जीनोम संपादन द्वारा Drosophila में ऊतक विशिष्ट द्विआधारी प्रतिलेखन प्रणाली पैदा करने के लिए एक कुशल रणनीति

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

यहां, हम प्रतिलेखन ड्राइवरों के साथ जीन की पहली कोडिंग एक्सॉन की जगह द्वारा Drosophila में ऊतक विशिष्ट द्विआधारी प्रतिलेखन प्रणाली पैदा करने के लिए एक विधि प्रस्तुत करते हैं । CRISPR/Cas9-आधारित विधि एक जगह जीन के अंतर्जात विनियमन के तहत एक transactivator अनुक्रम रखता है, और फलस्वरूप जीन विशेष transctivator पैटर्न में विशेष रूप से spatiotemporal अभिव्यक्ति की सुविधा ।

Cite this Article

Copy Citation | Download Citations

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

द्विआधारी प्रतिलेखन प्रणाली शक्तिशाली आनुवंशिक उपकरण व्यापक रूप से visualizing और सेल भाग्य और कोशिकाओं या मॉडल जीवों में ऊतकों के विशिष्ट समूहों में जीन अभिव्यक्ति जोड़ तोड़ के लिए इस्तेमाल कर रहे हैं । इन सिस्टमों में अलग ट्रांसजेनिक रेखाओं के रूप में दो घटक होते हैं । एक चालक लाइन ऊतक के नियंत्रण के तहत एक transcriptional उत्प्रेरक-विशिष्ट प्रवर्तक/बढ़ाने, और एक रिपोर्टर/प्रभाव लाइन एक लक्ष्य जीन प्रतिलेखन उत्प्रेरक के बंधन साइट के लिए बहाव रखा बंदरगाह । पशु दोनों घटकों को शरण एक लक्ष्य जीन अभिव्यक्ति की ऊतक विशिष्ट transactivation प्रेरित । लक्षित ऊतकों में जीन की सटीक spatiotemporal अभिव्यक्ति कोशिका की निष्पक्ष व्याख्या के लिए महत्वपूर्ण है/ इसलिए, विशेष सेल/ऊतक-विशिष्ट ड्राइवर लाइनों पैदा करने के लिए एक विधि का विकास आवश्यक है । यहां हम एक विधि एक "नियमित रूप से अंतरालीय लघु Palindromic दोहराने/CRISPR-एसोसिएटेड" (CRISPR/Cas) आधारित जीनोम संपादन तकनीक को रोजगार द्वारा अत्यधिक ऊतक विशिष्ट लक्षित अभिव्यक्ति प्रणाली उत्पंन करने के लिए एक तरीका प्रस्तुत करते हैं । इस विधि में, endonuclease Cas9 डबल-कतरा टूटता (gRNA) बनाने के लिए एक्सॉन जीनोम में एक जीन की पहली कोडिंग Drosophila में विशिष्ट साइटों के लिए दो chimeric गाइड RNAs (DSB) द्वारा लक्षित है । बाद में, transactivator अनुक्रम युक्त एक exogenous दाता प्लाज्मिड का उपयोग करते हुए, कोशिका-स्वायत्त मरंमत मशीनरी DSB के समरूपता-निर्देशित मरंमत (HDR) को सक्षम करती है, जिसके परिणामस्वरूप एक्सॉन के साथ सटीक विलोपन और प्रतिस्थापन होता है transactivator अनुक्रम. खटखटाया-transactivator में विशेष रूप से कोशिकाओं में व्यक्त किया जाता है, जहां सीआईएसप्रतिस्थापित जीन के नियामक तत्वों कार्यात्मक हैं । विस्तृत कदम दर कदम प्रोटोकॉल यहां प्रस्तुत एक द्विआधारी transcriptional ड्राइवर पैदा करने के लिए Drosophila fgfमें व्यक्त/branched-उत्पादक उपकला/न्यूरॉन कोशिकाओं किसी भी जीन या ऊतक-विशिष्ट अभिव्यक्ति के लिए अपनाया जा सकता है ।

Introduction

लक्षित जीन अभिव्यक्ति के लिए आनुवंशिक toolbox अच्छी तरह से Drosophilaमें विकसित किया गया है, यह सबसे अच्छा मॉडल प्रणालियों में से एक के लिए सेलुलर प्रक्रियाओं की एक विस्तृत विविधता में शामिल जीन के समारोह की जांच कर रही है । द्विआधारी अभिव्यक्ति सिस्टम, जैसे खमीर Gal4/यूएएस (ऊपर सक्रियकरण अनुक्रम), पहले ऊतक विशेष बढ़ाने फँसाने और Drosophila आनुवंशिक मॉडल1 (चित्रा 1) में जीन अर्थ के लिए अपनाया गया था । यह प्रणाली ऐसी जीन व्यक्त की spatiotemporal विनियमन के रूप में तकनीक की एक बड़ी संख्या के विकास की सुविधा, व्यक्त, कोशिकाओं के चयनित समूहों में नॉकआउट के रूप में के रूप में अच्छी तरह से सेल पृथक में, सेल अंकन, सेलुलर और आणविक के लाइव अनुरेखण भ्रूण और ऊतकों, वंश अनुरेखण और मोज़ेक विश्लेषण में विकास के दौरान प्रक्रियाओं । ऐसे बैक्टीरियल LexA/LexAसेशन प्रणाली (चित्रा 1) और Neurospora क्यू प्रणाली के रूप में द्विआधारी प्रतिलेखन प्रणाली, के एक नंबर, शक्तिशाली आनुवंशिक उपकरण है कि अब व्यापक रूप से Drosophila में इस्तेमाल कर रहे हैं , इसके अलावा में लक्षित जीन अभिव्यक्ति के लिए मूल Gal4/यूएएस प्रणाली1,2,3

यहाँ, हम एक जीनोम संपादन तकनीक को रोजगार के द्वारा अत्यधिक विश्वसनीय ऊतक विशिष्ट द्विआधारी अभिव्यक्ति प्रणाली उत्पन्न करने के लिए एक विधि प्रस्तुत करते हैं । CRISPR/Cas9 जीनोम संपादन प्रौद्योगिकी में हाल ही में प्रगति के लिए अभूतपूर्व जीवों की एक व्यापक रेंज में जीनोम परिवर्तन का निर्देशन करने के अवसरों की अनुमति दी है । अंय उपलब्ध जीनोम संपादन तकनीक की तुलना में, CRISPR/Cas9 प्रणाली सस्ती, कुशल, और विश्वसनीय है । इस तकनीक जीवाणु अनुकूली प्रतिरक्षा प्रणाली के घटकों का इस्तेमाल करता है: स्ट्रेप्टोकोकस pyogenes की एक Cas9 endonuclease कि एक डबल-किनारा तोड़ (DSB), और एक chimeric गाइड आरएनए (gRNA) है, जो एक विशेष जीनोम साइट के लिए Cas9 गाइड बनाता है लक्षित DSB4. कोशिकाओं को विभिन्न रास्ते का उपयोग कर DSB की मरंमत करने के लिए मशीनरी होते हैं । गैर मुताबिक़ अंत में शामिल होने (NHEJ) छोटे सम्मिलन या हटाने के लिए जीन समारोह को बाधित करने की ओर जाता है, जबकि समरूपता-निर्देशित मरंमत (HDR) एक परिभाषित निर्देशित/वांछनीय जीनोमिक नॉक-इन/दस्तक एक exogenous HDR दाता का उपयोग करके एक टेंपलेट के रूप में परिचय । HDR-आधारित प्रतिस्थापन रणनीति कुशलतापूर्वक एक अत्यधिक विश्वसनीय ऊतक-विशिष्ट बाइनरी अभिव्यक्ति प्रणाली है, जो पारंपरिक बढ़ाने जाल तरीकों की सभी सीमाओं को दूर कर सकते हैं उत्पन्न करने के लिए उपयोग किया जा सकता है । हम CRISPR/Cas9-आधारित HDR मरंमत के उपयोग के लिए एक कदम दर कदम प्रक्रिया का वर्णन एक द्विआधारी प्रतिलेखन चालक लाइन है कि अंतर्जात transcriptional और एक transcriptional के बाद Drosophila विनियमन के नियंत्रण में व्यक्त की है पैदा करने में जीन. इस प्रोटोकॉल में, हम शाखा के लिए एक चालक लाइन (मास्टर्स) जीन एक FGF परिवार के प्रोटीन है कि सांस airway उपकला के शाखाकरण morphogenesis नियंत्रित करता है एंकोडिंग के लिए विशिष्ट की पीढ़ी का प्रदर्शन5। इस उदाहरण में, मास्टर्स जीन की पहली कोडिंग एक्सॉन अंतर्जात जीन के किसी भी मास्टर्स सीआईएस-विनियामक दृश्यों को बदलने के बिना एक जीवाणु LexA transactivator अनुक्रम के अनुक्रम द्वारा प्रतिस्थापित किया गया था । हम बताते है कि रणनीति एक मास्टर्स-LexA चालक लाइन है कि spatiotemporally एक रिपोर्टर जीन LexAoperator के बहाव (LexAop या LexO) विशेष रूप से मास्टर्स में रखा की अभिव्यक्ति नियंत्रण उत्पंन -- उपकला/mesenchymal/न्यूरॉन कोशिकाओं को व्यक्त.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. डिजाइनिंग और gRNA अभिव्यक्ति वेक्टर का निर्माण

  1. ठीक एक लंबे समय से परिभाषित एक एक्सॉन के क्षेत्र की जगह, एक दोहरे gRNA दृष्टिकोण6, जिसमें प्रत्येक gRNA विशेष रूप से ब्याज की चयनित क्षेत्र के दो सिरों को लक्षित कर सकते है का उपयोग करें । ड्राइवर का एक सटीक जीन विशिष्ट spatiotemporal अभिव्यक्ति प्राप्त करने के लिए, जीन की पहली कोडिंग एक्सॉन के भीतर दो gRNA लक्ष्य साइटों का चयन करें ।
  2. Drosophila melanogasterके लिए, flyCRISPR इष्टतम लक्ष्य खोजक उपकरण (http://tools.flycrispr.molbio.wisc.edu/targetFinder/) का उपयोग करके gRNA लक्ष्य साइट्स का चयन करें । अंय उपलब्ध CRISPR डिजाइन उपकरण के रूप में अच्छी तरह से इस्तेमाल किया जा सकता है, अनुकूलित CRISPR डिजाइन उपकरण (http://crispr.mit.edu), FlyCas9 (https://shigen.nig.ac.jp/fly/nigfly/cas9), और ई सहित कुरकुरा (www.e-crisp.org/E-CRISP) ।
    नोट: gRNA डिजाइन और क्लोनिंग के निंनलिखित प्रोटोकॉल पहले6,7वर्णित विधियों से अपनाया गया था ।
    1. ऑनलाइन उपकरण में दिए गए बॉक्स में वास्तविक अनुक्रम की प्रतिलिपि बनाएँ । सबसे हाल ही में जारी Drosophila melanogaster जीनोम एनोटेशन संस्करण का चयन करें, "r_6," ड्रॉप-डाउन मेनू में "जीनोम का चयन करें." क्षेत्र में "चुनें गाइड लंबाई (nt)," इनपुट "20." "सभी CRISPR लक्ष्य" खोजने के लिए चुनें और "CRISPR लक्ष्य खोजें" क्लिक करें ।
    2. "अधिकतम" के लिए "Stringency" और "NGG केवल" के लिए "पाम" की स्थापना करके सभी उंमीदवार gRNA लक्ष्यों का मूल्यांकन करें । किसी भी संभावित ऑफ-टार्गेट्स या ऑफ़-टार्गेट्स की ंयूनतम संख्या के बिना gRNA साइट्स का चयन करने का प्रयास करें । एक संभावित "अच्छा" गतिविधि स्कोर के साथ gRNAs का चयन करने के लिए Doench एट अल. २०१४ 8 में वर्णित वेब उपकरण का उपयोग करें ।
    3. इसके साथ-साथ, यह सुनिश्चित करें कि इंजेक्शन के लिए चयनित माता-पिता फ्लाई लाइन के जीनोम में gRNA लक्ष्यों में कोई एकल न्यूक्लियोटाइड बहुरूपता (जैसे, नग-Cas9 एक्स गुणसूत्र, बीएल # ५४५९१) । Gratz एट अल. २०१५7 में वर्णित प्रोटोकॉल का पालन करें माता पिता मक्खी लाइन से जीनोमिक डीएनए निकालने के लिए । पीसीआर बढ़ाना, लगभग, 500-1000 nt प्राइमरों का उपयोग क्षेत्रों है कि ब्याज और एक उच्च निष्ठा डीएनए पोलीमरेज़ के अनुक्रम के पार्श्व; अनुक्रम-पीसीआर प्रवर्धित उत्पादों की पुष्टि करें ।
  3. एक मिलकर gRNA अभिव्यक्ति वेक्टर पैदा करने के लिए, एक pCFD4 आरएनए अभिव्यक्ति वेक्टर में दो protospacer दृश्यों को पेश करने के लिए एक बंधाव-स्वतंत्र क्लोनिंग प्रोटोकॉल6 का पालन करें । ध्यान दें कि एक बेहतर मल्टी-gRNA अभिव्यक्ति वेक्टर (pCFD5) अब उपलब्ध है जहां दोनों sgRNAs मजबूत U6 से व्यक्त कर रहे हैं: 3 प्रमोटरों9 (https://www.crisprflydesign.org) । एक डीएनए विधानसभा विधि का उपयोग करने के लिए pCFD4 वेक्टर में gRNAs क्लोन ।
    1. डिजाइन और आरएनए अभिव्यक्ति वेक्टर pCFD4 (तालिका 1a) में दो protospacer अनुक्रम शुरू करने के लिए आगे और रिवर्स प्राइमरों का आदेश । के रूप में पहले6वर्णित है, आगे प्राइमर पहले protospacer pCFD4 में U6-1 प्रमोटर और gRNA कोर करने के लिए इसी क्षेत्रों द्वारा निहित अनुक्रम शामिल हैं; रिवर्स प्राइमर gRNA कोर और U6-pCDF4 में 3 प्रमोटर के लिए इसी क्षेत्र द्वारा पार्श्व दूसरी protospacer के रिवर्स अनुक्रम शामिल हैं ।
    2. DNase और RNase-मुक्त डबल आसुत जल (ddH2हे) के साथ १०० माइक्रोन के लिए प्राइमरों resuspend । एक 10 माइक्रोन काम एकाग्रता प्राइमर बनाओ । एक टेम्पलेट के रूप में pCFD4 प्लाज्मिड का उपयोग करें और एक उच्च निष्ठा पोलीमरेज़ का उपयोग कर पीसीआर प्रतिक्रिया की स्थापना की और पीसीआर प्रतिक्रिया के लिए सिफारिश की सेटिंग्स6.
    3. pCFD4 में प्रवर्धित उत्पाद क्लोन करने के लिए, निम्नलिखित प्रतिक्रिया की स्थापना करके BbsI एंजाइम के साथ pCFD4 प्लाज्मिड डाइजेस्ट: 2 – 5 μg के pCFD4 प्लाज्मिड, 10x पाचन बफर के 5 μL, μL एंजाइम के 1 BbsI, और ddH2हे ५० μL करने के लिए अंतिम मात्रा लाने के लिए. धीरे ट्यूब दोहन और एक संक्षिप्त स्पिन द्वारा नीचे करने के लिए ट्यूब की दीवार से सभी बिखरे हुए बूंदों का संग्रह द्वारा प्रतिक्रिया सामग्री मिलाएं । 2 एच के लिए ३७ डिग्री सेल्सियस पर प्रतिक्रिया मिश्रण की मशीन
    4. 1% agarose जेल पर कदम 3 से चरण 2 और पचा उत्पाद से पीसीआर उत्पाद चलाएँ । ट्रो पर्याप्त समय के लिए पूरी तरह से डीएनए बैंड अलग करने के लिए प्रदर्शन करते हैं । निर्माता के निर्देश के बाद जेल रेफरेंस कॉलम का उपयोग कर अपेक्षित उत्पादों को शुद्ध करने से पहले एक यूवी ट्रांस-प्रकाशक के तहत सही आकार डीएनए बैंड काटें ( सामग्री की तालिकादेखें) । पीसीआर उत्पाद ६०० bp होना चाहिए, और रैखिक pCFD4 प्लाज्मिड ~ ६.४ kb 6होना चाहिए ।
    5. एक पीसीआर ट्यूब में डीएनए असेंबली प्रतिक्रिया, निर्माता के निर्देश के अनुसार सेट ( सामग्री की तालिकादेखें) ।
    6. सक्षम जीवाणु (DH5α या ΔrecA1, ΔendA1के साथ इसी तरह के उपभेदों), एम्पीसिलीन पर प्लेट (१०० μg/एमएल) पौंड से युक्त (£/) आगर प्लेट, और ३७ डिग्री सेल्सियस पर रात भर में मशीन के साथ विधानसभा उत्पाद के 2 μL रूपांतरण । ध्यान दें कि डीएनए विधानसभा मिश्रण कुछ बैक्टीरिया उपभेदों के लिए विषाक्त हो सकता है, लेकिन कमजोर विधानसभा मिश्रण विषाक्तता को कम कर सकते हैं ।
    7. 3-4 एम्पीसिलीन-रात भर की थाली से प्रतिरोधी कालोनियों उठाओ, 3 मिलीलीटर १०० μg युक्त में कॉलोनी inoculate/एमएल एम्पीसिलीन, और एक ३७ डिग्री सेल्सियस शेखर में inoculated बैक्टीरिया बढ़ने रातोंरात । प्लाज्मिड मिनी-तैयारी निर्माता के निर्देश के बाद तैयार किट का उपयोग कर रातोंरात-संस्कृति वाले बैक्टीरिया से निकालने प्लाज्मिड ( सामग्री की तालिकादेखें) ।
    8. T3 यूनिवर्सल प्राइमर के साथ plasmids अनुक्रम सही मिलकर gRNA प्रविष्टि युक्त क्लोन के लिए स्क्रीन करने के लिए । एक अनुक्रम-सत्यापित pCFD4-gRNA में 20% ग्लिसरॉल और स्टोर में एक-८० डिग्री सेल्सियस फ्रीजर में भविष्य के उपयोग के लिए के साथ रूपांतरित बैक्टीरिया का एक ग्लिसरॉल स्टॉक स्थापित करें ।

2. डिजाइनिंग और HDR दाता का निर्माण

  1. एक Gal4 या LexA अनुक्रम के जीनोमिक दस्तक के लिए, दो समरूपता हथियार द्वारा पार्श्व transactivator अनुक्रम युक्त एक डबल-असहाय HDR दाता डिजाइन ।
    1. का प्रयोग करें > 1.5 kb बाएँ और दाएँ समरूपता gRNA लक्ष्यीकरण साइट (ओं) पार्श्व भुजाओं. विस्तारित समरूपता हथियारों की मरंमत की प्रक्रिया के दौरान HDR की दक्षता में वृद्धि 10
    2. पीसीआर जीनोमिक डीएनए (gDNA) से माता पिता मक्खी इंजेक्शन के लिए चयनित लाइन से निकाले समरूपता हथियार बढ़ाना (जैसे, नग-Cas9 (एक्स गुणसूत्र पर), बीएल # ५४५९१) । लंबी पीसीआर एक्सटेंशन के लिए उपयुक्त एक सबूत पढ़ने गर्म शुरू Taq-डीएनए पोलीमरेज़ एंजाइम का प्रयोग करें ( सामग्री की तालिकादेखें) । अनुक्रम-सत्यापित करें ।
  2. इंजीनियर लोकस के लिए gRNA के पुनर्लक्षित से बचने के लिए, इस तरह है कि gRNA मांयता साइटों exogenous अनुक्रम शुरू द्वारा बाधित कर रहे है में प्रतिस्थापन दाता डिजाइन ।
    नोट: ख्यात सीआईएस विनियामक तत्वों को बदलने से बचने के लिए, हमेशा कोडिंग एक्सॉन क्षेत्र के भीतर gRNA मान्यता साइटों का चयन करें ।
  3. एक प्रतिस्थापन कैसेट पैदा करने के लिए, डीएनए विधानसभा रणनीति योजना के चार खंडों में शामिल होने के साथ: 5 ' और 3 ' समरूपता हथियार, मध्य exogenous transactivator डीएनए अनुक्रम, और रैखिक क्लोनिंग वेक्टर रीढ़ (जैसे, pUC19 या अंय आमतौर पर इस्तेमाल किया क्लोनिंग वैक्टर) । डीएनए विधानसभा के लिए निर्माता के दिशानिर्देश के बाद (सामग्री की तालिका देखें), पीसीआर प्रवर्धन और प्रत्येक खंड के विधानसभा के लिए उपयुक्त प्राइमरों डिजाइन । ddH2के साथ १०० माइक्रोन के लिए प्राइमरों resuspend O. एक 10 माइक्रोन काम एकाग्रता प्राइमर बनाओ । सभी पीसीआर प्रतिक्रियाओं के लिए उच्च निष्ठा पोलीमरेज़ का प्रयोग करें । निंन प्रोटोकॉल का पालन करें:
    1. पीसीआर एक उपलब्ध सदिश से एक Gal4 या LexA अभिव्यक्ति कैसेट बढ़ाना (जैसे, एनएलएस-LexA: p65; आदर्श Gal4/LexA/QF2 अभिव्यक्ति plasmids पाया जा सकता है और Addgene जैसे आम संसाधनों से प्राप्त कर सकते हैं) का उपयोग तालिका 1bमें सूचीबद्ध प्राइमरों ।
      1. transactivator डीएनए अनुक्रम की अभिव्यक्ति पर प्रतिस्थापित एक्सॉन के सभी मूल transcriptional और पोस्ट-transcriptional विनियमों को बनाए रखने के लिए, इस तरह से कैसेट डिज़ाइन करें कि संपादित जीनोमिक एलील का एक chimeric mRNA व्यक्त करे transactivator और जीन । किसी भी ब्याह संकेत को बनाए रखने के लिए लक्षित एक्सॉन के 5 ' और 3 ' अंत को बनाए रखने.
      2. एक chimeric प्रोटीन में अनुवाद को रोकने के लिए अवशिष्ट 5 ' कोडिंग एक्सॉन और transactivator अनुक्रम के बीच एक T2A सेल्फ-सट पेप्टाइड अनुक्रम को शामिल करें । exogenous transactivator अनुक्रम (चित्रा 5) के बाद एक अनुवाद रोकें codon जोड़ें ।
    2. पीसीआर जीनोमिक डीएनए (gDNA) से माता पिता मक्खी इंजेक्शन के लिए चयनित लाइन से निकाले समरूपता हथियार बढ़ाना (जैसे, नग-Cas9 (एक्स गुणसूत्र पर), बीएल # ५४५९१) तालिका 1bमें सूचीबद्ध प्राइमरों का उपयोग कर । इस प्रकार के रूप में सिस्टम का उपयोग सभी पीसीआर प्रतिक्रियाओं के लिए उच्च निष्ठा पोलीमरेज़ का प्रयोग करें: 5x रिएक्शन बफर के 5 μL, ०.५ μL की 10 एमएम dNTPs, १.२५ की μL 10 माइक्रोन फॉरवर्ड प्राइमरी, १.२५ μL की 10 माइक्रोन रिवर्स प्राइमरी, ०.५ μL के खाके डीएनए की, ०.२५ μL की हाई-निष्ठा डीएनए की पोलीमरेज़ , १६.२५ μL के ddH2हे.
    3. रैखिक क्लोनिंग वेक्टर जैसे pUC19 का उपयोग करें । दाता वैक्टर की एक संख्या अब उपलब्ध हैं । निम्न वेबसाइट पर एक व्यापक सूची देखें-http://flycrispr.molbio.wisc.edu.
    4. 1% agarose जेल पर पीसीआर प्रॉडक्ट्स चलाएं । पर्याप्त समय के लिए अवांछित गैर विशिष्ट बैंड से वांछित बैंड की एक स्पष्ट जुदाई सुनिश्चित करने के लिए ट्रो प्रदर्शन (यदि कोई हो) । जेल-उंमीद डीएनए टुकड़े शुद्ध । एक spectrophotometer का उपयोग कर एक शुद्ध डीएनए टुकड़ा की एकाग्रता को मापने ।
    5. निर्माता के निर्देश के बाद डीएनए असेंबली प्रतिक्रिया सेट करें । निम्नलिखित प्रतिक्रिया में चरण 3 और चरण 4 से रैखिक क्लोनिंग वेक्टर और लक्ष्य टुकड़े मिश्रण: 1 μL के रैखिक क्लोनिंग वेक्टर (५० एनजी/μL), 2 – 3 प्रत्येक लक्ष्य टुकड़ा के गुना अधिक, 2x डीएनए असेंबली मास्टर मिक्स के 10 μL, ddH के साथ 20 μL के लिए अंतिम प्रतिक्रिया मात्रा लाने के लिए < c21 > 2हे. ५० डिग्री सेल्सियस पर 1 घंटे के लिए रिएक्शन मिक्स की मशीन ।
    6. सक्षम बैक्टीरिया, पौंड/Amp पर प्लेट में विधानसभा उत्पाद के 2 μL रूपांतरण १०० μg/एमएल एम्पीसिलीन युक्त प्लेटें । इसके अलावा, नीले/सफेद स्क्रीनिंग के लिए प्लेट पर एक्स-लड़की + IPTG जोड़ें ।
    7. 3-4 रात भर मशीन से सफेद कालोनियों उठाओ, 3 मिलीलीटर १०० μg/एमएल एम्पीसिलीन युक्त पौंड में कॉलोनी inoculate, और ३७ डिग्री सेल्सियस पर एक शेखर में रातोंरात बढ़ती है । रातोंरात-संस्कृति वाले प्लाज्मिड मिनी निर्माता मैनुअल के बाद तैयारी किट का उपयोग कर बैक्टीरिया से निकालने प्लाज्मिड ( सामग्री की तालिकादेखें) ।
    8. पीसीआर या प्रतिबंध पाचन द्वारा सकारात्मक कॉलोनी स्क्रीन ।
    9. अनुक्रम अंतिम प्लाज्मिड के HDR दाता क्षेत्र सत्यापित करें । भविष्य टीका के लिए-८० डिग्री सेल्सियस पर 20% ग्लिसरॉल में सही क्लोन के साथ तब्दील एक जीवाणु शेयर बचाओ ।

3. भ्रूण इंजेक्शन, मक्खी आनुवंशिकी और जीनोम संपादन के लिए स्क्रीनिंग

  1. तैयार उच्च शुद्धता endotoxin-मुक्त gRNA अभिव्यक्ति वेक्टर के रूप में के रूप में अच्छी तरह से HDR दाता प्लाज्मिड एक प्लाज्मिड maxiprep किट का उपयोग ( सामग्री की तालिकादेखें) ।
  2. सह इंजेक्षन gRNA अभिव्यक्ति प्लाज्मिड (१०० एनजी/μL) और प्रतिस्थापन दाता (५०० एनजी/μL) के germline में नग-Cas9 भ्रूण6। नोट: हम इंजेक्शन के लिए एक वाणिज्यिक सेवा का उपयोग करें, लेकिन इस प्रक्रिया के रूप में अच्छी तरह से प्रयोगशाला में किया जा सकता है ।
  3. मक्खी आनुवंशिकी और स्क्रीनिंग (चित्रा 2 और चित्रा 3):
    1. जब इंजेक्शन भ्रूण वयस्कों में विकसित, प्रत्येक एक जी0 मक्खियों को बालन मक्खियों को पार । का चयन करें उपयुक्त बैलेंसर गुणसूत्र के लिए लक्षित एलील युक्त ।
    2. एक सह2 पैड पर एक G0 पार से F1 वंश Anesthetize और बेतरतीब ढंग से एक stereomicroscope के तहत 10-20 पुरुषों उठाओ । उंहें व्यक्तिगत रूप से क्रॉस बैलेंसर महिलाओं के रूप में चित्रा 3में दिखाया गया है ।
    3. जब F2 लार्वा हैच, प्रत्येक पार से एकल F1 पिता उठाओ और एक मक्खी जीनोमिक डीएनए तैयारी प्रोटोकॉल का उपयोग कर gDNA निकालने:
      1. gDNA निष्कर्षण बफर तैयार: 10 मिमी Tris-सीएल पीएच ८.२, 1 मिमी EDTA, 25 मिमी NaCl, कमरे के तापमान पर स्टोर । तैयार 20 मिलीग्राम/एमएल Proteinase कश्मीर स्टॉक समाधान और फ्रीजर में स्टोर ।
      2. एक १.५ मिलीलीटर माइक्रो-केंद्रापसारक ट्यूब और लेबल ट्यूब में प्रत्येक मक्खी रखो । -८० ° c फ्रीजर रात भर में रखें ।
      3. २०० µ g/mL Proteinase K के अंतिम एकाग्रता युक्त gDNA निष्कर्षण बफर की एक ताजा कार्य मात्रा तैयार करें ।
        नोट: इस चरण के लिए एक पुराने बफ़र का उपयोग न करें ।
      4. Squish प्रत्येक मक्खी के लिए 10-15 एस के साथ एक पिपेट टिप तरल वितरण के बिना squishing बफर के ५० μL युक्त । ट्यूब में शेष बफर वितरण और अच्छी तरह से मिश्रण । 20-30 मिनट के लिए ३७ ° c पर मशीन ।
      5. Proteinase K निष्क्रिय करने के लिए 1 – 2 मिनट के लिए ९५ ° c हीट ब्लॉक में ट्यूबों रखो.
      6. १०,००० एक्स जीमें 5 मिनट के लिए नीचे स्पिन आगे पीसीआर विश्लेषण के लिए 4 डिग्री सेल्सियस पर तैयारी की दुकान ।
  4. एक नग-Cas9 फ्लाई से gDNA तैयार करने के लिए उसी विधि का प्रयोग करें, जो नकारात्मक नियंत्रण के रूप में कार्य करता है. तीन कदम पीसीआर आधारित स्क्रीन सही पहचान "बाहर समाप्त होता है" HDR (चित्रा 2, चित्रा 5) एक5टेंपलेट के रूप में प्रत्येक F1 पुरुष के gDNA का उपयोग कर । निंनलिखित पीसीआर रिएक्शन सिस्टम में डीएनए प्रस्तुत करने के 1 μL का प्रयोग करें: 10 μL के साथ 2x पीसीआर मास्टर मिश्रण, प्रत्येक प्राइमरी के 1 μL (10 माइक्रोन), डीएनए टेम्पलेट के 1 μL, और 7 μL के ddH2हे.
  5. के रूप में चित्रा 5में दिखाया गया है, fwd1 और rev1 सम्मिलन या प्रतिस्थापन के अस्तित्व के लिए स्क्रीन करने के लिए प्राइमरों का उपयोग कर पीसीआर प्रदर्शन; fwd2 और rev2 प्राइमरों का उपयोग कर पीसीआर 3 ' क्षेत्र से सम्मिलन या प्रतिस्थापन सत्यापित करने के लिए प्रदर्शन; "समाप्त होता है" HDR (तालिका 1C) की जांच करने के लिए प्राइमरों M13F और rev3 का उपयोग कर पीसीआर प्रदर्शन ।
  6. की पुष्टि समाप्त होता है बाहर HDR के साथ उड़ान लाइनों रखें और F2 पीढ़ी से संतुलित शेयरों की स्थापना । बालन को पार करने के लिए अन्य गुणसूत्रों पर किसी भी अवांछित उत्परिवर्तनों को दूर करने के लिए फिर से मक्खियों ।
  7. उच्च-निष्ठा Taq पोलीमरेज़ के साथ amplicon लंबी पीसीआर (> 800-1000 nt) बढ़ाना के लिए स्थापित शेयरों से उच्च गुणवत्ता gDNA तैयार है और पूरी तरह से अनुक्रम इंजीनियर amplicons क्षेत्रों से प्राप्त जीनोमिक सत्यापित करें । वैकल्पिक रूप से, पहले वर्णित के रूप में कच्चे gDNA निकालने का उपयोग करें छोटा (< 800 nt), परिक्रमा के लिए अतिव्यापी पीसीआर उत्पादों-संपादित जीनोम सत्यापित । अच्छी गुणवत्ता Drosophila जीनोमिक डीएनए तैयार करने के लिए निम्न प्रोटोकॉल का उपयोग करें:
    1. एक १.५ मिलीलीटर microcentrifuge ट्यूब में के बारे में 25 वयस्क मक्खियों रखो, और फ्रीज में-20 डिग्री सेल्सियस या-८० डिग्री सेल्सियस फ्रीजर के लिए 1 घंटे से कम ।
    2. Add २५० μL सॉल्यूशन A (pH ९.० Tris HCl ०.१ m, EDTA ०.१ m, एसडीएस 1%).
    3. microcentrifuge ट्यूबों में अनुमन्य मूसल का प्रयोग कर मक्खियों को Homogenize, और ट्यूब को बर्फ पर लगा दें ।
    4. 30 मिनट के लिए ७० ° c पर मशीन ।
    5. KOAc (5 मीटर) के ३५ μL जोड़ें, शेक, और अच्छी तरह से मिश्रण है, लेकिन भंवर नहीं है ।
    6. 30 मिनट के लिए बर्फ पर मशीन ।
    7. 15 मिनट के लिए १२,००० x g पर स्पिन ।
    8. एक 1 मिलीलीटर micropipette के साथ, ध्यान से एक नई ट्यूब के लिए केवल स्पष्ट supernatant हस्तांतरण, वापस किसी भी हाला या चरण छोड़ने ।
    9. isopropanol के १५० μL को supernatant में जोड़ें । धीरे उलटा द्वारा मिश्रण ।
    10. 5 मिनट के लिए १०,००० x g पर स्पिन ।
    11. ध्यान से supernatant निकालें और गोली ट्यूब में छोड़ दें ।
    12. 1 मिलीलीटर ७०% ेतोः के साथ गोली धो लो ।
    13. 5 मिनट के लिए १२,००० x g पर स्पिन ।
    14. supernatant निकालें । हवा 15 से 20 मिनट के लिए गोली सूखी । पर गोली सूखी नहीं है ।
    15. ddH2ओ के १०० μL में गोली भंग ।
    16. पूरा संपादित क्षेत्र बढ़ाना करने के लिए लंबी amplicon (> 800 बीपी) के लिए उपयुक्त उच्च निष्ठा डीएनए पोलीमरेज़ का प्रयोग करें । आदर्श रूप में, डाला कैसेट के बाहर दो प्राइमरी ले जीनोमिक क्षेत्र बढ़ाना । जेल पीसीआर उत्पाद को शुद्ध, और जैसा कि पहले वर्णित, अनुक्रम एकाधिक अतिव्यापी प्राइमरों के साथ उत्पाद सत्यापित करें ।
  8. प्रमाणित सही spatiotemporal अभिव्यक्ति पैटर्न से विदारक ऊतकों/इंजीनियर फ्लाई लाइनों के भ्रूण:
    1. हाइब्रिड mRNA उत्पाद (तालिका 1 d) की अभिव्यक्ति को सत्यापित करने के लिए कुल आरएनए से RT-पीसीआर निष्पादित करें.
    2. अभिव्यक्ति को मान्य करने के लिए लार्वा ऊतकों/भ्रूण में रुचि के mRNA उत्पाद का एक सीटू संकरण में प्रदर्शन करें ।
    3. अनुक्रम-सत्यापित सिरों-आउट रेखाओं के बीच सटीक ऊतक-विशिष्ट spatiotemporal अभिव्यक्ति प्रतिमान के लिए स्क्रीन करने के लिए, प्रत्येक संपादित पंक्तियों के साथ बाइनरी व्यंजक ड्राइवर के लिए प्राप्त LexO-GFP या LexO-आरएफपी (के लिए LexA चालक) लाइन (ब्लूमिंगटन स्टॉक केंद्रों से उपलब्ध है) और LexA या Gal4 संचालित रिपोर्टर-भ्रूण, लार्वा में जीन अभिव्यक्ति का पालन करें, और एक प्रतिदीप्ति माइक्रोस्कोप के तहत वयस्क ऊतकों ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

इस प्रोटोकॉल सफलतापूर्वक मास्टर्स एक्सप्रेस5कोशिकाओं के लिए एक लक्षित बाइनरी अभिव्यक्ति रिपोर्टर सिस्टम जनरेट करने के लिए उपयोग किया गया था । जटिल spatiotemporal मास्टर्स अभिव्यक्ति को नियंत्रित करने वाले सीआईएसविनियामक तत्व (CREs) की विशेषता नहीं है । इसलिए, अंतर्जात मास्टर्स विनियामक अनुक्रम के नियंत्रण के अंतर्गत spatiotemporal अभिव्यक्ति प्राप्त करने के लिए, केवल मास्टर्स की पहली कोडिंग एक्सॉन को बैक्टीरियल LexA transactivator के अनुक्रम के साथ प्रतिस्थापित करने के लिए डिज़ाइन किया गया था । एक बेहतर एनएलएस-LexA: Drosophila में इष्टतम अभिव्यक्ति प्रदान करने के लिए जाना जाता:p ६५ कैसेट का चयन किया गया ।

प्रतिस्थापन रणनीति एक chimeric एनएलएस-LexA: p65- मास्टर्स mRNA के तहत अंतर्जात transcriptional और पोस्ट-transcriptional नियंत्रण उत्पंन करने के उद्देश्य से । इस chimeric mRNA एक बरकरार मास्टर्स 5 ' UTR, 5 ' अंत और संपादित मास्टर्स कोडिंग एक्सॉन (पहली एक्सॉन) के 3 अंत का हिस्सा है, और पूरा बहाव मास्टर्स introns और exons निहित । प्रतिस्थापित एक्सॉन के मास्टर्स आरएनए-विशिष्ट ब्याह को संरक्षित करने के लिए, प्रतिस्थापित कोडिंग एक्सॉन के छोटे 5 ' और 3 सिरों ' को बनाए रखा गया. हालांकि, एक chimeric मास्टर्स प्रोटीन से जुड़े एनएलएस-LexA:p ६५ के संश्लेषण को रोकने के लिए, एक T2A स्व-सट पेप्टाइड अनुक्रम अवशिष्ट 5 ' मास्टर्स कोडन क्षेत्र और ATG के एनएलएस -LexA: p65के बीच शामिल किया गया था । इसके अलावा, एक अनुवाद रोक codon के बाद जोड़ा गया एनएलएस-LexA: p65 अनुक्रम एक छोटा मास्टर्स प्रोटीन5 (चित्रा 4 और चित्रा5) के सह अनुवाद से बचने के लिए ।

इन सभी सुविधाओं वाले प्रतिस्थापन दाता का उपयोग किया गया था, जिसमें T2A-एनएलएस-LexA: p65 अनुक्रम और 2 kb 5 '-और १.८ kb 3 '-समरूपता आर्म्स थे । लंबे समरूपता हथियार कुशल HDR और मरंमत की साइट पर एक बड़े डीएनए टुकड़ा के सम्मिलन के लिए इस्तेमाल किया गया (T2A-एनएलएस-LexA: p65 १.८ kb है) (चित्र 5 ए) ।

दो gRNAs को परिभाषित पदों पर DSBs बनाने के लिए मास्टर्सकी पहली कोडिंग एक्सॉन के अधिकांश को नष्ट किया गया । दो gRNAs कि सभी १.३ खंड में वर्णित मानदंडों का मिलान (पाम अनुक्रम रेखांकित) थे:
gRNA1: TGTATCTGCGATGCCCCTCATGG
gRNA2: ATCCTTCAGATATTGCGGGATGG

दोनों gRNA मांयता साइटों प्रतिस्थापन दाता में exogenous T2A-एनएलएस-LexA: p65 अनुक्रम है, जो सबसे आसान करने के लिए इंजीनियर gRNAs के लिए लोकस के पुनर्लक्षित से बचने का तरीका है द्वारा बाधित किया गया । प्रतिस्थापन दाता में बाधित gRNA मान्यता अनुक्रम (इटैलिक्स में gRNA मान्यता साइटों को बाधित exogenous अनुक्रम) थे:
gRNA1: TGTATCTGCG-GGCTCCGGCGAAGGAC...
gRNA2:... AAAAACTCGTTTAGA-CGGGATGG

pCFD4 gRNA अभिव्यक्ति वेक्टर इन gRNAs युक्त, प्रतिस्थापन दाता के साथ साथ, सह था germline में इंजेक्शन -Cas9 भ्रूण । बाद में, प्रोटोकॉल यहां वर्णित प्रतिस्थापन (चित्रा 5B, सी) के लिए स्क्रीन करने के लिए पीछा किया गया था । इंजेक्शन G0 पशुओं के बारे में ६७% उपजाऊ थे । और ५६% उपजाऊ G0s के संस्थापक थे, जिन्होंने HDR-पॉजिटिव संततियों को जन्म दिया । F1 संतति जांच के अलावा, के बारे में 23% सफल HDR के लिए सकारात्मक थे, और सकारात्मक hdr के ७३% थे "समाप्त होता है बाहर" (तालिका 2) । मास्टर्स की पहली कोडिंग एक्सॉन के बाद से "बाहर खटखटाया" था, सभी HDR लाइनों को homozygous घातक हो पाया गया, और शेयरों में कसरती पर बनाए रखा गया ।

कोशिकाओं में एक chimeric LexA-मास्टर्स mRNA की पीढ़ी को आरटी-पीसीआर विश्लेषण (चित्रा 5d) द्वारा मान्य किया गया था । प्राप्त मास्टर्स-LexA पंक्तियाँ अंतर्जात मास्टर्स अभिव्यक्ति प्रतिमान में व्यक्त किए गए थे, तो सत्यापित करने के लिए, प्रत्येक "समाप्त-आउट" HDR लाइन LexO-mCherryCAAX ट्रांसजेनिक मक्खी5, और रिपोर्टर व्यंजक प्रतिमान के लिए क्रॉस किया गया था में संतति भ्रूण और लार्वा की जांच की गई । ४२ से बाहर ४६ लाइनों सटीक spatiotemporal अभिव्यक्ति पहले रिपोर्ट मास्टर्स पैटर्न5 (चित्रा 6) के अनुरूप दिखाया । चार लाइनों या तो कमजोर या गैर विशिष्ट अभिव्यक्ति पैटर्न दिखाया । हम भविष्यवाणी है कि इन पंक्तियों उत्परिवर्तनों, जो हम पूरी तरह से अनुक्रमण विश्लेषण के साथ सत्यापित करने की आवश्यकता जमा हो सकती है । एक साथ इन परिणामों की पुष्टि की है कि HDR-मध्यस्थता एक्सॉन प्रतिस्थापन रणनीति सफलतापूर्वक एक जीन के लिए एक लक्षित द्विआधारी अभिव्यक्ति प्रणाली उत्पंन करने के लिए नियोजित किया जा सकता है । उपकरण सफलतापूर्वक मास्टर्स जीन के spatiotemporal पैटर्न में एक्सप्रेस रिपोर्टर या अस्थानिक जीन के लिए इस्तेमाल किया जा सकता है ।

Figure 1
चित्रा 1: लक्षित जीन अभिव्यक्ति के लिए एक द्विआधारी प्रतिलेखन प्रणाली की योजना है । एक transactivator (GAL4 या LexA), सीआईएसके नियंत्रण में व्यक्त-विनियामक तत्वों (CREs) एक जीन के, एक प्रभाव ड्राइव विशिष्ट प्रतिलेखन बंधन साइटों के बहाव transgene (यूएएस के लिए GAL4 या LexAop आयुष्य LexA). कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: एक द्विआधारी प्रतिलेखन प्रणाली उत्पंन करने के लिए CRISPR/Cas9-मध्यस्थता जीनोम संपादन के लिए कार्यप्रवाह का एक सिंहावलोकन । अनुमानित समय प्रत्येक चरण के लिए आवश्यक अवधि इंगित की गई है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3: जीनोम-संपादित फ्लाई लाइनों की स्थापना के लिए CRISPR स्क्रीनिंग और आनुवंशिक क्रॉस योजना का एक उदाहरण । आनुवंशिक पार में, आर संपादित एलील कि 3rd गुणसूत्र पर है के लिए खड़ा है । MKRS (टी. पी. (3; 3) श्रीमती, एम (3) 76A [1] kar [1] ry [2] Sb [1]), एक 3rd गुणसूत्र मार्कर है; TM6B ((3LR) TM6B, Antp [Hu] e [1] Tb [1]) एक 3rd गुणसूत्र बैलेंसर है । जीनोम संपादित फ्लाई स्टॉक्स जीनोमिक डीएनए से या तो F2 या F3 पीढ़ी मक्खियों और पीसीआर उत्पादों का निर्धारण अनुक्रम से निकाले गए ब्याज के लक्ष्य क्षेत्रों बढ़ाना पीसीआर द्वारा सत्यापित कर रहे हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: डीएनए विधानसभा द्वारा प्रतिस्थापन कैसेट की पीढ़ी । एक योजनाबद्ध पीसीआर प्रवर्धन और विभिंन पीसीआर उत्पादों की विधानसभा चित्रण ड्राइंग (ए, बी, और सी) दाता सदिश में (d) एक डीएनए विधानसभा पद्धति का उपयोग कर । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्रा 5: मास्टर्स की जनरेशन -LexA द्वारा CRISPR/Cas9-मध्यस्थ एक्सॉन प्रतिस्थापन । (A) मास्टर्स लोकस में एक्सॉन प्रतिस्थापन के लिए CRISPR/Cas9 मध्यस्थता HDR की रणनीति का चित्रण योजनाबद्ध आरेखण. बाक्स-एक्सॉन; रेखा-intron; प्रतिस्थापन दाता (pDonor-मास्टर्स: LexA) और HDR के दो संभावित परिणाम दिखाए गए थे । pDonor-मास्टर्स: LexA निंनलिखित विशेषताएं थी: (1)T2A-एनएलएस-LexA: p65 (~ 1.8 केबी) अनुक्रम 2 kb और १.८ kb लंबे समरूपता हथियार (डैश्ड लाइनें), (2) अवशिष्ट एन टर्मिनल T2A मास्टर्स और के बीच एक एक्सॉन स्व-सट पेप्टाइड द्वारा पार्श्व । एनएलएस-LexA: p65, और (3) एक अनुवाद रोक codon (red *) के बाद एनएलएस-LexA: p65 अनुक्रम । HDR उत्पाद मास्टर्सके सभी transcriptional और पोस्ट-transcriptional नियंत्रण बनाए रखा,और LexA:p ६५ प्रोटीन अंतर्जात मास्टर्स के रूप में एक ही पैटर्न में उत्पादित होने की उंमीद है । छोटे काले तीर संबंधित बाइंडिंग साइट्स दिखाएं (में नहीं स्केल) पीसीआर प्राइमरों (तालिका 1) 3 के लिए इस्तेमाल किया कदम स्क्रीनिंग या आर टी-पीसीआर सत्यापन । (ख) Agarose जेल 3-कदम पीसीआर स्क्रीनिंग के परिणाम दिखा तस्वीरें । पीसीआर उत्पादों चार सफल समाप्त होता है बाहर HDR लाइनों के जीनोमिक डीएनए से परिवर्धित दिखाया जाता है; नकारात्मक नियंत्रण, नग-Cas9 माता-पिता की रेखा के जीनोमिक डीएनए; सकारात्मक नियंत्रण, pDonor-मास्टर्स: LexA प्लाज्मिड; मी, मार्कर (SL2K DNA सीढ़ी). (ग) समाप्त होने वाली लाइनों के लिए प्राइमरी M13F और rev3 का उपयोग अपेक्षित पीसीआर उत्पाद दिखा स्क्रीनिंग जेल का एक उदाहरण; M8-7 और M9-6 लाइनों में दो सिरों हैं; नकारात्मक और सकारात्मक नियंत्रण, बी के रूप में एक ही; एम, मार्कर (नेब 1 केबी डीएनए सीढ़ी) । (घ) मास्टर्स से कुल आरएनए पर आरटी-पीसीआर विश्लेषण -LexA और नग-Cas9 नियंत्रण मक्खियों. फॉरवर्ड प्राइमर एक LexA विशिष्ट क्षेत्र के लिए बांध, रिवर्स प्राइमर एक बहाव मास्टर्स एक्सॉन क्षेत्र को बांध; ~ ४४० बीपी (बेस जोड़ी) प्रवर्धन बैंड (*) मास्टर्स-LexA mRNA पर आरटी-पीसीआर से पता चला था, लेकिन नियंत्रण आरएनए से नहीं । एम, १०० बीपी मार्कर (नेब) । 2 और ड्यूल एट अलमें एस 1 आंकड़े से अनुकूलित । २०१७5. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 6
चित्रा 6: विभिन्न ऊतकों में ऊतक-विशिष्ट और सशर्त मास्टर्स-LexA अभिव्यक्ति का सत्यापन. (A-D) मास्टर्स अभिव्यक्ति (लाल) विभिन्न लार्वा ऊतकों में, btl व्यक्त कोशिकाओं के साथ हरे रंग में दिखाया गया है । (a, a ') विंग डिस्क मास्टर्स स्रोत आगे बढ़ते एयर सैक primordium (एएसपी) के । (ख, ग) TR5 अनुप्रस्थ संयोजी (टीसी) (बी) और TR2 पृष्ठीय शाखा (डीबी) (सी) में मास्टर्स अभिव्यक्ति. () जननांग डिस्क में मास्टर्स अभिव्यक्ति. (ई-जे) गतिशील मास्टर्स अभिव्यक्ति (लाल) भ्रूण सांस शाखा के दौरान (हरा) पैटर्न; छोटे तीर, पांच मास्टर्स 10 स्टेज पर सांस placode आसपास के स्रोतों । पादी: क-J; btl-Gal4, यूएएस- CD8GFP/+; मास्टर्स-LexA, LexO- CherryCAAX/+. (K-L ") हाइपोक्सिया-प्रेरित मास्टर्स- विंग डिस्क में LexA अभिव्यक्ति प्रोफ़ाइल और एसोसिएटेड TR2 सांस metamere (टीसी, DB, पृष्ठीय ट्रंक-डीटी) । जीनोटाइप: मास्टर्स-LexA, LexO-CherryCAAX/ (K) CoCl2के बिना पूर्व vivo cultureed अंगों से नियंत्रण डिस्क. (l-l ") विंग डिस्क्स (l, l ') और श्वासनली (DT, (l ' ')) से CoCl2 प्रेरित हाइपोक्सिया के साथ कल्चरल पूर्व vivo अंगों. स्टार, अस्थानिक अभिव्यक्ति हाइपोक्सिया द्वारा प्रेरित । स्केल बार्स = 30 µm; ५० µm (K-L ") । ड्यू एट अलमें चित्रा 3 से अनुकूलित । २०१७5. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

A. gRNA क्लोनिंग और अनुक्रमण
मास्टर्स-lexA gRNA fwd TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
मास्टर्स-lexA gRNA rev ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
cGACGTTAAATTGAAAATAGGTC पर
T3 प्राइमर sequencing के लिए इस्तेमाल किया CAATTA ACCCTCACTAAAGG-3 '
नोट: न्यूक्लियोटाइड pCFD4 वेक्टर पर U6 प्रवर्तक या gRNA कोर को रेखांकित करने के लिए, लोअरकेस g/c को सहायता U6 प्रवर्तक-निर्भर प्रतिलेखन जोड़ा गया था
B. HDR दाता निर्माण
मास्टर्स एन-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
मास्टर्स-lexA-एन-आर tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
सी
lexA-च CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
lexA-R CTAAACGAGTTTTTAAGCAAACTCACTC
मास्टर्स lexA-सी Fwd TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
मास्टर्स सी-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
नोट: न्यूक्लियोटाइड में राजधानी ओवरलैप pUC19 वेक्टर के लिए गिब्सन विधानसभा के लिए, न्यूक्लियोटाइड रेखांकित T2A पेप्टाइड इसके अलावा के लिए अनुक्रम बदस्तूर थे ।
C. HDR स्क्रीनिंग और अनुक्रमण
मास्टर्स-lexA fwd1 GTGGCGCACGCCCAATAAAC
मास्टर्स-lexA rev1 GATCCCAGCCAATCTCCGTTG
मास्टर्स-lexA fwd2 CAACGGAGATTGGCTGGGATC
मास्टर्स-lexA rev2 CTGGCCAACTGTAGGGAAGTC
समाप्त होता है-में जांच rev3 GCAATGTTATGCAATGCGTTGAC
मास्टर्स-lexA seq fwd3 CACTTGTCGCCCATATTGATACAATTG
नोट: इन प्राइमरों पीसीआर स्क्रीनिंग और अनुक्रमण के लिए इस्तेमाल किया गया, प्राइमर बाध्यकारी साइटों की अनुमानित स्थानों fwd1-2 और rev1-3 के रूप में चित्रा 5 में दिखाया गया है ।
D. भ-पीसीआर विश्लेषण
भ-च GATATGGATTTCTCCGCTTTGCTG
आरटी-आर CCATGCAGAGATACAGGCAAGTG

तालिका 1: इस अध्ययन में प्रयुक्त प्राइमर । (एक) gRNA अभिव्यक्ति वेक्टर और अनुक्रमण क्लोनिंग के लिए प्राइमरों । () HDR दाता टेंपलेट क्लोनिंग के लिए प्राइमर । () HDR उत्पादों के स्क्रीनिंग और अनुक्रमण के लिए प्राइमरों । () chimeric LexA-मास्टर्स mRNA उत्पाद के आरटी-पीसीआर सत्यापन के लिए इस्तेमाल किया प्राइमरों ।

जीनोटाइप hdr संचरण दर% (# hdr-पावरफुल G0/# उपजाऊ G0) # HDR-सकारात्मक f1/# कुल f1 की जांच की (%) # "समाप्त होता है" hdr/# कुल hdr (%)
मास्टर्स-LexA ५६ (15/27) 23 (60/259) ७३ (46/60)

तालिका 2: CRISPR/Cas9-मध्यस्थता HDR की दक्षता । hdr संचरण दर के रूप में की गणना की है # hdr-पावरफुल G0/# कुल उपजाऊ G0 की. सफल hdr% hdr के # के रूप में गणना की है-सकारात्मक f1/ "समाप्त होता है"% के रूप में की गणना की है # "समाप्त होता है बाहर" hdr/# कुल सकारात्मक hdr का ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

परंपरागत रूप से, Drosophila बढ़ाने जाल दो अलग तरीकों से उत्पंन किया गया । तरीकों में से एक स्थानांतरण (जैसे, पी तत्व स्थानांतरण)1 द्वारा जीनोम में एक ड्राइवर (eg., Gal4) अनुक्रम के यादृच्छिक प्रविष्टि भी शामिल है । वैकल्पिक रूप से, चालक दृश्यों एक प्लाज्मिड निर्माण में एक ख्यात बढ़ाने/प्रवर्तक क्षेत्र के transcriptional नियंत्रण के तहत रखा जा सकता है, जो3जीनोम,11के एक अस्थानिक साइट में एकीकृत किया जाएगा । हालांकि इन तरीकों Drosophilaके लिए Gal4 या LexA बढ़ाने के जाल का एक बड़ा पूल उत्पंन किया है, वे कई सीमाएं हैं । P तत्व-मध्यस्थता वाले यादृच्छिक सम्मिलन जीनोम में महत्वपूर्ण सीआईएसविनियामक अनुक्रम की नियामक गतिविधि को बाधित कर सकते हैं । जीनोम में यादृच्छिक स्थानांतरण के कारण, transactivator अभिव्यक्ति कई पड़ोसी जीन के पैटर्न की रिपोर्ट कर सकते हैं । दूसरी ओर, सीआईएस के एक पूर्व ज्ञान-एक जीन की नियामक अनुक्रम एक बढ़ाने के लिए आवश्यक है-जाल प्लाज्मिड का निर्माण । वहां भी एक अनुक्रम है कि क्लोन किया जा सकता है और एक प्लाज्मिड निर्माण में परीक्षण की लंबाई की सीमा है । अलग और अंतर्जात जीनोमिक संदर्भ से बाहर डीएनए की केवल एक आंशिक टुकड़ा क्लोनिंग एक पूरी जीन विशिष्ट अभिव्यक्ति पैटर्न पुन: पेश नहीं हो सकता है । उदाहरण के लिए, मास्टर्स-Gal4 (NP2211) लाइन, जो पी द्वारा उत्पंन किया गया था एक बढ़ाने जाल Gal4 तत्व के तत्व सम्मिलन मास्टर्स जीन के आगे बस, पूरी तरह से नहीं करता है जीन विशिष्ट अभिव्यक्ति पैटर्न भ्रूण में प्रतिलिपि5 . इसलिए, ऐसे संदर्भों के अंतर्गत, repurposing तकनीक, जैसे हैक (समरूपता असिस्टेड CRISPR नॉक-इन), जो मौजूदा Gal4 लाइनों को एक अन्य LexA या क्यू-सिस्टम आधारित ड्राइवर लाइन12 में परिवर्तित कर सकते हैं, बहुत उपयोगी नहीं हो सकता है । इन सीमाओं को दूर करने के लिए, यहां, हम जीनोम संपादन द्वारा द्विआधारी अभिव्यक्ति प्रणाली पैदा करने के लिए एक कुशल और वैकल्पिक पद्धति का वर्णन किया । इस विधि में, पहले एक जीन की कोडिंग एक्सॉन transactivator (eg., LexA या Gal4) अनुक्रम के साथ बदली है ताकि प्रतिलेखन ड्राइवर की अभिव्यक्ति विशेष रूप से जीन अभिव्यक्ति के spatiotemporal पैटर्न नकल । हालांकि रणनीति और प्रोटोकॉल यहां वर्णित मास्टर्स-अभिव्यक्ति के लिए अनुकूलित किया गया, विधि आसानी से अंय जीन के लिए अपनाया जा सकता है ।

लक्षित जीन क्षेत्र के भीतर एक प्रविष्टि साइट का निर्धारण इस प्रायोगिक रणनीति में सबसे महत्वपूर्ण कदम है । विधि हम प्रस्तुत सभी मूल transcriptional के रूप में के रूप में अच्छी तरह से मास्टर्स जीन5के बाद transcriptional नियमों को बनाए रखने के लिए डिजाइन किया गया था । इसलिए, हम मास्टर्स जीन की पहली कोडिंग एक्सॉन के सबसे हटाने और यह LexA कैसेट के साथ बदलने की योजना बनाई । प्रतिस्थापन इस तरह की योजना बनाई गई थी कि संपादित एलील एक संकर LexA-मास्टर्स mRNA से अंतर्जात प्रतिलेखन और अनुवाद मास्टर्स के प्रारंभ साइट से व्यक्त करते हुए सभी intronic क्षेत्रों को बनाए रखने । हालांकि, हाइब्रिड mRNA केवल LexA प्रोटीन का उत्पादन करने के लिए इंजीनियर था, लेकिन मास्टर्स नहीं । हमें पता चला कि रणनीति सफलतापूर्वक एक मास्टर्स-LexA /LexOआधारित प्रतिलेखन प्रणाली उत्पंन किया था और यह कि प्रणाली सही गतिशील रिपोर्ट कर सकता है, spatiotemporal मास्टर्स अभिव्यक्ति पैटर्न (5 चित्रा)5 . इस प्रक्रिया की एक सीमा Drosophila लाइनों में homozygous घातकता है अगर लक्षित जीन अस्तित्व के लिए आवश्यक है । इसके अलावा, एक दोहरी gRNA रणनीति का उपयोग बंद लक्ष्य संपादन का मौका बढ़ सकता है । इन समस्याओं से बचने के लिए एक वैकल्पिक रणनीति कार्यरत हो सकती है । इस रणनीति में, एक LexA या Gal4 कैसेट सही जगह जीन की ATG शुरू साइट पर रखा जा सकता है और एक T2A स्व-सट पेप्टाइड अनुक्रम LexA के बीच रखा जा सकता है /Gal4 कैसेट और बरकरार कोडिंग एक्सॉन की शुरुआत लक्ष्य जीन । इस रणनीति के लिए एक chimeric mRNA कि दोनों transctivator और कार्यात्मक जीन उत्पाद में अनुवाद किया जा सकता है उत्पादन की उंमीद है । इस तरह के एक डिजाइन संभवतः homozygous घातकता का मौका कम कर सकता है । इस रणनीति में, एक एकल gRNA जीनोम संपादन के लिए पर्याप्त है । हालांकि, कार्यात्मक जीन की दो प्रतियां की उपस्थिति में, ट्रांसजेनिक प्रोटीन Gal4/LexA चालक द्वारा संचालित वेरिएंट की अभिव्यक्ति (eg., मास्टर्स- LexA प्रेरित अभिव्यक्ति की LexO-मास्टर्स: GFP संलयन, या मास्टर्स प्रोटीन के साथ विलोपन) संस्करण प्रोटीन की कार्यक्षमता की जानकारी प्रदान नहीं करेगा ।

जीनोम की एक सीमा संपादन रणनीति लक्ष्यीकरण और एक समय में एक एकल जीन के संपादन की श्रमसाध्य प्रक्रिया है । हालांकि, सादगी और CRISPR/Cas9 की दक्षता-मध्यस्थता जीनोम संपादन विधि लक्षित जीनोमिक दस्तक में क्रांति की है/नॉक आउट और प्रतिस्थापन प्रौद्योगिकी है कि आसानी से किसी भी मानक प्रयोगशाला में अपनाया जा सकता है की स्थापना की । पिछले कई वर्षों में, Drosophila शोधकर्ताओं ने जीनोम संपादन है कि बुनियादी जैविक प्रक्रियाओं7,13 को समझने के लिए आवश्यक आनुवंशिक toolsets का विस्तार करने के लिए नियोजित किया जा सकता के लिए सुविधाजनक toolkit विकसित किया है . जीनोम संपादन और स्क्रीनिंग प्रक्रियाओं यहां वर्णित अपेक्षाकृत तेजी से है और किसी भी अंय मुताबिक़ पुनर्संयोजन आधारित प्रतिस्थापन की तुलना में लगभग दो महीने लगते हैं । सफल और कुशल जीनोम-संपादन परिणामों के लिए, यह कई तकनीकी रूप से महत्वपूर्ण चरणों का पालन करने के लिए महत्वपूर्ण है: 1) प्रत्येक gRNA संभावित बंद-लक्ष्य के बिना अधिकतम stringency और गतिविधि द्वारा चुना गया है; 2) HDR दाता ~ १.५ kb समरूपता gRNA लक्ष्यीकरण साइटों पार्श्व हथियार हैं । लंबे समय तक समरूपता बाहों (1.8-2 केबी) HDR की दक्षता बढ़ाने के लिए जब एक बड़े exogenous डीएनए टुकड़ा की जरूरत है डाला जा करने के लिए उपयोग किया जाता है; 3) HDR दाता को gRNA मांयता साइटों से मुक्त करने के लिए इंजीनियर लोकस को gRNA के retargetिंग से बचने के लिए डिज़ाइन किया गया है; और 4) एक आसान विस्तृत योजना और आनुवंशिक पार के समय के समंवय 3 कदम पीसीआर आधारित स्क्रीनिंग के साथ एक "समाप्त होता है" HDR लाइन का चयन करें ।

यादृच्छिक स्थानांतरण या क्लोन बढ़ाने के विपरीत constructs, रणनीति और प्रोटोकॉल हम यहां वर्णित एक विशेष रूप से लक्ष्य जीन विशिष्ट द्विआधारी प्रतिलेखन प्रणाली की पीढ़ी सुनिश्चित करता है । ड्राइवर की अभिव्यक्ति के बाद से एक देशी जीन एक्सॉन की जगह, जीन चालक की विशिष्ट अभिव्यक्ति भी बहुमुखी है और सभी विकासात्मक, चयापचय के तहत जीन अभिव्यक्ति पैटर्न की नकल की उंमीद है, और शारीरिक5शर्तें । जीन/सेल-विशिष्ट अभिव्यक्ति जब वे विभिंन सेल और विकास जीवविज्ञान विधियों में उपयोग किया जाता है सभी द्विआधारी चालक लाइनों के सबसे वांछनीय मानदंड है । उदाहरण के लिए, जीन एक प्रतिलेखन चालक द्वारा रिपोर्टर जीन की विशिष्ट अभिव्यक्ति के लक्ष्य जीन व्यक्त कोशिकाओं के विश्वसनीय वंश विश्लेषण की सुविधा । यह भी लाइव इमेजिंग और spatiotemporal अभिव्यक्ति, माइग्रेशन, और कोशिकाओं के पुनर्गठन के विकास के दौरान की ट्रैकिंग सक्षम बनाता है । ऊतक morphogenesis के दौरान सेलुलर और आणविक घटनाओं की जांच करने के लिए, Gal4 या LexA प्रेरित विभिंन transgenes और RNAi की मध्यस्थता जीन दस्तक-कोशिकाओं के विशिष्ट सेट में नीचे की अभिव्यक्ति के लिए आवश्यक हैं । अत्यधिक विशिष्ट लक्षित अभिव्यक्ति प्रणाली एक निष्पक्ष विश्लेषण और परिणामों की व्याख्या प्रदान करता है । इसलिए, CRISPR/Cas9-आधारित एक जीन एक्सॉन के लक्ष्यीकरण और एक transactivator अनुक्रम के साथ अपने प्रतिस्थापन अत्यधिक विशिष्ट लक्षित जीन अभिव्यक्ति प्रणाली पैदा करने के लिए एक बेहतर विकल्प प्रदान करता है ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के हित का खुलासा करने का कोई टकराव नहीं है.

Acknowledgments

हम dr. F पोर्ट, dr. K. कॉनर-Giles, और डॉ एस फेंग CRISPR रणनीति पर विचार विमर्श के लिए धंयवाद; Dr. T.B. Kornberg, और ब्लूमिंगटन स्टॉक सेंटर के लिए रिएजेंट; UMD इमेजिंग कोर सुविधा; और NIH से फंडिंग: R00HL114867 और R35GM124878 से सीनियर

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics