Een efficiënte strategie voor het genereren van weefsel toepassingsspecifieke binaire transcriptie systemen in Drosophila door het bewerken van het genoom

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier presenteren we een methode voor het genereren van weefsel toepassingsspecifieke binaire transcriptie systemen in Drosophila door vervanging van de eerste codering exon van genen met transcriptie stuurprogramma's. De CRISPR/Cas9 gebaseerde methode plaatst een transactivator reeks onder de endogene regulering van een vervangen gen, en bijgevolg vergemakkelijkt transctivator expressie uitsluitend in gen-specifieke Spatio patronen.

Cite this Article

Copy Citation | Download Citations

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Binaire transcriptie systemen zijn krachtige genetische hulpmiddelen voor het visualiseren en manipuleren van cel lot en gen-expressie in specifieke groepen van cellen of weefsels in modelorganismen op grote schaal gebruikt. Deze systemen bevatten twee componenten als afzonderlijke transgene regels. Een driver regel spreekt een transcriptionele activator onder de controle van weefsel-specifieke initiatiefnemers/versterkers, en een verslaggever/effector lijn havens een target-gen stroomafwaarts geplaatst op de site van de binding van de transcriptie activator. Dieren herbergen van beide componenten induceren weefsel-specifieke transactivation van de genexpressie van een doel. Precieze Spatio uitdrukking van het gen in gerichte weefsels is essentieel voor onbevooroordeelde interpretatie van cel/gen-activiteit. Ontwikkeling van een methode voor het genereren van exclusieve cel/weefsel-specifieke stuurprogramma lijnen is daarom essentieel. Hier presenteren we een methode voor het genereren van zeer weefsel-specifieke gerichte expressie systemen door gebruik te maken een "geclusterd regelmatig Interspaced korte palindromische Repeat/CRISPR-geassocieerde" (CRISPR/Cas)-genoom bewerken techniek gebaseerd. Bij deze methode wordt de endonuclease Cas9 wordt gericht door twee chimeer gids RNAs (gRNA) voor specifieke sites in de eerste codering exon van een gen in het genoom van de Drosophila maken dubbel-strand einden (DSB). Vervolgens kan met behulp van een exogene donor plasmide met de transactivator reeks, de cel-autonome reparatie machines homologie geleide herstellen (HDR) van de DSB, wat resulteert in precieze verwijdering en vervanging van de exon met de transactivator volgorde. De transactivator klopte-in wordt uitgedrukt uitsluitend in cellen waar het cis-regelgevende elementen van het vervangen gen zijn functioneel. Het gedetailleerde stapsgewijze protocol hier gepresenteerd voor het genereren van een binaire transcriptionele stuurprogramma uitgedrukt in Drosophila fgf/branchless-epitheliale/neuronale cellen produceren voor elke gen - of weefsel-specifieke expressie kan worden aangenomen.

Introduction

De genetische toolbox voor gerichte genexpressie is in Drosophila, waardoor het een van de beste modelsystemen te onderzoeken van de functie van genen die betrokken zijn in een breed scala van cellulaire processen goed ontwikkeld. Binaire expressiesystemen, zoals gist Gal4/UAS (upstream activering sequence), werd aangenomen voor weefsel-specifieke enhancer overlapping en gene misexpression in de Drosophila genetische model1 (Figuur 1). Dit systeem vergemakkelijkt de ontwikkeling van een groot aantal technieken zoals Spatio verordening overexpressie van het gen, misexpression, knock-out in geselecteerde groepen cellen zo goed zoals in cel ablatie, cel markering, live traceren van cellulaire en moleculaire processen in het embryo en weefsels, lineage tracering en mozaïek analyses tijdens de ontwikkeling. Een aantal binaire transcriptie systeem, zoals de bacteriële LexA/LexAop systeem (Figuur 1) en Neurospora Q-systeem, zijn krachtige genetische hulpmiddelen die worden nu algemeen gebruikt in Drosophila, in aanvulling op het oorspronkelijke Gal4/UAS systeem voor gerichte gene expression1,2,3.

Hier presenteren we een methode voor het genereren van zeer betrouwbare weefsel toepassingsspecifieke binaire expressie systemen door gebruik te maken van een genoom-bewerken-techniek. De recente vooruitgang in CRISPR/Cas9 genoom bewerken technologie hebben toegestaan ongekende mogelijkheden gestuurde genoom wijzigingen aanbrengen in een brede waaier van organismen. In vergelijking met de andere beschikbare genoom-bewerkingstechnieken, is het CRISPR/Cas9-systeem goedkoop, efficiënt en betrouwbaar. Deze technologie maakt gebruik van onderdelen van het bacteriële adaptieve immuunsysteem: een Cas9 endonuclease van Streptococcus pyogenes die creëert een dubbel-strand break (DSB), en een chimeer gids-RNA (gRNA), die de Cas9 aan een bepaalde genoom site voor gidsen gerichte DSB4. De cellen bevatten de machine om te herstellen van de DSB met verschillende routes. Non-homologe einde deelname aan (NHEJ) leidt tot kleine invoegingen of verwijderingen verstoren genfunctie, terwijl homologie geleide reparatie (HDR) een gedefinieerde regie/wenselijk genomic knock-in/knock-out introduceert met behulp van een exogene HDR donor als een sjabloon. De vervanging HDR gebaseerde strategie kan efficiënt worden gebruikt voor het genereren van een zeer betrouwbare weefsel toepassingsspecifieke binaire expressie-systeem, dat alle beperkingen van de traditionele enhancer val methoden kan overwinnen. We beschrijven een stapsgewijze procedure voor het gebruik van CRISPR/Cas9 gebaseerde HDR reparatie bij het genereren van een binaire transcriptie driver regel die onder de controle van endogene verordening op het gebied van transcriptionele en post-transcriptional van een Drosophila wordt uitgedrukt gen. In dit protocol, tonen we de generatie van een driver regel specifiek voor branchless (bnl) gen een FGF familie eiwit dat vertakkende morfogenese van tracheale airway epitheel5 regeltcodering. In dit voorbeeld wordt de eerste codering exon van de bnl -gen werd vervangen door een opeenvolging van een bacteriële LexA transactivator reeks zonder te veranderen van een endogene cis-regulerende sequenties van de bnl -gen. We laten zien dat de strategie een bnl-LexA driver regel die spatiotemporally de expressie van een gen van de verslaggever geplaatst stroomafwaarts van LexAoperator (LexAop of LexO) uitsluitend in bnl regelt- gegenereerd epitheliale/mesenchymale/neuronale cellen uiten.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. de ontwerpen en de bouw van de gRNA expressie Vector

  1. Voor het juist een lang gedefinieerde regio van een exon vervangen gebruikt u een dubbele gRNA aanpak6, waarin elke gRNA speciaal te op twee uiteinden van het geselecteerde gebied van belang richten kan. Selecteer de twee sites van de doelstelling van de gRNA binnen de eerste codering exon van het gen voor het verkrijgen van een nauwkeurige gen-specifieke Spatio expressie van het stuurprogramma.
  2. Bij Drosophila melanogaster, selecteert u de gRNA doel sites met behulp van het flyCRISPR optimale Target Finder hulpprogramma (http://tools.flycrispr.molbio.wisc.edu/targetFinder/). Andere beschikbare CRISPR-ontwerpgereedschappen inzetbaar, met inbegrip van de geoptimaliseerde CRISPR Design tool (http://crispr.mit.edu), FlyCas9 (https://shigen.nig.ac.jp/fly/nigfly/cas9), en E-CRISP (www.e-crisp.org/E-CRISP).
    Opmerking: De volgende protocollen van gRNA design en klonen werd aangenomen van de methoden hierboven beschreven6,7.
    1. Kopieer de feitelijke volgorde in het vak in de online tool. Selecteer de meest recent uitgebrachte Drosophila melanogaster genoom aantekening versie, "r_6," in het drop-down menu voor "Select genoom." In het veld "Selecteer gids lengte (nt)," input "20." Selecteer het vinden van "Alle CRISPR doelen" en klik op "Vind CRISPR doelen".
    2. Evalueren alle kandidaat-gRNA doelstellingen door het instellen van "Maximum" voor "Starheid" en "NGG slechts" voor "PAM". Probeer te selecteren van de gRNA sites zonder een uit-doelwit of een minimum aantal af-doelen mogelijk. Gebruik de web-tool beschreven in Doench et al. 2014 8 Schakel gRNAs met een mogelijke score van de "goede" activiteit.
    3. Tegelijkertijd zorgen ervoor dat er geen single nucleotide polymorphism in de doelstellingen van de gRNA in het genoom van de bovenliggende vlieg lijn geselecteerd voor injectie (Bijvoorbeeld nos-Cas9 op het X-chromosoom, BL # 54591). Volg het protocol beschreven in Gratz et al. 20157 aan de genomic DNA halen uit de bovenliggende vlieg lijn. PCR vullen, ongeveer, de 500 – 1000 nt regio's gebruikend inleidingen die flank van de volgorde van belang en een polymerase van DNA van HiFi; volgorde-Controleer of de PCR versterkt producten.
  3. Volg voor het genereren van een tandem gRNA expressie vector, een afbinding-onafhankelijke klonen protocol6 in te voeren van twee reeksen van de protospacer in een pCFD4 RNA expressie vector. Merk op dat een verbeterde multi-gRNA expressie vector (pCFD5) nu beschikbaar, is waarin zowel de sgRNAs van de sterke U6:3 initiatiefnemers9 (https://www.crisprflydesign.org) worden uitgedrukt. Gebruik een DNA vergadering-methode om een kloon van de gRNAs in de pCFD4-vector.
    1. Ontwerpen en bestellen van de voorwaartse en omgekeerde inleidingen voor de invoering van twee reeksen van de protospacer in de pCFD4 van RNA expressie vector (tabel 1A). Als eerder beschreven6bevat de voorwaartse primer de eerste protospacer reeks geflankeerd door regio's overeenkomt met het U6-1 de promotor en de kern van de gRNA in pCFD4; de omgekeerde primer bevat de aanvulling van de omgekeerde volgorde van de tweede protospacer geflankeerd door de regio's die overeenkomt met de gRNA kern en U6-3 promotor in pCDF4.
    2. Resuspendeer inleidingen tot 100 μM met DNase en RNase-gratis dubbel gedestilleerd water (ddH2van O). Het maken van een primer concentratie van 10 μM werken. PCFD4 plasmide als sjabloon gebruiken en instellen van PCR reactie met behulp van een hifi-polymerase en aanbevolen instellingen voor PCR reactie6.
    3. Om te clonen de versterkte product in pCFD4, pCFD4 plasmide met BbsI enzym te verteren door het opzetten van de volgende reactie: 2 – 5 μg pCFD4 plasmide, 5 μl van 10 x spijsvertering buffer, 1 μL van BbsI enzym en ddH2O om het uiteindelijke volume op 50 μl. Meng de inhoud van de reactie door zachtjes te tikken van de buis en verzamelen van alle de verspreide druppels van de wand van de buis aan de onderkant door een korte spin. Incubeer de mix van de reactie bij 37 ° C gedurende 2 uur.
    4. Voer het PCR-product van stap 2 en het verteerd product uit stap 3 op een 1% agarose gel. Voer de elektroforese voor genoeg tijd om volledig gescheiden van de DNA-bands. Knip het juiste formaat DNA banden onder een UV trans-illuminator voor het zuiveren van de verwachte producten met behulp van gel elutie kolom volgens de instructies van de fabrikant (Zie Tabel van materialen). Het PCR product moeten 600 bp, en het plasmide gelineariseerde pCFD4 moet ~6.4 kb 6.
    5. Instellen van de DNA vergadering reactie in een PCR-buis, per de instructies van de fabrikant (Zie Tabel van materialen).
    6. 2 μL van de vergadering product omvormen bevoegde bacteriën (DH5α of soortgelijke stammen met ΔrecA1, ΔendA1), plaat op ampicilline (100 μg/mL) met LB (LB/Amp) agar platen en Incubeer bij 37 ° C's nachts. Merk op dat de DNA vergadering mix misschien wel giftig voor bepaalde stammen van bacteriën, maar verdunning van de vergadering-mix de toxiciteit verminderen kan.
    7. Kies 3-4 ampicilline-resistente kolonies van de overnachting-bebroede plaat, enten van de kolonie in 3 mL LB met 100 μg/mL ampicilline, en groeien geënte bacteriën in een shaker 37 ° C's nachts. Plasmide uittreksel uit de overnachting-gekweekte bacteriën met behulp van de plasmide mini prep kit volgens de instructies van de fabrikant (Zie Tabel van materialen).
    8. Het volgnummer van de plasmiden met T3 universele primer aan het scherm voor de juiste klonen met de tandem gRNA inbrengen. Vast een glycerol voorraad van bacteriën getransformeerd met een reeks-gecontroleerd pCFD4-gRNA in 20% glycerol en winkel in een vriezer-80 ° C voor toekomstig gebruik.

2. ontwerpen en de bouw van de HDR-Donor

  1. Ontwerpen voor genomic knock-in van een Gal4 of LexA reeks, een double-stranded HDR donor met de volgorde van de transactivator geflankeerd door de twee takken van de homologie.
    1. Gebruik > 1,5 kb links en rechts homologie wapens flankerende gRNA gerichte locatiegebonden. Uitgebreide homologie wapens verhoging van de efficiëntie van HDR tijdens de reparatie proces 10.
    2. PCR versterken de homologie wapens uit de genomic DNA (gDNA), gewonnen uit de bovenliggende vlieg lijn geselecteerd voor injectie (Bijvoorbeeld nos-Cas9 (op het X-chromosoom), BL # 54591). Een bewijs lezing hot-start polymerase van DNA polymerase enzym geschikt voor lange PCR extensie gebruiken (Zie Tabel van materialen). Controleer of volgorde.
  2. Om te voorkomen van de gRNA naar de gemanipuleerde locus retargeting, ontwerpen de vervanging donor op zodanige wijze dat de gRNA erkenning sites worden verstoord door de exogene reeks geïntroduceerd.
    Let op: om te voorkomen dat de vermeende cis-regulerende elementen wijzigen, kies altijd de gRNA erkenning sites binnen de codering exon-regio.
  3. Voor het genereren van een vervangende cassette, plan de DNA vergadering strategie om vier segmenten samen: de 5' en 3' homologie wapens, de middelste exogene transactivator DNA-sequentie en het gelineariseerde klonen vector backbone (bijvoorbeeld pUC19 of andere gebruikte vectoren klonen). Na de fabrikant richtsnoer voor DNA vergadering (zie tabel of Materials), de geschikte inleidingen voor PCR versterking en montage van elk segment ontwerpen. Resuspendeer inleidingen tot 100 μM met ddH2O. Make een 10 μM werken concentratie primer. HiFi-polymerase gebruiken voor alle PCR reacties. Volg de onderstaande voorschriften:
    1. PCR versterken een Gal4 of LexA cassette van de expressie van een beschikbare vector (b.v., nls-LexA:p65; de ideale Gal4/LexA/QF2 expressie plasmiden kunnen worden gevonden en kan worden verkregen uit gemeenschappelijke middelen zoals Addgene) met behulp van de inleidingen vermeld in tabel 1B.
      1. Ontwerp om te behouden alle de oorspronkelijke transcriptionele en post-transcriptional regeling van de vervangen exon op de uitdrukking van de opeenvolging van DNA van transactivator, de cassette op een zodanige wijze dat de bewerkte genomic allel spreek een chimeer mRNA van de transactivator en het gen. De 5' en 3' eind van de gerichte exon te behouden elke splicing signaal te behouden.
      2. Nemen een T2A zelf verbrijzelen-peptide reeks tussen de resterende 5' codering exon en de volgorde van de transactivator om te voorkomen dat de traduction een chimeer eiwit. Voeg een vertaling stop codon na de opeenvolging van exogene transactivator (Figuur 5).
    2. PCR versterken de homologie wapens uit de genomic DNA (gDNA), gewonnen uit de bovenliggende vlieg lijn geselecteerd voor injectie (Bijvoorbeeld nos-Cas9 (op het X-chromosoom), BL # 54591) met behulp van de inleidingen vermeld in tabel 1B. HiFi-polymerase gebruiken voor alle PCR reacties met behulp van de systemen als volgt: 5 μL van 5 x reactie Buffer, 0,5 μL van 10 mM dNTPs, 1,25 μL van 10 μM vooruit Primer, 1,25 μL van 10 μM Reverse Primer, 0,5 μL van sjabloon DNA, 0,25 μL van de Polymerase van het DNA van de High-Fidelity , 16,25 μL van ddH2O.
    3. Gebruik gelineariseerde klonen vector zoals pUC19. Een aantal donor vectoren zijn nu beschikbaar. Zien te veelomvattend tochtband op de volgende website-http://flycrispr.molbio.wisc.edu.
    4. Voer de PCR producten op een 1% agarose gel. Voer de elektroforese voldoende tijd om een duidelijke scheiding van de gewenste band van de ongewenste niet-specifieke banden (indien aanwezig). Gel-zuiveren de verwachte DNA-fragmenten. Het meten van de concentratie van elke gezuiverde DNA-fragment met een spectrofotometer.
    5. Instellen van de DNA vergadering reactie volgens de instructies van de fabrikant. Meng de gelineariseerde klonen vector- en het doeldomein fragmenten uit stap 3 en stap 4 in de volgende reactie: 1 μL van lineaire klonen vector (50 ng/l), 2-3 vouw overmaat van elke doelgroep fragment, 10 μL van 2 x DNA vergadering master mix, zodat de uiteindelijke reactie volume 20 μL met ddH < C21 > 2O. Incubate de reactie mix gedurende 1 uur bij 50 ° C.
    6. Omvormen 2 μL van de vergadering product bevoegde bacteriën, plaat op LB/Amp agar platen met 100 μg/mL ampicilline. Ook Voeg X-Gal + IPTG op de plaat voor blauw/wit screening.
    7. Kies 3 – 4 witte kolonies van de overnachting-bebroede plaat, de kolonie in 3 mL LB met 100 μg/mL ampicilline beënten, en groeien bij 37 ° C's nachts in een shaker. Uittreksel plasmide van de overnachting-gekweekte bacteriën met behulp van de plasmide mini prep kit na de fabrikant handleiding (Zie Tabel van materialen).
    8. Het scherm van de positieve kolonie door PCR of beperking spijsvertering.
    9. Volgorde controleren de HDR donor regio van het definitieve plasmide. Sla een bacteriële voorraad getransformeerd met de juiste klonen in 20% glycerol bij-80 ° C voor toekomstige inoculatie.

3. de embryo injectie, vliegen genetica en Screening voor het bewerken van het genoom

  1. Voorbereiden van de hoge zuiverheid endotoxine-vrije gRNA expressie vector evenals de HDR donor plasmide met behulp van de maxiprep van een plasmide kit (Zie Tabel van materialen).
  2. Mede de gRNA expressie plasmide (100 ng/μl) en de vervanging donor (500 ng/μl) te injecteren in de kiemcellen van nos-Cas9 embryo's6. Opmerking: we gebruiken een commerciële dienst voor injectie, maar deze procedure kan worden uitgevoerd in het laboratorium zo goed.
  3. Vliegen genetica en screening (Figuur 2 en Figuur 3):
    1. Wanneer de ingespoten embryo's tot volwassenen uitgroeien, kruis elke één G vliegt0 naar balancer vliegen. Selecteer geschikte balancer voor het chromosoom met het allel gerichte.
    2. Anesthetize de F1 nakomelingen van elke G0 kruis op een pad van CO2 en 10-20 mannen onder een stereomicroscoop willekeurig te kiezen. Steek hen individueel naar de balancer vrouwtjes zoals afgebeeld in Figuur 3.
    3. Wanneer de F2 larven hatch, kies de alleenstaande vader van de F1 van elk kruis en uitpakken van de gDNA via het interne vliegen genomic DNA voorbereiding protocol:
      1. Bereiden van gDNA extractie buffer: 10 mM Tris-Cl pH 8.2, 1 mM EDTA, 25 mM NaCl, bewaren bij kamertemperatuur. Bereiden van 20 mg/mL stockoplossing proteïnase K en op te slaan in de vriezer.
      2. Zet elke vlieg in een 1,5 mL micro-centrifuge buis en label van de buis. Bewaren in de vriezer-80 ° C's nachts.
      3. Voorbereiding van een verse werken volume van gDNA extractie buffer met 200 µg/mL eindconcentratie van proteïnase K.
        Opmerking: Gebruik geen een oude buffer voor deze stap.
      4. Squish elke vlieg voor 10 – 15 s met een uiteinde van de pipet met 50 μl van squishing buffer zonder verstrekking van de vloeistof. Afzien van de resterende buffer in de buis en meng goed. Incubeer bij 37 ° C gedurende 20-30 min.
      5. Buizen ter 95 ° C warmte blok voor 1-2 min naar de inactivering van het proteïnase K.
      6. Spin down voor 5 min op 10.000 x g. Opslaan van het preparaat bij 4 ° C voor verdere PCR analyse.
  4. Gebruik dezelfde methode ter voorbereiding van de gDNA van een nos-Cas9 -fly, die als een negatieve controle fungeert. Uitvoeren van drie-stap PCR gebaseerd schermen om te identificeren van de juiste "uiteinden uit" HDR (Figuur 2en Figuur 5) met behulp van gDNA van elke man van de F1 als een sjabloon5. Gebruik 1 μL van de DNA-prep in de volgende systeem van de PCR-reactie: 10 μL van 2 x PCR Master Mix met kleurstof, 1 μL van elke primer (10 μM), 1 μL van DNA sjabloon, en 7 μL van ddH2O.
  5. Zoals blijkt uit figuur 5A, uitvoeren van PCR inleidingen fwd1 en rev1 naar scherm te gebruiken voor het bestaan van de invoegpositie of vervanging; uitvoeren van PCR fwd2 en rev2 inleidingen te gebruiken om te controleren of de toevoeging of vervanging van 3' regio; uitvoeren van PCR gebruikt inleidingen M13F en rev3 te controleren "eindigt-in" HDR (tabel 1 c).
  6. Houd de vliegen lijnen met de bevestigde uiteinden-out HDR en stellen evenwichtige voorraden uit de F2-generatie. Genenoverdracht naar de balancer vliegen weer te verwijderen elke onbedoelde mutaties op andere chromosomen.
  7. Kwalitatief hoogwaardige gDNA uit de gevestigde bestanden voorbereiden met het sturen van lange PCR (> 800 – 1000 nt) amplicon met high-fidelity Taq polymerase en volledig volgorde controleren de waarbij de gemanipuleerde genomic regio's verkregen. Anderzijds kunt ruwe gDNA uittreksel zoals beschreven eerder versterken korter (< 800 nt), overlappende PCR producten om te volgorde-valideren van het bewerkte genoom. Gebruik het volgende protocol om te bereiden de Drosophila van de genomic DNA van goede kwaliteit:
    1. Zet over 25 volwassen vliegen in een 1,5 mL microcentrifuge buis, en bevriezen in de vriezer van-20 ° C of -80 ° C gedurende ten minste 1 uur.
    2. Toevoegen van 250 μL van oplossing A (pH 9.0 Tris HCl 0,1 M, EDTA 0,1 M, SDS 1%).
    3. Meng het vliegen met behulp van de homogenisator pestles in microcentrifuge buizen, en zet de buis op ijs.
    4. Incubeer bij 70 ° C gedurende 30 minuten.
    5. 35 μL van KOAc (5 M), shake en mix goed toevoegen, maar niet niet vortex.
    6. Incubeer op ijs gedurende 30 minuten.
    7. Draaien op 12.000 x g gedurende 15 minuten.
    8. Met een micropipet van 1 mL, zorgvuldig alleen het supernatans dat duidelijk overbrengen in een nieuwe buis, verlaten terug een eventueel neerslag of interfase.
    9. 150 μl van isopropanol aan het supernatant toevoegen. Meng zachtjes door inversie.
    10. Spin bij 10.000 x g gedurende 5 min.
    11. Verwijder het supernatant voorzichtig en laat de pellet in de buis.
    12. Wassen van de pellet met 1 mL 70% EtOH.
    13. Spin bij 12.000 x g gedurende 5 min.
    14. Verwijder het supernatant. Lucht drogen de pellet gedurende 15 tot 20 minuten. Niet meer dan de pellet drogen.
    15. Los van de pellet in 100 μl van ddH2O.
    16. High-fidelity geschikt voor lange amplicon de polymerase van DNA gebruiken (> 800 bp) om het volledige bewerkte regio versterken. In het ideale geval nemen twee inleidingen buiten de ingevoegde cassette aan de genomic regio versterken. Gel zuiveren het PCR-product, en zoals eerder beschreven, volgorde de productprestaties met meerdere overlappende inleidingen.
  8. Valideert de juiste Spatio-expressiepatronen uit ontleed weefsels/embryo's van de gemanipuleerde vliegen lijnen:
    1. RT-PCR van het totale RNA om te controleren of de expressie van het hybride mRNA product (tabel 1 d) uitvoeren.
    2. Het uitvoeren van een in situ -hybridisatie van het mRNA-product van het belang in het larvale weefsels/embryo voor het valideren van de expressie.
    3. Op het scherm voor de nauwkeurige weefsel-specifieke Spatio-expressiepatronen onder de sequentie-geverifieerd uiteinden-out lijnen, cross elk van de bewerkte lijnen verkregen voor het stuurprogramma van de binaire expressie met de LexO- GFP of LexO- RFP (voor LexA stuurprogramma) lijn (verkrijgbaar bij de voorraad centra van Bloomington) en houd rekening met de LexA of Gal4 verslaggever-genexpressie in embryo-larval en volwassen weefsels onder een fluorescentie Microscoop gereden.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dit protocol werd met succes gebruikt voor het genereren van een gerichte binaire expressie verslaggever systeem specifiek voor bnl cellen5uitdrukken. Het cis-regelgevende elementen (CREs) waarmee complexe Spatio bnl -expressie niet worden gekenmerkt. Daarom, om te bereiken Spatio expressie onder de controle van de endogene bnl regelgevende volgorde, alleen de eerste codering exon van bnl was ontworpen worden vervangen door de volgorde van de bacteriële LexA transactivator. Een verbeterde nls-LexA::p65 -cassette bekend om optimale expressie in Drosophila werd geselecteerd.

De vervanging strategie gericht voor het genereren van een chimeer nls-LexA:p65-bnl mRNA onder endogene transcriptionele en post-transcriptional controle. Deze chimeer mRNA bevatte een intact bnl 5' UTR, onderdeel van het einde 5' en 3' eind van de bewerkte bnl exon codering (eerste exon), en de volledige downstream bnl introns en exons. Om te bewaren de bnl RNA-specifieke splitsen van de vervangen exon, werden kleine 5' en 3' einden van de vervangen codering exon gehandhaafd. Echter, om te voorkomen dat de synthese van een chimeer Bnl eiwit gesmolten tot nls -LexA: p65, een T2A zelf verbrijzelen peptide reeks werd opgenomen tussen de resterende 5' bnl codering van de regio en de ATG van nls-LexA:p65. Ook een vertaling stop codon was toegevoegd na de nls-LexA:p65 volgorde om te voorkomen dat mede vertaling van een afgeknotte Bnl eiwit5 (Figuur 4 en figuur 5A).

Een donor van de vervanging met al deze functies werd gebruikt, die had de T2A-nls-LexA:p65 -reeks en 2 kb 5'- en 1,8 kb 3' - homologie wapens. Lange homologie wapens werden gebruikt voor efficiënte HDR en inbrengen van een grote fragment van DNA op de plaats van reparatie (T2A-nls-LexA:p65 is 1,8 kb) (figuur 5A).

Twee gRNAs werden gebruikt voor het maken van DSBs op de gedefinieerde posities allermeest naar de eerste codering exon van bnlverwijderen. Twee gRNAs die overeenkomen met alle criteria beschreven in punt 1.3 (PAM sequence onderstreept) waren:
gRNA1: TGTATCTGCGATGCCCCTCATGG
gRNA2: ATCCTTCAGATATTGCGGGATGG

Beide gRNA erkenning sites werden verstoord bij de donor vervanging door de exogene T2A-nls-LexA:p65 reeks, die de makkelijkste manier is om te voorkomen dat van de gRNAs naar de gemanipuleerde locus retargeting. De verstoorde gRNA erkenning sequenties in de vervanging donor (de exogene sequenties die verstoord gRNA erkenning sites in cursief) waren:
gRNA1: TGTATCTGCG -GGCTCCGGCGAAGGAC...
gRNA2:... AAAAACTCGTTTAGA- CGGGATGG

De pCFD4 gRNA expressie vector met deze gRNAs, samen met de vervanging donor, was mede ingespoten in de kiemcellen embryo's de Amendementen-Cas9 . Vervolgens het protocol beschreven hier volgde aan het scherm voor de beoogde vervanging (figuur 5B, C). Er waren ongeveer 67% van ingespoten G0 dieren vruchtbare. En 56% van de vruchtbare G0s waren de oprichters, die aanleiding gaf tot HDR-seropositieve nakomelingen. Onder de F1 nakomelingen gecontroleerd, ongeveer 23% positieve voor succesvolle HDR, en 73% van de positieve HDR waren "uiteinden-out" (tabel 2). Sinds de eerste codering exon van bnl was "knock-out", alle lijnen van de HDR bleken te zijn homozygoot dodelijk, en de voorraden werden onderhouden over balancers.

De generatie van een chimeer LexA-bnl mRNA in de cellen werd gevalideerd door RT-PCR-analyses (figuur 5D). Om te controleren of de verkregen bnl-LexA lijnen alsof uitgedrukt in het endogene bnl -expressiepatroon, elke regel van de HDR "uiteinden-out" naar LexO-mCherryCAAX transgene vliegen5, en de verslaggever-expressiepatroon werd gekruist werd onderzocht in de nakomelingen embryo's en larven. 42 van 46 lijnen toonde nauwkeurige Spatio expressie overeen met de eerder gemelde bnl patronen5 (Figuur 6). Vier lijnen toonde een zwakke of aspecifieke expressiepatronen. We voorspellen dat deze lijnen mutaties, die wij moeten controleren met grondige sequencing analyses kunnen hebben verzameld. Samen bevestigd deze resultaten dat de HDR-gemedieerde exon vervanging strategie met succes kan worden gebruikt voor het genereren van een systeem van de gerichte binaire expressie voor een gen. De tool kan met succes worden gebruikt om express verslaggever of ectopische genen in de spatio patronen van de bnl -gen.

Figure 1
Figuur 1: schema van een binaire transcriptie systeem voor gerichte genexpressie. Een transactivator (GAL4 of LexA), uitgedrukt onder de controle van cis-regelgevende elementen (CREs) van een gen, rijdt een effector transgenic geplaatst stroomafwaarts van de specifieke transcriptie bandplaatsen (UAS voor Gal4 of LexAop voor LexA). Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: een overzicht van de werkstroom voor CRISPR/Cas9-gemedieerde genoom bewerken voor het genereren van een systeem voor binaire transcriptie. De geschatte tijdsduur nodig voor elke stap wordt aangegeven. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: een illustratie van de CRISPR, screening en genetische grensoverschrijdende regeling voor de vaststelling van genoom-bewerkt vliegen lijnen. In genetische kruisen staat R voor het bewerkte allel thats op het chromosoom 3rd . MKRS (Tp (3; 3) Mevrouw, M (3) 76A [1] kar [1] ry [2] Sb [1]), is een 3rd chromosoom marker; TM6B (In (3LR) TM6B, Antp [Hu] e [1] Tb[1]) is een 3rd chromosoom balancer. Genoom bewerkt vliegen voorraden worden geverifieerd door PCR de doelregio's van belang van de genomic DNA geëxtraheerd uit de F2 of de F3 generatie vliegen en de volgorde bepalen van de PCR producten frequentiebanden te versterken. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: generatie van de cassette vervangen door DNA vergadering. Een schematische tekening beeltenis van PCR versterking en assemblage van verschillende PCR producten (a, b en c) in de vector van de donor (d) het gebruikmaken van een DNA vergadering methode. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5: Generatie bnl-LexA door CRISPR/Cas9-gemedieerde exon vervanging. (A) schematische tekening van de beeltenis van de strategie van de CRISPR/Cas9 gemedieerde HDR voor exon vervanging in de bnl locus. Box - exon; lijn-intron; vervanging donor (pDonor -bnl:LexA) en twee mogelijke uitkomsten van de HDR werden getoond. De pDonor -bnl:LexA had de volgende kenmerken: (1)T2A-nls-LexA:p65 (~1.8kb) volgorde geflankeerd door 2 kb en 1,8 kb lang homologie wapens (onderbroken lijnen), (2) een peptide T2A zelf verbrijzelen tussen de resterende N terminal bnl exon en de nls-LexA:p65, en (3) een vertaling stop codon (rode *) nadat de nls-LexA:p65 reeks. De HDR-product behouden alle transcriptionele en post-transcriptional controle van bnl,en de LexA: p65 eiwitten worden geproduceerd in hetzelfde patroon als endogene Bnl. kleine zwarte pijlen wijzen naar de relatieve bandplaatsen (niet in verwachting schaal) van de PCR inleidingen (tabel 1) gebruikt voor 3-staps screening of RT-PCR validatie. (B) Agarose gel afbeeldingen weergegeven: resultaten van de screening van de PCR 3-stap. PCR producten versterkt uit de genomic DNA van vier succesvolle uiteinden-out HDR lijnen worden weergegeven; negatieve controle, het genomic DNA van nos-Cas9 ouderlijke lijn; positieve controle, pDonor -bnl:LexA -plasmide; M, Marker (SL2K DNA-ladder). (C) een voorbeeld van de screening gel toont de verwachte PCR product gebruikend inleidingen M13F en rev3 voor eindigt-in lijnen; M8-7 en M9-6 zijn twee uiteinden-in lijnen; negatieve en positieve controles, gelijk aan B; M, Marker (NEB 1 kb DNA ladder). (D) RT-PCR analyse op totaal RNA van bnl-LexA en de controle van de nos-Cas9 vliegt. Voorwaartse primer bindt aan een specifiek gebied van LexA , omgekeerde primer bindt aan een stroomafwaartse bnl exon regio; ~ 440 bp (base-paar) versterking band (*) van de RT-PCR werd ontdekt op bnl-LexA mRNA, maar niet van het besturingselement RNA. M, 100 bp Marker (NEB). Uit de figuren 2 en S1 in Du et al.aangepast. 20175. Klik hier voor een grotere versie van dit cijfer.

Figure 6
Figuur 6: Validatie van weefsel-specifieke en voorwaardelijke bnl-LexA expressie in verschillende weefsels. (A-D) bnl expressie (rood) in verschillende weefsels en larvale, met de btl uiting van cellen in het groen weergegeven. (A, A') Vleugel bnl discbron voorafgaand aan de groeiende air sac primordium (ASP). (B, C) BNL expressie in TR5 dwarse connective (TC) (B) en TR2 dorsale tak (DB) (C). (D) bnl expressie in genitale schijven. (E-J) Dynamische bnl expressie (rood) tijdens de embryonale tracheale tak (groen) patronen; Kleine pijltjes, vijf bnl bronnen rond de trachea placode stadium 10. Genotypen: A-J; btl-Gal4, UAS- CD8GFP / +; bnl-LexA, LexO- CherryCAAX /+. (K-L ") Hypoxie-geïnduceerde bnl-LexA profiel in vleugel schijven en bijbehorende TR2 tracheale metamere (TC, DB, dorsale stam-DT). Genotype: bnl-LexA, LexO -CherryCAAX / +. (K) controle schijven van ex vivo gekweekte organen zonder CoCl2. (L-L") vleugel schijven (L, L') en luchtpijp (DT, (L'')) van gekweekte ex vivo organen met CoCl2 geïnduceerde hypoxie. Ster, ectopische expressie geïnduceerd door hypoxie. Schaal bars = 30 µm; 50 µm (K-L"). Uit Figuur 3 in Du et al.aangepast. 20175. Klik hier voor een grotere versie van dit cijfer.

A. gRNA klonen en sequencing
BNL-lexA gRNA fwd TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
BNL-lexA gRNA rev ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
OPcGACGTTAAATTGAAAATAGGTC
T3 primer gebruikt voor het rangschikken CAATTA ACCCTCACTAAAGG-3'
Opmerking: nucleotiden onderstreept ontharden aan U6 promotor of gRNA kern op pCFD4 vector, de kleine letters g/c toevoegde aan steun U6 promotor-afhankelijke transcriptie
B. HDR donor bouw
BNL N-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
BNL-lexA-N-R tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
C
lexA-F CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
lexA-R CTAAACGAGTTTTTAAGCAAACTCACTC
BNL lexA-C Fwd TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
BNL C-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
Opmerking: nucleotiden in kapitaal overlap met pUC19 vector voor de assemblage van Gibson, nucleotiden onderstreept zijn reeks overhang voor T2A peptide toevoeging.
C. HDR screening en rangschikken
BNL-lexA scr fwd1 GTGGCGCACGCCCAATAAAC
BNL-lexA scr rev1 GATCCCAGCCAATCTCCGTTG
BNL-lexA scr fwd2 CAACGGAGATTGGCTGGGATC
BNL-lexA scr rev2 CTGGCCAACTGTAGGGAAGTC
eindigt-in check-rev3 GCAATGTTATGCAATGCGTTGAC
BNL-lexA seq fwd3 CACTTGTCGCCCATATTGATACAATTG
Opmerking: Deze inleidingen werden gebruikt voor PCR screening en het rangschikken, de geschatte locaties van bindende inleidingsplaatsen zijn weergegeven in figuur 5A als fwd1-2 en rev1-3.
D. RT-PCR analyse
RT-f GATATGGATTTCTCCGCTTTGCTG
RT-r CCATGCAGAGATACAGGCAAGTG

Tabel 1: inleidingen gebruikt in deze studie. (A) inleidingen voor klonen van gRNA expressie vector en sequencing. (B) inleidingen voor het klonen van HDR donor sjabloon. (C) inleidingen voor screening en rangschikken van de HDR-producten. (D) Primers gebruikt voor verificatie van de RT-PCR van het chimeer LexA-bnl mRNA product.

genotype HDR transmissie tarief % (# HDR-opbrengst G0 / # vruchtbare G0) # HDR-positieve F1 / # totale F1 gecontroleerd (%) # "uiteinden-out" HDR / # totale HDR (%)
BNL-LexA 56 (15/27) 23 (60/259) 73 (46/60)

Tabel 2: de efficiëntie van CRISPR/Cas9-gemedieerde HDR. De HDR-overdrachtssnelheid wordt berekend als de # van HDR-opbrengst G0 / # van totale vruchtbare G0. Succesvolle HDR % wordt berekend als de # van HDR-positieve F1 / # van totale F1 gescreend. "Uiteinden-out" % wordt berekend als het aantal "uiteinden-out" HDR / # van totale positieve HDR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Traditioneel, werden Drosophila enhancer vallen gegenereerd door twee verschillende methoden. Een van de manieren bevat willekeurige invoeging van een stuurprogramma (bijv., Gal4) volgorde in het genoom door omzetting (bv., P-element omzetting)1 . Als alternatief, kunnen de stuurprogramma-sequenties worden geplaatst onder de Transcriptionele controle van een vermeende versterker/promotor regio in een plasmide constructie, die vervolgens zou worden geïntegreerd in een ectopische site van het genoom3,11. Hoewel deze methoden hebben een grote pool van Gal4 of LexA enhancer vallen gegenereerd voor Drosophila, hebben zij verschillende beperkingen. Het P-element-gemedieerde willekeurig inbrengen in het genoom kan het verstoren van de regelgeving van kritische cis-regulerende sequenties. Als gevolg van de willekeurige omzetting in het genoom rapporteert transactivator expressie mogelijk patronen van meerdere naburige genen. Aan de andere kant, is een voorafgaande kennis van de GOS-regulerende sequenties van een gen noodzakelijk voor een versterker-trap plasmide construct. Er is ook een limiet aan de lengte van een reeks die kan worden gekloond en getest in een plasmide-constructie. Isoleren en klonen van slechts een gedeeltelijke fragment van DNA uit de endogene genomic context kunnen een volledige expressie van gen-specifieke patronen niet reproduceren. Bijvoorbeeld, doet de lijn van de bnl-Gal4 (NP2211), die werd gegenereerd door het P-element invoeging van een versterker trap Gal4 element vlak voor de bnl -gen, niet helemaal reproduceren de van de gen-specifieke expressiepatronen in het embryo5 . Daarom onder dergelijke contexten, de herdefiniëren technieken, zoals HACK (homologie bijgestaan CRISPR knock-in), dat kan converteren de bestaande Gal4 lijnen naar een ander LexA of Q-systeem gebaseerd stuurprogramma lijn12 mogelijk niet handig. Deze beperkingen wilt opheffen, beschreven we hier, een efficiënte en alternatieve methode voor het genereren van binaire expressiesystemen door het bewerken van het genoom. Bij deze methode wordt de eerste codering exon van een gen is verwisseld met de transactivator (bijv., LexA of Gal4) volgnummer zodat de uitdrukking van de transcriptie bestuurder uitsluitend de spatio patronen van de genexpressie bootst. Hoewel de strategie en de protocollen die hier beschreven werden geoptimaliseerd voor bnl -expressie, kan de methode gemakkelijk worden vastgesteld voor andere genen.

Het bepalen van een site van de invoegpositie binnen de regio gerichte gen is de meest kritische stap in deze experimentele strategie. De methode die we gepresenteerd werd ontworpen om alle het origineel transcriptionele evenals de post-transcriptional verordeningen van de bnl gen5behouden. Dus we gepland om te verwijderen van de meeste van de eerste codering exon van de bnl -gen en de LexA cassette te vervangen. De vervanging was gepland op een zodanige wijze dat de bewerkte allel een hybride LexA-bnl spreekt mRNA van de endogene transcriptie en vertaling site van bnl starten met behoud van alle intronic regio's. Echter, de hybride mRNA werd ontworpen om de producten alleen LexA eiwit, maar niet Bnl. We hebben laten zien dat de strategie met succes een bnl-LexA had gegenereerd /LexO-op basis van transcriptie systeem hebben en dat het systeem nauwkeurig de dynamische, Spatio bnl -expressiepatronen (Figuur 5)5 . Een beperking van dit proces is de homozygoot letaliteit in de Drosophila lijnen als het beoogde gen essentieel om te overleven is. Verder kan gebruik van een dubbele gRNA-strategie verhogen de kans op uit-target bewerken. Een alternatieve strategie kan worden ingezet om deze problemen te vermijden. In deze strategie kan een cassette LexA of Gal4 worden geplaatst recht op de ATG start plaats van de vervangen gen en een T2A zelf verbrijzelen peptide volgorde kan worden geplaatst tussen de cassette LexA/Gal4 en het begin van de exon intact codering van het doel-gen. Deze strategie wordt verwacht dat het produceren van een chimeer mRNA die vertaald kan worden in zowel de transctivator als de functionele gene product. Zo'n ontwerp kan eventueel verminderen de kans op homozygoot letaliteit. In deze strategie volstaat een enkel gRNA voor het bewerken van het genoom. Echter in de aanwezigheid van twee exemplaren van functionele genen, expressie van de transgene eiwit varianten gedreven door het stuurprogramma Gal4/LexA (bijv., bnl-LexA gedreven uitdrukking van LexO- Bnl: GFP fusies of Bnl eiwitten met verwijderingen) zijn toegestaan zal geen informatie van de functionaliteit van de variant eiwitten.

Een beperking van de strategie van genoom-bewerken is het moeizame proces van targeting en het uitgeven van een enkel gen tegelijk. Echter, de eenvoud en efficiëntie van CRISPR/Cas9-gemedieerde genoom bewerken methode hebben een revolutie teweeggebracht in de gerichte genomic knock-in/knock-out en vervanging technologie die gemakkelijk kan worden vastgesteld in een standaard laboratorium instellen. In de afgelopen jaren, hebben Drosophila onderzoekers ontwikkeld handige toolkits voor het bewerken van het genoom die kan worden ingezet om uit te breiden van de genetische toolsets essentieel is voor begrip fundamentele biologische processen7,13 . Het genoom bewerken en screening van de hier beschreven processen is relatief sneller en duurt ongeveer twee maanden in vergelijking met andere homologe recombinatie gebaseerde vervangende. Voor succesvol en efficiënt genoom-bewerken resultaten, is het belangrijk om verschillende technisch kritische stappen: 1) elke gRNA is geselecteerd door de maximale striktheid en de activiteit zonder potentiële uit doelsoort zijn; 2) de HDR donor bevat ~1.5 kb homologie wapens flankerend de gRNA gericht op sites. Langere homologie wapens (1.8-2 kb) worden gebruikt voor de verhoging van de efficiëntie van HDR wanneer een grote exogene DNA-fragment worden ingevoegd moet; 3) de HDR donor is ontworpen om kosteloos de gRNA erkenning sites te vermijden kredietherschikking van de gRNA naar de gemanipuleerde locus; en 4) een bedrijfszeker uitwerken plan en de coördinatie van het tijdschema van genetische kruisen met 3-staps PCR-gebaseerde screening om een lijn van de HDR "uiteinden-out" te selecteren.

In tegenstelling tot willekeurige omzetting of gekloonde enhancer constructies, de strategie en de protocollen die we hier beschreven zorgt voor generatie van een uitsluitend richten op gen-specifieke binaire transcriptie systeem. Aangezien de expressie van het stuurprogramma een inheemse gene exon vervangt, gen-specifieke expressie van het stuurprogramma is ook veelzijdig en verwachting na te bootsen van gen-expressiepatronen onder alle ontwikkelingsstoornissen, metabole en fysiologische omstandigheden5. Gen/cel-specifieke expressie is de meest wenselijke criteria van alle lijnen van het binaire stuurprogramma wanneer ze worden gebruikt in verschillende cel en ontwikkelingsbiologie methoden. Bijvoorbeeld, vergemakkelijkt gen-specifieke expressie van genen die verslaggever door een stuurprogramma dat transcriptie betrouwbare afstamming analyses van de cellen die de target-gen uitdrukt. Het maakt ook levende imaging en bijhouden van de spatio expressie, migratie en reorganisatie van cellen tijdens de ontwikkeling. Voor het onderzoek naar de cellulaire en moleculaire gebeurtenissen tijdens weefsel morfogenese, Gal4 of LexA gedreven overexpressie/misexpression van zijn verschillende transgenen en RNAi-gemedieerde gene knock-down in specifieke soorten cellen essentieel. Zeer specifieke gerichte expressie systeem biedt een onbevooroordeelde analyse en interpretatie van de resultaten. Daarom, CRISPR/Cas9 gebaseerde targeting van een gen exon en zijn vervanging met een transactivator-reeks biedt een beter alternatief voor het genereren van zeer specifieke gerichte gen expressiesystemen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben geen conflicten van belang om te vermelden.

Acknowledgments

Wij danken Dr. F. Port, Dr. K. O'Connor-Giles en Dr. S. Feng voor discussies over de strategie van de CRISPR; Dr. T.B. Kornberg, en het Bloomington voorraad Center for reagentia; UMD imaging core faciliteit; en financiering van NIH: R00HL114867 en R35GM124878 naar SR.

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics