באמצעות מסלולים שונים. Non-הומולוגי סוף מצטרף (NHEJ) מוביל קטן שהתוספות או המחיקות כדי לשבש את תפקוד הגן, תוך תיקון מכוון הומולוגיה (HDR) מציג מוגדר ביים/רצוי גנומית ב/דפיקה-את מדהימה באמצעות תורם HDR אקסוגני כתבנית. האסטרטגיה מבוססת-HDR החלפת ביעילות יכול להיות מנוצל כדי ליצור מערכת ואמינים רקמות ספציפיות ביטוי בינארי, אשר ניתן להתגבר על כל המגבלות של השיטות מלכודת משפר מסורתיים. אנו מתארים הליך שלב אחר שלב של ניצול של HDR מבוססת על CRISPR/Cas9 תיקון ביצירת קו הנהג שעתוק בינארי מבוטא תחת השליטה של ויסות גנים ברמת השעתוק והתרגום post-transcriptional אנדוגני של דרוזופילה ג'ין. ב פרוטוקול זה, נדגים את הדור של קו מנהל התקן ספציפי עבור branchless (bnl) ג'ין קידוד החלבון של המשפחה FGF המווסת מורפוגנזה הסתעפות של אפיתל דרכי הנשימה והכו אותי5. בדוגמה זו, אקסון קידוד הראשון של הגן bnl הוחלף על ידי הרצף של רצף transactivator לקסה חיידקי מבלי לשנות כל אנדוגני cis-רצפים הרגולציה של הגן bnl . אנחנו מראים כי האסטרטגיה שנוצר קו נהג bnl-לקסה השולטת spatiotemporally את הביטוי של גנים כתב ממוקם במורד הזרם של LexAoperator (LexAop או LexO) bnl - באופן בלעדי הבעת אפיתל/mesenchymal/תאים עצביים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. עיצוב ובניית gRNA את הביטוי וקטור

  1. להחלפת במדויק אזור זמן המוגדר אקסון, להשתמש gRNA כפול הגישה6, שבו כל gRNA במיוחד יעד שני הקצוות של האזור הנבחר של ריבית. כדי לקבל ביטוי גנים ספציפיים ייתכן מדויק של מנהל ההתקן, בחר שני אתרי היעד gRNA בתוך אקסון קידוד הראשון של הגן.
  2. דרוזופילה melanogaster, בחר את האתרים gRNA היעד באמצעות הכלי אופטימלית היעד מאתר flyCRISPR (http://tools.flycrispr.molbio.wisc.edu/targetFinder/). כלי עיצוב הזמינים אחרים CRISPR ניתן להשתמש גם כן, כולל כלי אופטימיזציה העיצוב CRISPR (http://crispr.mit.edu), FlyCas9 (https://shigen.nig.ac.jp/fly/nigfly/cas9), ו- E-פריך (www.e-crisp.org/E-CRISP).
    הערה: הפרוטוקולים הבאים של עיצוב gRNA, שיבוט אומצה השיטות שתוארו6,7.
    1. העתק את רצף בפועל לתוך תיבת סיפק בכלי מקוון. בחר לאחרונה דרוזופילה melanogaster הגנום ביאור הגירסה המסחרית, "r_6," בתפריט הנפתח עבור "בחר הגנום. ב- "מדריך בחר אורך השדה (nt)," קלט "20". בחר כדי למצוא את "כל CRISPR מטרות" ולחץ על "למצוא מטרות CRISPR".
    2. להעריך כל המטרות gRNA המועמד על-ידי הגדרת "מקסימום" עבור "לכתחילה" ו- "הגולה בלבד" עבור "פאם". נסו לבחור את האתרים gRNA ללא כל הנחה-המטרות הפוטנציאליות או מספר מינימלי של חופש-מטרות אפשרי. שימוש בכלי האינטרנט המתוארים Doench. et al. 2014 8 לבחירת gRNAs עם ציון "טוב" פעילות פוטנציאליות.
    3. במקביל, ודא כי יש פולימורפיזם נוקלאוטיד יחיד אין המטרות gRNA הגנום של הקו לטוס ההורה שנבחר עבור הזרקה (למשל, nos-Cas9 על כרומוזום X, BL # 54591). לעקוב אחר הפרוטוקול המתואר גרץ. ואח 20157 כדי לחלץ את ה-DNA גנומי מהקו לטוס האב. PCR להגביר, כ, 500-1000 nt האזורים באמצעות תחל מחזיתות את הרצף של עניין של אמינות גבוהה DNA פולימראז; רצף-לאמת את המוצרים PCR מוגבר.
  3. עבור יצירת וקטור ביטוי gRNA טנדם, בצע עצמאית מצדו שיבוט פרוטוקול6 להציג שני רצפים protospacer לתוך pCFD4 RNA ביטוי וקטור. שימו לב כי וקטור ביטוי משופר מולטי-gRNA (pCFD5) זמין כעת שבו sgRNAs שניהם באים לידי ביטוי U6:3 חזקה היזמים9 (https://www.crisprflydesign.org). להשתמש בשיטה DNA הרכבה לשבט את gRNAs לתוך וקטור pCFD4.
    1. לעצב ולסדר את תחל ואחורה ידביקו שני רצפים protospacer pCFD4 וקטור ביטוי ה-RNA (טבלה 1 א). כפי שתואר קודם לכן6, פריימר לפנים מכיל את רצף protospacer הראשון ולצדו אזורים המתאימים יזם U6-1, gRNA הליבה ב- pCFD4; ומהצמיגים הפוכה מכיל את רצף משלים הפוך protospacer השני ולצדו אזורים המתאימים gRNA core ו- U6-3 יזם ב- pCDF4.
    2. Resuspend תחל כדי 100 μM עם DNase ונטולת RNase כפול מים מזוקקים (ddH2O). להפוך 10 μM עבודה ריכוז פריימר. השתמש pCFD4 פלסמיד כתבנית ולהגדיר התגובה PCR באמצעות פולימראז של אמינות גבוהה ומומלץ הגדרות עבור ה-PCR תגובה6.
    3. לשבט את המוצר מוגבר לתוך pCFD4, לעכל pCFD4 פלסמיד עם אנזים BbsI על-ידי הגדרת את התגובה הבאה: 2 – 5 μg של פלסמיד pCFD4, 5 μL של 10 x מאגר עיכול, μL 1 של האנזים BbsI, ו- ddH2O כדי להביא את עוצמת הקול הסופי 50 μL. מערבבים את תוכן התגובה על-ידי הקשה על הצינור ובעדינות איסוף את כל טיפות פזורים מהקיר של הצינור התחתון על ידי סיבוב קצר. דגירה המיקס התגובה ב 37 מעלות צלזיוס במשך שעתיים.
    4. להפעיל את המוצר PCR שלב 2 ואת המוצר מתעכל משלב 3 ב- 1% agarose ג'ל. לבצע את אלקטרופורזה זמן מספיק להפריד לגמרי הלהקות הדנ א. את החלק הנכון בגודל DNA להקות תחת הטרנס-המאייר UV לפני טיהור המוצרים הצפוי באמצעות ג'ל עמודה • תנאי בעקבות ההוראה של היצרן (ראה טבלה של חומרים). המוצר PCR צריך להיות 600 bp, ואת את פלסמיד pCFD4 ליניארית צריך להיות kb ~6.4 6.
    5. להגדיר את התגובה הרכבה DNA בשפופרת PCR, לפי הוראות היצרן (ראה טבלה של חומרים).
    6. להפוך את μL 2 של המוצר הרכבה המוסמכת חיידקים (DH5α או זנים דומה עם ΔrecA1, ΔendA1), צלחת לוקחת אמפיצילין (100 μg/mL) המכיל פלטות אגר ליברות (LB/כח), דגירה ב 37 מעלות צלזיוס למשך הלילה. שימו לב: לערבב מכלול ה-DNA עשוי להיות רעיל זני חיידקים מסוימים, אבל דילול המיקס האסיפה יכולה להפחית הרעילות.
    7. לקחת 3-4 מושבות עמידים אמפיצילין מהצלחת מודגרות לילה, לחסן את המושבה ב- 3 מ ל LB המכיל אמפיצילין μg/mL 100, לגדול חיידקים חוסנו ב שייקר 37 º C למשך הלילה. לחלץ פלסמיד החיידק תרבותי בין לילה באמצעות ערכת הכנה מיני פלסמיד בעקבות ההוראה של היצרן (ראה טבלה של חומרים).
    8. רצף של פלסמידים עם T3 פריימר אוניברסלי עבור שיבוטים הנכון המכיל את הכניסה gRNA טנדם מסך. ליצור גליצרול מלאי של חיידקים טרנספורמציה עם תבדוק-רצף pCFD4-gRNA ב- 20% גליצרול וחנות במקפיא-80 ° C לשימוש עתידי.

2. עיצוב ובניית התורם HDR

  1. גנומית טוק-אין של רצף Gal4 או לקסה , עיצוב תורם HDR כפול גדילי המכיל את רצף transactivator ולצדו שתי זרועות הומולוגיה.
    1. שימוש > 1.5 kb עזב, זרועות הומולוגיה נכון איגוף הפגיעה המכוונת gRNA האתר. הומולוגיה המורחבת זרועות להגביר את היעילות של HDR במהלך תהליך תיקון 10.
    2. PCR להגביר את הזרועות הומולוגיה מהדנ גנומית (gDNA) שחולצו מן השורה לטוס האב שנבחר עבור הזרקה (למשל, nos-Cas9 (על כרומוזום X), BL # 54591). השתמש הגהת חם-start Taq-DNA פולימראז אנזים מתאים זמן PCR הרחבה (ראה טבלה של חומרים). רצף-לאמת.
  2. כדי להימנע retargeting של gRNA על מיקומה מהונדסים, עיצוב התורם החלפת בצורה כזאת, כי האתרים זיהוי gRNA הם מובסים על רצף אקסוגניים הציג.
    הערה: כדי למנוע שינוי הרכיבים בשם cis-רגולציה, תמיד בחר את האתרים זיהוי gRNA בתוך אזור אקסון קידוד.
  3. עבור הפקת קלטת חלופי, לתכנן את האסטרטגיה הרכבה דנ א כדי לאחד ארבעה מקטעים: הזרועות הומולוגיה 5' ו 3', רצף הדנ א transactivator אקסוגני האמצעי, השיבוט ליניארית וקטור עמוד השדרה (למשל, pUC19 או אחר נפוץ שיבוט וקטורים). בעקבות מנחה של היצרן עבור הרכבה דנ א (ראה טבלה של חומרים), לעצב את צבעי יסוד מתאים PCR הגברה והרכבה של כל אחד מהמקטעים. Resuspend תחל כדי 100 μM עם ddH2O. להפוך 10 μM עבודה ריכוז פריימר. השתמש פולימראז באיכות גבוהה עבור כל התגובות PCR. לפי התקנון שלהלן:
    1. PCR להגביר את קלטת ביטוי Gal4 או לקסה של וקטור זמין (למשל, nls-LexA:p65; פלסמידים הביטוי האידיאלי Gal4/לקסה/QF2 ניתן למצוא, המתקבל משאבים משותפים כגון Addgene) באמצעות תחל המופיעים בטבלה 1B.
      1. כדי לשמור את כל המקורי גנים ברמת השעתוק והתרגום post-transcriptional התקנות של אקסון הוחלף על הביטוי של רצף הדנ א transactivator, לעצב את הקלטת בצורה כזאת, כי אלל גנומית הערוך מביעים של mRNA chimeric של transactivator, את הגן. משמרות סוף אקסון יישוב כדי לשמור על כל אות splicing 5' ו 3'.
      2. לשלב T2A רצף פפטיד עצמית שהפריד בין השארית 5' קידוד אקסון ואת הרצף transactivator כדי למנוע תרגום חלבון chimeric. הוסף codon עצירה של תרגום אחרי רצף אקסוגניים transactivator (איור 5).
    2. PCR להגביר את הזרועות הומולוגיה מהדנ גנומית (gDNA) שחולצו מן השורה לטוס האב שנבחר עבור הזרקה (למשל, nos-Cas9 (על כרומוזום X), BL # 54591) באמצעות תחל את המופיעים בטבלה 1B. השתמש פולימראז באיכות גבוהה עבור כל התגובות PCR באמצעות המערכות כדלקמן: 5 μL של 5 x תגובת מאגר, 0.5 μL של dNTPs 10 מ"מ, 1.25 μL של 10 μM פריימר לפנים, μL 1.25 של 10 μM הפוך פריימר, 0.5 μL של תבנית ה-DNA, 0.25 μL של אמינות גבוהה DNA פולימראז , ΜL 16.25 ddH2O.
    3. השתמש ליניארית שיבוט וקטור כגון pUC19. מספר התורמים וקטורים זמינים כעת. ראה רשימה מקיפה-אתר האינטרנט-http://flycrispr.molbio.wisc.edu הבאים.
    4. להפעיל את המוצרים PCR על ג'ל agarose 1%. לבצע את אלקטרופורזה מספיק זמן להבטיח הפרדה ברורה של הלהקה הרצוי של הלהקות לא ספציפית רצויה (אם בכלל). ג'ל-לטהר שברי DNA הצפוי. למדוד את הריכוז של כל שבר DNA מטוהרים באמצעות ספקטרופוטומטרים.
    5. להגדיר את התגובה הרכבה DNA בעקבות ההוראה של היצרן. לערבב ליניארית שיבוט וקטור והיעד שברי מ שלב 3, שלב 4, התגובה הבאה: 1 μL של ליניארי שיבוט וקטור (50 ng/μL), 2-3 עודף הקיפול של כל שבר היעד, 10 μL של 2 x מיקס מאסטר הרכבה דנ א, להביא שעוצמת התגובה האחרונה μL 20 עם ddH < c21 > 2או Incubate המיקס התגובה למשך שעה ב 50 º C.
    6. להפוך את μL 2 של המוצר הרכבה חיידקים המוסמכת, צלחת על פלטות אגר ליברות/מגבר המכיל אמפיצילין μg/mL 100. בנוסף, להוסיף X-גל + IPTG בצלחת להקרנה כחול/לבן.
    7. לקחת 3-4 לבן מושבות מהצלחת מודגרות לילה, לחסן את המושבה ב- 3 מ ל LB המכיל אמפיצילין μg/mL 100, לגדול ב 37 מעלות צלזיוס למשך הלילה ב שייקר. במדריך של תמצית פלסמיד מהבקטריות תרבותי בין לילה באמצעות ערכת הכנה מיני פלסמיד בעקבות היצרן (ראה טבלה של חומרים).
    8. מסך המושבה חיובי על ידי עיכול PCR או הגבלה.
    9. רצף לאמת האזור התורם HDR של פלסמיד הסופי. שמירת מלאי חיידקי טרנספורמציה הנכון שיבוטים גליצרול 20% ב- 80 ° C עבור חיסון לעתיד.

3. העובר הזרקה, גנטיקה לעוף, הקרנה לעריכה הגנום

  1. להכין הגבוה טוהר gRNA נטולת אנדוטוקסין ביטוי וקטור, כמו גם את פלסמיד התורם HDR באמצעות maxiprep של פלסמיד קיט (ראה טבלה של חומרים).
  2. שיתוף להזריק את פלסמיד ביטוי gRNA (100 ng/μL), התורם חלופי (500 ng/μL) לתוך germline של עוברי nos-Cas9 6. הערה: אנו משתמשים שירות מסחרי להזרקה, אך ניתן לבצע הליך זה גם במעבדה.
  3. לטוס גנטיקה ההקרנה (איור 2 , איור 3):
    1. כאשר מוזרק העוברים המתפתחים להיות מבוגרים, לחצות כל יחיד G0 טסה שאיזון זבובים. בחר מאזן מתאים עבור כרומוזום המכיל אלל יישוב.
    2. עזים ומתנגד של F1 צאצאים של כל G0 לחצות על משטח2 CO, נבחר באקראי 10-20 גברים תחת stereomicroscope. לחצות אותם בנפרד אל הנקבות שאיזון כמוצג באיור3.
    3. כאשר הפתח הזחלים F2, בחר האב F1 יחיד מהצלב כל ולחלץ את gDNA באמצעות אחד לטוס גנומית DNA הכנה פרוטוקול:
      1. הכנת מאגר החילוץ gDNA: 10 מ מ טריס-Cl pH 8.2, 1 מ"מ EDTA, 25 מ מ NaCl, לשמור בטמפרטורת החדר. להכין 20 מ"ג/מ"ל פתרון מניות Proteinase K ולאחסן במקרר.
      2. מכניסים כל זבוב צינור מיקרו-צנטריפוגה 1.5 mL ויסמנו את הצינור. לשמור במקפיא-80 מעלות צלזיוס למשך הלילה.
      3. הכנת אמצעי העבודה טריים gDNA החילוץ מאגר המכיל 200 µg/mL הריכוז הסופי של ק' Proteinase
        הערה: אין להשתמש מאגר הישן לצעד הזה.
      4. למחוץ כל זבוב עבור s 10 – 15 עם טיפ פיפטה המכיל 50 μL של מחיצות מאגר ללא מחלק את הנוזל. לוותר על המאגר הנותרים לתוך הצינור ומערבבים היטב. דגירה ב 37 מעלות צלזיוס למשך 20-30 דקות.
      5. לשים צינורות בבלוק חום 95 מעלות צלזיוס למשך 1-2 דקות להשבית את ק' Proteinase
      6. ספין למטה במשך 5 דקות ב x 10,000 ג'י. לאחסן את התכשיר 4 ° C לצורך ניתוח נוסף PCR.
  4. להשתמש באותה השיטה כדי להכין gDNA מחבצלת nos-Cas9 , אשר משמש פקד שלילי. לבצע שלושה שלבים מסכי ה-PCR מבוסס כדי לזהות את הנכונות "מסתיימת החוצה" HDR (איור 2, איור 5) באמצעות gDNA של כל זכר F1 כמו תבנית5. השתמש μL 1 של ההכנות DNA במערכת ה-PCR התגובה הבאה: μL 10 של 2 x מיקס מאסטר PCR עם צבע, μL 1 של כל פריימר (10 μM), μL 1 של תבנית ה-DNA, 7 μL של ddH2O.
  5. כפי שמוצג באיור 5A, לבצע PCR באמצעות תחל fwd1 rev1 למסך את עצם קיומו של ההכנסה או החלפת; לבצע PCR באמצעות תחל fwd2 ו- rev2 כדי לוודא את ההכנסה או החלפת מאזור 3'; לבצע PCR באמצעות תחל M13F ו- rev3 כדי לבדוק "מסתיים-ב" HDR (טבלה 1C).
  6. לשמור על הקווים לטוס עם HDR אישר הקצוות-אאוט ולהקים מניות מאוזנת בני הדור F2. Outcross הזבוב העומס שוב כדי להסיר כל מוטציות לא מכוונות על כרומוזום אחרים.
  7. להכין gDNA באיכות גבוהה מן המניות הוקמה עבור הגברה PCR ארוך (> 800-1000 nt) אמפליקון עם אמינות גבוהה. אנזימים, באופן מלא רצף לאמת את amplicons המתקבל האזורים גנומית מהונדסים. לחלופין, השתמש gDNA גולמי תמצית כמתואר קודם לכן כדי להגביר קצר יותר (< 800 nt), חופפים PCR מוצרים לאימות רצף הגנום הערוך. השתמש בפרוטוקול הבא להכין באיכות טובה דרוזופילה דנ א גנומי:
    1. לשים על הזבוב הבוגר 25 1.5 mL microcentrifuge צינור, ומקפיאים במקפיא-20 ° C או -80 ° C למשך לפחות שעה.
    2. להוסיף 250 μL של פתרון A (pH 9.0 טריס HCl 0.1 M, EDTA 0.1 M, למען חברה דמוקרטית 1%).
    3. Homogenize זבובים באמצעות בקווקז homogenizing את צינורות microcentrifuge והניח את הצינורית על קרח.
    4. דגירה-70 מעלות צלזיוס למשך 30 דקות.
    5. הוספת 35 μL של KOAc (5 מ'), לנער, לערבב היטב, אבל לא מערבולת.
    6. דגירה על קרח למשך 30 דקות.
    7. ספין-x 12,000 g למשך 15 דקות.
    8. עם micropipette 1 מ"ל, בזהירות להעביר רק את תגובת שיקוע ברור צינור חדש, עוזב חזרה כל המשקע או לאטמוספרה.
    9. להוסיף 150 μL של אלכוהול איזופרופיל תגובת שיקוע. מערבבים בעדינות על-ידי היפוך.
    10. ספין-x 10,000 g עבור 5 דקות.
    11. בזהירות להסיר את תגובת שיקוע ולהשאיר בגדר בצינור.
    12. לשטוף את גלולה עם 1 מ ל 70% EtOH.
    13. ספין-x 12,000 g עבור 5 דקות.
    14. הסר את תגובת שיקוע. האוויר יבש בגדר למשך 15-20 דקות. לא מעל יבשה בגדר.
    15. להמיס בגדר ב 100 μL של ddH2O.
    16. השתמש דיוק גבוה DNA פולימראז מתאים אמפליקון ארוך (> 800 bp) כדי להגביר את האזור הערוך השלם. באופן אידיאלי, לקחת שני צבעי יסוד מחוץ בקלטת שנוספו כדי להגביר את האזור גנומית. ג'ל לטהר את המוצר PCR, כפי שהוסבר קודם, רצף לאמת את המוצר עם תחל חופפים מרובים.
  8. לאמת את דפוסי ביטוי ייתכן הנכון מעוברים ביתור רקמות/הקווים לטוס מהונדסים:
    1. לבצע RT-PCR מ הרנ א הכולל כדי לאמת את הביטוי של המוצר mRNA היברידית (1D טבלה).
    2. ביצוע של הכלאה בחיי עיר של המוצר mRNA של הריבית ב הרקמות/העובר זחל כדי לאמת את הביטוי.
    3. למסך עבור דפוסי ביטוי ייתכן מדויק של רקמות ספציפיות בין השורות הקצוות-אאוט תבדוק-רצף, צלב לכל הקווים הערוך שהושג עבור מנהל ההתקן ביטוי בינארי עם LexO- GFP או LexO- RFP (עבור לקסה נהג) קו (זמין ממרכזי מניות בלומינגטון) ולבחון את לקסה או Gal4 מונע כתב-גנים ברקמות העובר, זחל, מבוגר מתחת למיקרוסקופ קרינה פלואורסצנטית.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

פרוטוקול זה שימש בהצלחה כדי ליצור ביטוי בינארי יישוב כתב מערכת ספציפי עבור bnl לבטא תאים5. Cis-אלמנטים רגולטוריות (קרס) כי ייתכן מורכבים bnl הביטוי שליטה לא מאופיינים. לכן, כדי להשיג ביטוי ייתכן תחת השליטה של רצף רגולטורי אנדוגני bnl , רק אקסון קידוד הראשון של bnl נועד להיות מוחלף עם רצף transactivator לקסה חיידקי. נבחר של קלטת משופרת nls-LexA::p65 ידוע לספק מיטביים ביטוי דרוזופילה .

אסטרטגיית ההחלפה שמטרתם ליצור chimeric של שקל-LexA:p65-bnl mRNA תחת בקרת גנים ברמת השעתוק והתרגום post-transcriptional אנדוגני. MRNA chimeric הזה הכיל שלם של bnl 5' UTR, חלק בקצה 5' וסופו 3' של הערוך bnl קידוד אקסון (אקסון הראשון), אינטרונים מלאה במורד הזרם bnl ואת exons. כדי לשמר את bnl RNA ספציפיים שחבור של אקסון הוחלף, נשמרו קטן 5' ו 3' קצוות אקסון קידוד הוחלף. עם זאת, כדי למנוע סינתזה של חלבון Bnl chimeric דבוקה nls -לקסה: p65, T2A רצף פפטיד עצמית שהפריד סופחה בין שרידי 5' bnl קידוד האזור ואת את ATG של שקל-LexA:p65. כמו כן, נוספה codon עצירה תרגום לאחר nls-LexA:p65 רצף להימנע תרגום משותף של קטום Bnl חלבון5 (איור 4 , איור 5A).

שימש תורם חלופי המכיל את כל התכונות האלה, אשר היו את T2A-שקל-LexA:p65 זרועות הומולוגיה רצף 2 kb 5' - ו 1.8 kb 3' -. הומולוגיה רב זרועות שימשו HDR יעיל והוספה של קטע DNA גדולים באתר של תיקון (T2A-nls-LexA:p65 הוא 1.8 kb) (איור 5A).

GRNAs שני שימשו כדי ליצור DSBs בכל המיקומים המוגדרים למחיקת רוב אקסון קידוד הראשון של bnl. GRNAs שני שתאמו את כל הקריטריונים המתוארים בסעיף 1.3 (רצף פאם בקו תחתון) היו:
gRNA1: TGTATCTGCGATGCCCCTCATGG
gRNA2: ATCCTTCAGATATTGCGGGATGG

בשני האתרים זיהוי gRNA היו משובשות, התורם החלפת מאת אקסוגני T2A-שקל-LexA:p65 רצף, אשר היא הדרך הקלה ביותר כדי למנוע retargeting של gRNAs על מיקומה מהונדסים. רצפי זיהוי gRNA שיבשו התורם חלופי (הרצף אקסוגני זה שיבשו gRNA אתרי זיהוי בכתב נטוי) היו:
gRNA1: TGTATCTGCG -GGCTCCGGCGAAGGAC...
gRNA2:... AAAAACTCGTTTAGA- CGGGATGG

הווקטור gRNA pCFD4 ביטוי המכיל gRNAs אלה, יחד עם התורם חלופי, היה שותף מוזרק לתוך germline nos-Cas9 העובר. לאחר מכן, הפרוטוקול המתואר כאן יושם אל מסך עבור החלפת המיועד (איור 5B, ג). כ- 67% מהחיות G0 מוזרק היו פוריים. 56% של G0s הפורה המייסדים, אשר הולידה רומא HDR-חיוביות. בין הוא צאצא F1 בדק, כ-23% היו חיוביות עבור HDR מוצלח, 73% HDR חיובי היו "מסתיים-אאוט" (טבלה 2). מאז התכנות הראשון אקסון של bnl "הכרה", כל הקווים HDR נמצאו להיות homozygous קטלני, ואת המניות היו מתוחזקים על כוחות מאזנים.

הדור של mRNA לקסה-bnl chimeric התאים אומתה על ידי ניתוחים RT-PCR (איור 5D). כדי לוודא אם שהושג bnl-לקסה הקווים היו לידי ביטוי התבנית ביטוי אנדוגני bnl , כל שורה HDR "מסתיים-אאוט" היה חצה זבובים הטרנסגניים LexO-mCherryCAAX 5, התבנית ביטוי כתב נבדק ב רומא עוברי ו הזחלים. 42 מתוך 46 הסתמנו ביטוי מדויק ייתכן עקבית עם דפוסי שדווחה בעבר bnl 5 (איור 6). ארבע שורות הראה גם דפוסי ביטוי חלש או שאינם ספציפיים. אנו צופים כי הקווים האלה אולי צברו מוטציות, לה אנו זקוקים כדי לוודא עם רצף יסודי ניתוחים. יחד תוצאות אלה אישר אסטרטגיית ההחלפה אקסון בתיווך HDR בהצלחה מועסק כדי ליצור מערכת יישוב ביטוי בינאריים עבור הגן. הכלי יכול לשמש בהצלחה לבטא כתב או חוץ רחמי גנים בתבניות ייתכן של הגן bnl .

Figure 1
איור 1: ערכה של מערכת בינארית שעתוק גנים יישוב. Transactivator (GAL4 או לקסה), הביע תחת השליטה של cis-רגולציה אלמנטים (קרס) של הגן, כוננים transgene אפקטור ממוקם במורד הזרם של האתרים מחייב שעתוק ספציפיים (UAS עבור Gal4 או LexAop עבור לקסה). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: סקירה כללית של זרימת עבודה עבור הגנום CRISPR/Cas9-מתווכת ' עריכה כדי ליצור מערכת בינארית שעתוק. משך זמן משוער הנדרש עבור כל שלב מסומן. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: המחשה של CRISPR הקרנת ותעשיה צלב ערכה להקמת נערך הגנום קווים לעוף. בצלבים גנטי, R מייצג אלל הערוכות זו על כרומוזום ה-3rd . MKRS (גברת Tp (3; 3), ז (3) 76A ריי קאר [1] [1] [2] Sb [1]), הוא סמן כרומוזום 3רואד ; TM6B (ב- TM6B (3LR), Antp [הוא] e [1] Tb[1]) היא העומס כרומוזום 3rd . מניות לטוס הגנום נערך אומתו PCR הגברה האזורים היעד של הריבית של ה-DNA גנומי שחולצו מן זבובים בדור F2 או F3, רצף הקובע את המוצרים ה-PCR. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: דור של קלטת חלופי על ידי העצרת דנ א. ציור סכמטי המתאר PCR הגברה והרכבה של מוצרים שונים PCR (א, ב, ג) לתוך הווקטור התורם (ד) באמצעות שיטת ההרכבה הדנ א. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5: דור bnl-לקסה על ידי החלפת אקסון CRISPR/Cas9-מתווכת. (א) שרטוט המתאר את האסטרטגיה של CRISPR/Cas9 סכמטי מתווכת HDR עבור אקסון להחלפת במיקומה bnl . תיבת - אקסון; קו-אינטרון; החלפת התורם (pDonor -bnl:LexA) ואת שתי תוצאות אפשריות של HDR הוצגו. PDonor -bnl:LexA היה את התכונות הבאות: (1)T2A-nls-LexA:p65 (~1.8kb) רצף ולצדו 2 kb ו- 1.8 kb זמן הומולוגיה זרועות (קווים מקווקווים), (2) T2A פפטיד עצמית שהפריד בין אקסון מסוף bnl שיורית של N את nls-LexA:p65, ו- (3) codon להפסיק תרגום (אדום *) לאחר nls-LexA:p65 רצף. המוצר HDR נשמרים כל שליטה גנים ברמת השעתוק והתרגום post-transcriptional של bnl,ולא את לקסה: p65 חלבון צפוי להיות מיוצר אותו דפוס כמו חצים Bnl. קטן שחור אנדוגני להראות את אתרי קישור יחסית (לא בתוך קנה המידה) של תחל PCR (טבלה 1) משמש 3-צעד ההקרנה או אימות RT-PCR. (B) Agarose ג'ל תמונות מציג תוצאות של ההקרנה PCR 3-צעד. מוצרי ה-PCR מוגבר של ה-DNA גנומי של ארבע שורות HDR מוצלח של הקצוות-אאוט מוצגים; שלילי שליטה, ה-DNA גנומי של nos-Cas9 הקו הורים; בקרה חיובית, pDonor -bnl:LexA פלסמיד; M סמן (סולם הדנ א SL2K). (ג) דוגמה של הג'ל ההקרנה מציג את המוצר PCR הצפוי באמצעות תחל M13F ו- rev3 עבור מסתיים בקווים; M8-7 ו- M9-6 הם שני הקצוות-אין קווים; פקדים שליליים או חיוביים, כמו ב'; M סמן (נב 1 kb סולם הדנ א). (ד) ניתוח RT-PCR על סך RNA bnl-לקסה , הפקד nos-Cas9 זבובים. פריימר לפנים נקשר לאזור מסוים לקסה , פריימר הפוכה נקשר לאזור אקסון במורד הזרם bnl ; ~ 440 הלהקה הגברה bp (בסיס-זוג) (*) זוהה מ- RT-PCR- bnl-לקסה mRNA, אך לא את פקד ה-RNA. M bp 100 סמן (נב). מקורי דמויות 2 ו- S1 ב- Du ואח. 20175. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 6
איור 6: אימות של רקמות ספציפיות, מותנה bnl-לקסה ביטוי ברקמות שונות. ביטוי bnl (י-ם) (אדום) ברקמות הזחל שונה, עם btl לבטא התאים מוצג בצבע ירוק. (א, א ') אגף דיסק מקור bnl לפני ראשית שק האוויר גדל (ASP). (ב, ג) ביטוי bnl TR5 החיבור רוחבי (TC) (B) וענף TR2 הגבי (DB) (C). (ד) bnl ביטוי דיסקים באברי המין. (ה'-י') ביטוי דינמי bnl (אדום) במהלך סניף והכו אותי עובריים (ירוק) המתבנת; חיצים קטנים, חמישה מקורות bnl המקיפים את placode והכו אותי בשלב 10. אחרים: A-J; btl-Gal4, UAS- CD8GFP / +; bnl-לקסה, LexO- CherryCAAX /+. (K-L ') היפוקסיההמושרה bnl-לקסה ביטוי בפרופיל כנף דיסקים ומקושרת TR2 והכו אותי metamere (TC, DB, תא המטען הגבי-DT). גנוטיפ: bnl-לקסה, LexO -CherryCAAX / +. (K) דיסקים שליטה מ ex-vivo תרבותי איברים ללא CoCl2. (L-L") אגף דיסקים (L, L') וקנה הנשימה (DT, (L ')) מ בתרבית שמחוץ איברים עם CoCl2 המושרה היפוקסיה. כוכב, חוץ רחמי ביטוי המושרה על ידי היפוקסיה. גודל ברים = 30 מיקרומטר; 50 מיקרומטר (K-L"). חיבור מקורי איור 3 ב- Du ואח. 20175. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

GRNA א שיבוט ורצף
bnl-לקסה gRNA fwd TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
bnl-לקסה gRNA rev ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
ב-cGACGTTAAATTGAAAATAGGTC
פריימר T3 המשמש רצף CAATTA ACCCTCACTAAAGG-3'
הערה: נוקלאוטידים בקו תחתון anneal U6 יזם או gRNA הליבה על וקטור pCFD4, g/c באותיות קטנות נוספה כדי לסייע תמלול תלויי-יזם U6
נולד ב HDR התורמת הבנייה
bnl N-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
bnl-לקסה-N-R tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
C
לקסה-F CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
לקסה-R CTAAACGAGTTTTTAAGCAAACTCACTC
לקסה bnl-C Fwd TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
bnl C-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
הערה: נוקלאוטידים ב ההון חפיפה עם וקטור pUC19 להרכבה גיבסון, נוקלאוטידים בקו תחתון היו רצף החריגה T2A פפטיד תוספת.
ג ההקרנה HDR ורצף
bnl-לקסה scr fwd1 GTGGCGCACGCCCAATAAAC
bnl-לקסה scr rev1 GATCCCAGCCAATCTCCGTTG
bnl-לקסה scr fwd2 CAACGGAGATTGGCTGGGATC
bnl-לקסה scr rev2 CTGGCCAACTGTAGGGAAGTC
מסתיים בסימון rev3 GCAATGTTATGCAATGCGTTGAC
bnl-לקסה seq fwd3 CACTTGTCGCCCATATTGATACAATTG
הערה: תחל אלה שימשו PCR ההקרנה, רצף, המיקומים משוער של אתרי קישור פריימר מוצגות באיור איור 5A כמו fwd1-2 ו- rev1-3.
ד ניתוח RT-PCR
RT-f GATATGGATTTCTCCGCTTTGCTG
RT-r CCATGCAGAGATACAGGCAAGTG

טבלה 1: תחל השתמשו במחקר זה. תחל (A) עבור שכפול gRNA ביטוי וקטור ורצף. תחל (B) עבור שכפול תבנית התורם HDR. (ג) תחל ההקרנה, רצף של המוצרים HDR. תחל (D) המשמש לאימות RT-PCR של המוצר mRNA לקסה-bnl chimeric.

גן # מושגים בסיסיים % קצב שידור HDR (# תנובה HDR G0 פורייה G0 / #) # F1 מוחלט F1 / # HDR-חיוביות בדק (%) # "מסתיים-אאוט" HDR / # הכולל HDR (%)
bnl-לקסה 56 (15/27) 23 (60/259) 73 (46/60)

בטבלה 2: היעילות של CRISPR/Cas9-מתווכת HDR- קצב השידור HDR מחושבת הסימן # של תנובה HDR G0 / # של סה כ G0 פורייה. % HDR מוצלח מחושבת הסימן # של HDR-חיוביות F1 / # של F1 הכולל מוקרן. "מסתיים-אאוט" % מחושבת הסימן # "מסתיים-אאוט" HDR / # של HDR חיובי מוחלט.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

באופן מסורתי, מלכודות משפר דרוזופילה נוצרו על ידי שתי שיטות שונות. אחת הדרכים כולל הכניסה אקראי של מנהל התקן (למשל., Gal4) רצף הגנום על ידי טרנספוזיציה (למשל., P-אלמנט טרנספוזיציה)1 . לחלופין, ניתן להציב את רצפי הנהג תחת שליטה תעתיק של אזור משפר בשם/יזם בונה פלסמיד, אשר אז ניתן לשלב אתר חוץ רחמי של גנום3,11. למרות ששיטות אלה יצרו בריכה גדולה של Gal4 או מלכודות משפר לקסה עבור דרוזופילה, יש להם מספר מגבלות. P-יסוד-מתווכת ההוספה אקראיות בגנום עלולות לשבש את הפעילות התקינה של קריטי cis-רצפים רגולטוריות. עקב כמהותיות אקראיות בגנום, transactivator הביטוי עשוי לדווח על דפוסים של גנים סמוכים מרובים. מצד שני, ידע מוקדם של הרצף cis-הרגולציה של גנים הוא הכרחי עבור לבנות פלסמיד משפר-השמנה. יש גם גבול האורך של רצף כי ניתן לשכפל במקצועות בונה פלסמיד. בידוד, שיבוט רק חלקית שבר של ה-DNA של ההקשר גנומית אנדוגני עשוי לא להתרבות דפוסי ביטוי גנים ספציפיים מלאה. למשל, קו bnl-Gal4 (NP2211), אשר הופק על ידי אלמנט P הכניסה של מלכודת enhancer Gal4 רכיב קצת לפני הגן bnl , לא לגמרי לשכפל את דפוסי ביטוי גנים ספציפיים בתוך העובר5 . לכן, תחת הקשרי כזה, טכניקות repurposing, כגון לפרוץ (הומולוגיה בסיוע CRISPR טוק-in), כי ניתן להמיר Gal4 קיימים קוים לקסה או Q-מערכת אחרת מבוסס נהג קו12 לא ייתכן מאוד שימושי. כדי להתגבר על מגבלות אלה, כאן, אנחנו תיאר שיטה חלופית ויעיל ליצירת מערכות בינאריות ביטוי על-ידי עריכת הגנום. בשיטה זו, החליפו את אקסון קידוד הראשון של גנים עם transactivator (למשל., לקסה או Gal4) רצף כך הביטוי של הנהג שעתוק מחקה באופן בלעדי את דפוסי זמן-מרחבי של ביטוי גנים. למרות האסטרטגיה והפרוטוקולים המתוארים כאן אופטימציה להצגה bnl -ביטוי, השיטה יכול בקלות להיות מאומץ עבור גנים אחרים.

קביעת אתר הכניסה בתוך אזור הגן יישוב הוא השלב הקריטי ביותר באסטרטגיה ניסיוני. השיטה הצגנו תוכנן כדי לשמור את כל המקורי תעתיק כמו גם התקנות post-transcriptional של ג'ין bnl 5. לכן, שתכננו למחוק את מרבית אקסון קידוד הראשון של הגן bnl והחלף אותו בקלטת לקסה . התחליף היה מתוכנן כך אלל הערוך מבטא היברידית לקסה-bnl mRNA אנדוגני תמלול, תרגום להתחיל באתר של bnl תוך שמירה על כל האזורים intronic. עם זאת, היברידית mRNA תוכנן לייצר חלבון לקסה היחיד, אך לא Bnl. הראינו כי האסטרטגיה יצרו בהצלחה bnl-לקסה /LexO-מבוסס ומערכת שעתוק כי המערכת יכולה לדווח במדויק את דפוסי ביטוי דינמי, ייתכן bnl (איור 5)5 . מגבלה של תהליך זה הוא קטלני homozygous שורות דרוזופילה אם הגן יישוב חיוני להישרדות. עוד יותר, השימוש באסטרטגיה כפולה gRNA עשויים להגדיל את הסיכוי של חופש-יעד עריכה. אסטרטגיית חלופי יכול להיות מועסק כדי להימנע מבעיות אלה. באסטרטגיה זו, קלטת לקסה או Gal4 ניתן להניח נכון באתר התחלה ATG של הגן הוחלף ו- T2A ניתן להציב רצף פפטיד עצמית שהפריד בין בקלטת לקסה/Gal4 תחילת אקסון קידוד תקין של הגן היעד. אסטרטגיה זו צפויה לייצר mRNA chimeric כך שניתן יהיה לתרגם גם את transctivator וגם את המוצר גן פונקציונלי. עיצוב כזה ואולי להפחית את הסיכוי homozygous הקטלניות. באסטרטגיה זו, gRNA אחת מספיקה לעריכה הגנום. עם זאת, בנוכחות שני עותקים של גנים פונקציונלי, ביטוי וריאנטים הטרנסגניים חלבון מונע על ידי הנהג Gal4/לקסה (למשל., bnl-לקסה המונעת על ידי ביטוי של LexO- Bnl: GFP fusions, או Bnl חלבונים עם מחיקות) לא יספק מידע מהפונקציונליות של החלבונים variant.

מגבלה של האסטרטגיה לעריכת הגנום הוא תהליך מפרך של פילוח ועריכה של גן יחיד בכל פעם. עם זאת, הפשטות והיעילות של CRISPR/Cas9-מתווכת ' שיטת העריכה הגנום מהפכה יישוב גנומית טוק-טוק-אווט וטכנולוגיה חלופי זה יכול בקלות להיות בפרשה סטנדרטי בכל מעבדה. בבשנים האחרונות, חוקרים דרוזופילה פיתחו נוחים ומקורות לעריכה גנום זה יכול להיות מועסק כדי להרחיב את toolsets גנטיים חיוניים על ההבנה הביולוגית הבסיסית תהליכים7,13 . הגנום עריכה וסינון התהליכים המתוארים כאן היא מהירה יחסית ולוקח בערך חודשיים לעומת כל האחרים הומולוגי מבוססי רקומבינציה החלפת. לתוצאות מוצלח ויעיל לעריכת הגנום, חשוב לעקוב אחר מספר שלבים קריטיים מבחינה טכנית: 1) כל gRNA נבחרה על ידי לכתחילה המרבי ועל פעילות ללא פוטנציאל את המטרה; 2) התורם HDR מכיל ~1.5 kb הומולוגיה זרועות איגוף את gRNA מיקוד אתרים. הומולוגיה עוד נשק (1.8-2 kb) משמשים כדי להגביר את היעילות של HDR כאשר קטע DNA אקסוגני גדול צריך להיות מוכנס; 3) התורם HDR תוכנן להיות חופשי gRNA זיהוי האתרים כדי להימנע retargeting של gRNA על מיקומה מהונדסים; . ו-4) התוכנית המושלמת משוכלל ותיאום העיתוי של חוצה גנטי עם הקרנה מבוססי ה-PCR 3-צעד כדי לבחור קו HDR "מסתיים-אאוט".

בניגוד טרנספוזיציה אקראית או משפר משובטים בונה, האסטרטגיה והפרוטוקולים אנו המתואר כאן מבטיחה מהדור אך ורק למטרה מערכת בינארית שעתוק גנים ספציפיים. מאז הביטוי של הנהג מחליף של אקסון ג'ין מקורית, ביטוי גנים ספציפיים של הנהג הוא גם תכליתי וצפויה לחקות דפוסי ביטוי גנים התפתחותית, מטבולית, מצבים פיזיולוגיים כל5. ביטוי גנים/תא-ספציפיות הוא הקריטריון המבוקשות ביותר של כל הקווים הנהג בינארי כאשר הם משמשים שונים התא, ביולוגיה התפתחותית שיטות. למשל, ביטוי גנים ספציפיים של גנים כתב על ידי נהג שעתוק מקלה על שושלת היוחסין אמין ניתוחים של התאים לבטא את הגן היעד. זה גם מאפשר הדמיה ומעקב בשידור חי של הביטוי ייתכן, הגירה, ארגון מחדש של תאים במהלך הפיתוח. לחקור את האירועים תאית ומולקולרית במהלך מורפוגנזה רקמות, Gal4 או לקסה מונע ביטוי/misexpression של חיוניים שונים transgenes, מציאה RNAi בתיווך גנים דפיקה למטה קבוצות ספציפיות של תאים. מערכת ביטוי יישוב ספציפי מאוד מספק משוחדת ניתוח ופרשנות של התוצאות. לכן, מבוססת על CRISPR/Cas9 פילוח של אקסון של ג'ין והחלפת שלה עם רצף transactivator מספק חלופה טובה יותר ליצירת מערכות ביטוי גנים יישוב מאוד ספציפיים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים יש שאין ניגודי אינטרסים לחשוף.

Acknowledgments

אנו מודים יציאת פ ד ר ד ר ק' אוקונור-ג'יילס, ד ר ס פנג לדיונים על אסטרטגיה CRISPR; שחפת ד ר קורנברג, המרכז מניות בלומינגטון ריאגנטים; UMD מתקן דימות הליבה; המימון של NIH: R00HL114867 ו- R35GM124878 כדי האב

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics