Uma estratégia eficiente para gerar sistemas de transcrição binário de tecido-específica em Drosophila editando genoma

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aqui, apresentamos um método para gerar sistemas de transcrição binário de tecido-específica em Drosophila , substituindo o primeiro exon codificação de genes com drivers de transcrição. O método baseado em CRISPR/Cas9 coloca uma sequência liberada sob o Regulamento endógena de um gene substituído e, consequentemente, facilita a expressão de transctivator exclusivamente em padrões spatiotemporal gene-específico.

Cite this Article

Copy Citation | Download Citations

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Sistemas de transcrição binário são poderosas ferramentas de genéticas, amplamente utilizadas para visualizar e manipular a célula destino e gene expression em grupos específicos de células ou tecidos em organismos-modelo. Estes sistemas contêm duas componentes linhas transgénicas. Uma linha de motorista expressa um ativador transcricional sob o controle de promotores/potenciadores de tecido-específica e uma linha de repórter/efetoras portos um gene alvo colocado a jusante para o sítio de ligação do ativador da transcrição. Animais, abrigando os dois componentes induzem transactivation tecido-específica de uma expressão de gene alvo. Preciso spatiotemporal expressão do gene nos tecidos alvo é crítica para interpretação imparcial da atividade celular/gene. Portanto, é essencial desenvolver um método para gerar linhas de motorista exclusivo de célula/tecido-específica. Aqui nós apresentamos um método para gerar o sistema altamente específicos do tecido-alvo expressão empregando um "Clustered regularmente Interspaced curta palíndromo Repeat/CRISPR-associado" (CRISPR/Cas)-com base técnica de edição de genoma. Neste método, a endonuclease Cas9 é alvo de dois quimérico guia RNAs (gRNA) para locais específicos no primeiro exon codificação de um gene no genoma de Drosophila para criar quebras de dobro-Costa (DSB). Posteriormente, usando um plasmídeo exógena do doador que contém a sequência de liberada, a maquinaria de reparo celular-autónoma permite reparação homologia-dirigido (HDR) de ORL, resultando em preciso exclusão e substituição do exon com a liberada sequência. A batido em liberada é expressa exclusivamente nas células onde o cis-elementos reguladores do gene substituído são funcionais. O protocolo passo a passo detalhado apresentado aqui para gerar um binário driver transcriptional expressado em Drosophila fgf/branchless-produção de células epiteliais/neuronal pode ser adotado para qualquer expressão de gene - ou tecido-específica.

Introduction

A caixa de ferramentas genética para a expressão do gene alvo bem desenvolveu-se em Drosophila, tornando-o um dos melhores sistemas de modelo para investigar a função de genes envolvidos em uma ampla variedade de processos celulares. Sistemas de expressão binário, como fermento Gal4/UAS (sequência de ativação upstream), foi adotado inicialmente por misexpression de trapping e gene potenciador de tecido-específica na drosófila genética modelo1 (Figura 1). Este sistema facilitou o desenvolvimento de um grande número de técnicas como spatiotemporal regulamento da superexpressão do gene, misexpression, nocaute em grupos selecionados de células, bem como em ablação de célula, marcação de célula, ao rastreamento de celular e molecular processos em embriões e tecidos, rastreamento de linhagem e análises de mosaico durante o desenvolvimento. Um número do sistema binário de transcrição, tais como o bacteriana LexA/ sistemaLexAop (Figura 1) e Q-sistema de Neurospora , são poderosas ferramentas genéticas que são amplamente utilizadas em Drosophila, além de o sistema original de Gal4/UAS para expressão de gene alvo a1,2,3.

Aqui, apresentamos um método para gerar o sistema altamente confiável tecido-específica de expressão binário empregando uma técnica de edição de genoma. Aos recentes avanços na tecnologia de edição CRISPR/Cas9 genoma permitiu oportunidades sem precedentes para fazer mudanças de direção do genoma em uma ampla gama de organismos. Em comparação com outras técnicas de edição disponíveis do genoma, o sistema CRISPR/Cas9 é barato, eficiente e confiável. Esta tecnologia utiliza componentes do sistema imune adaptativo bacteriano: uma endonuclease Cas9 de Streptococcus pyogenes que cria uma ruptura da dobro-Costa (DSB) e um RNA guia Quimérico (gRNA), que orienta a Cas9 para um site específico do genoma para alvo de ORL4. As células contêm a maquinaria para reparar o ORL usando diferentes caminhos. Não-homóloga final juntando (NHEJ) leva a pequenas inserções ou exclusões para perturbar a função dos genes, enquanto reparo homologia-dirigido (HDR) introduz um definido dirigido/desejável genômica em/TOC-nocaute usando um doador HDR exógeno como um modelo. A estratégia de substituição baseada em HDR com eficiência pode ser utilizada para gerar um sistema altamente confiável expressão binário de tecido-específica, que pode superar todas as limitações dos métodos tradicionais potenciador armadilha. Descrevemos um procedimento passo a passo para a utilização do reparo HDR CRISPR/Cas9-baseado na geração de uma linha de driver binário da transcrição que se expressa sob o controle de endógena regulação transcricional e pós-transcricional de um da drosófila gene. Neste protocolo, demonstramos a geração de uma linha de motorista específica para branchless (bnl) gene que codifica uma proteína de família FGF que regula a morfogênese de ramificação da via aérea traqueal epitélio5. Neste exemplo, o primeiro exon codificação do gene da bnl foi substituído pela sequência de uma sequência de liberada bacteriana LexA sem alterar qualquer endógena cis-sequências reguladoras do gene do bnl . Mostramos que a estratégia gerou uma linha de motorista bnl-LexA que spatiotemporally controla a expressão de um gene repórter, colocado a jusante do LexAoperator (LexAop ou seguir) exclusivamente na bnl- expressando as células epiteliais/mesenquimais/neuronal.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. projetar e construir a gRNA vetor de expressão

  1. Para precisamente substituir uma região tempo definida de um exon, use uma gRNA dupla abordagem6, em que cada gRNA pode alvejar especificamente duas extremidades da região selecionada de interesse. Para obter uma expressão spatiotemporal precisa de gene-específico do driver, selecione dois sites de destino gRNA dentro o primeiro exon codificação do gene.
  2. Drosophila melanogaster, selecione os sites de destino gRNA usando a ferramenta de utilitário de destino ideal do flyCRISPR (http://tools.flycrispr.molbio.wisc.edu/targetFinder/). Outras ferramentas de design CRISPR disponíveis podem ser usadas também, incluindo a ferramenta otimizado CRISPR Design (http://crispr.mit.edu), FlyCas9 (https://shigen.nig.ac.jp/fly/nigfly/cas9) e E-CRISP (www.e-crisp.org/E-CRISP).
    Nota: Os seguintes protocolos de gRNA design e clonagem foi adotada de métodos anteriormente descritos,6,7.
    1. Copie a sequência real na caixa fornecida na ferramenta on-line. Selecione mais recentemente Drosophila melanogaster genoma anotação versão lançada, "r_6", no menu suspenso para "Select genoma." No campo "Select guia comprimento (nt)," entrada "20". Selecione para encontrar "Todos os alvos CRISPR" e clique em "Encontrar CRISPR alvos".
    2. Avalie todos os alvos de gRNA candidato definindo "Máximo" para o "Rigor" e "NGG somente" para "PAM". Tente selecionar os sites gRNA sem qualquer potencial fora-alvo ou um número mínimo de possível fora-alvos. Uso da ferramenta web descrito em Doench et al 2014 8 para selecionar gRNAs com uma pontuação de "boa" atividade potencial.
    3. Simultaneamente, assegurar que não há nenhum polimorfismo de nucleotídeo único em alvos a gRNA no genoma da linha voar pai selecionado para injeção (E.g., n º s-Cas9 no cromossoma X, BL # 54591). Siga o protocolo descrito em Gratz et al . 20157 para extrair o DNA genômico de linha pai de voar. PCR amplificar, aproximadamente, 500 – 1.000 nt regiões usando as primeiras demão que flanqueiam a sequência de interesse e uma polimerase de DNA de alta fidelidade; sequência-Verifique se os produtos da PCR amplificado.
  3. Para gerar um vetor de expressão em tandem gRNA, siga uma ligadura independente clonagem, protocolo6 para introduzir duas sequências de protospacer em um vetor de expressão de RNA pCFD4. Note-se que um vetor de expressão de multi-gRNA melhorado (pCFD5) agora está disponível, onde ambos os sgRNAs exprimem-se do forte U6:3 promotores9 (https://www.crisprflydesign.org). Use um método de montagem de DNA para clonar o gRNAs no vetor pCFD4.
    1. Projetar e ordenar as primeiras demão para diante e reversos para a introdução duas sequências de protospacer a pCFD4 de vetor de expressão de RNA (tabela 1A). Como descrito anteriormente,6, o primer frente contém a primeira sequência de protospacer, ladeada por regiões correspondentes ao promotor U6-1 e núcleo de gRNA em pCFD4; o reverso primer contém a sequência inversa complemento da segunda protospacer ladeado por regiões correspondentes ao núcleo gRNA e promotor de U6-3 em pCDF4.
    2. Resuspenda primers para 100 μM com DNase e RNase livre água bidestilada (ddH2O). Fazer uma cartilha de concentração de trabalho 10 do μM. Usar o plasmídeo pCFD4 como modelo e configurar a reação de PCR usando um polymerase de alta-fidelidade e recomendado configurações para reação de PCR6.
    3. Para clonar o produto amplificado em pCFD4, digerir pCFD4 do plasmídeo com enzimas BbsI Configurando a seguinte reação: 2 – 5 μg do plasmídeo pCFD4, 5 μL de tampão de digestão de 10x, 1 μL de enzima BbsI e ddH2O para trazer o volume final de 50 μL. Misture o conteúdo de reação suavemente tocando o tubo e recolher todas as gotas dispersas da parede do tubo ao fundo por uma breve volta. Incube a mistura de reação a 37 ° C por 2 h.
    4. Execute o produto do PCR da etapa 2 e digerido produto da etapa 3 em um gel de agarose 1%. Realize a eletroforese por tempo suficiente para separar completamente as bandas de DNA. Corte o correto tamanho bandas de DNA sob uma trans-iluminador UV antes de purificar os produtos esperados, usando a coluna de eluição de gel seguindo as instruções do fabricante (ver Tabela de materiais). O produto PCR deve ser 600 bp e o plasmídeo linear pCFD4 devem ser ~6.4 kb 6.
    5. Configurar a reação de montagem de DNA em um tubo de PCR, pelas instruções do fabricante (ver Tabela de materiais).
    6. 2 μL do produto montagem se transformar em bactérias competentes (DH5α ou cepas semelhantes com ΔrecA1, ΔendA1), placa de ampicilina (100 μg/mL) contendo placas de ágar LB (LB/Amp) e incubar a 37 ° C durante a noite. Observe que a combinação de Assembleia de DNA pode ser tóxica para certas estirpes de bactérias, mas diluir a mistura de montagem pode reduzir a toxicidade.
    7. Escolha 3 – 4 colônias ampicilina-resistentes da placa incubados durante a noite, inocular a colônia em 3 mL contendo 100 ampicilina μg/mL LB e crescer bactérias inoculadas em um shaker de 37 ° C durante a noite. Extraia o plasmídeo da bactéria durante a noite-cultivadas usando o plasmídeo prep mini kit seguindo as instruções do fabricante (ver Tabela de materiais).
    8. Sequenciar os plasmideos com primer universal de T3 a tela para os corretos clones contendo a inserção de gRNA em tandem. Estabelece um estoque de glicerol de bactéria transformada com um pCFD4-gRNA sequência verificada em glicerol 20% e a loja em um freezer-80 ° C para uso futuro.

2. projetando e construindo o doador HDR

  1. Para genômico bater-de uma sequência de Gal4 ou LexA , desenha um doador HDR de dupla-hélice que contém a sequência de liberada, ladeada por dois braços de homologia.
    1. Uso > 1,5 kb deixou e braços certa homologia flanqueando o direcionamento de gRNA conceptuais. Braços estendidos homologia aumentam a eficiência do HDR durante o processo de reparação 10.
    2. PCR amplificar os braços de homologia de DNA genômico (gDNA) extraído da linha voar pai selecionada para injeção (E.g., n º s-Cas9 (no cromossoma X), BL # 54591). Use uma prova de leitura início quente Taq DNA polimerase enzima apropriada para a longa extensão PCR (veja a Tabela de materiais). Verifica a sequência.
  2. Para evitar o redirecionamento da gRNA para o locus engenharia, desenha o doador de substituição de tal forma que os sites de reconhecimento gRNA são perturbados pela sequência exógena introduzida.
    Nota: para evitar de alterar os elementos cis-regulatórios putativos, sempre selecione os sites de reconhecimento de gRNA dentro da região de exon a codificação.
  3. Para a geração de uma fita de substituição, planejar a estratégia de montagem do DNA para unir quatro segmentos: os braços de homologia 5' e 3', a sequência de DNA médio liberada exógenos e a clonagem linear vector coluna vertebral (por exemplo, pUC19 ou outros comumente utilizados vectores de clonagem). Seguindo orientação do fabricante para montagem de DNA (ver tabela de materiais), desenha os primers adequados para amplificação por PCR e montagem de cada segmento. Resuspenda primers para 100 μM com DDQ2Make O. uma cartilha de concentração de trabalho 10 do μM. Use o polymerase de alta fidelidade para todas as reações de PCR. Siga o seguinte protocolo:
    1. PCR amplificar uma gaveta de expressão Gal4 ou LexA de um vetor de disponível (por exemplo, nls-LexA:p65; o plasmídeo de expressão ideal Gal4/LexA/QF2 pode ser encontrado e obtido de recursos comuns, tais como Addgene) usando o primeiras demão listadas na tabela 1B.
      1. Para reter todos os originais regulamentos transcricionais e pós-transcricional do exon substituído na expressão da sequência de DNA liberada, desenha a fita de modo que o alelo genômico editado expressaria um RNAm quimérico do liberada e o gene. Preserve a extremidade 5' e 3' do exon direcionado para reter qualquer sinal de emenda.
      2. Incorpore uma sequência de peptídeo Self chicotada T2A entre residual 5' codificação exon e a sequência liberada para impedir a tradução em uma proteína quimérico. Adicione um códon de parada de tradução após a sequência de liberada exógenos (Figura 5).
    2. PCR amplificar os braços de homologia de DNA genômico (gDNA) extraído da linha voar pai selecionada para injeção (E.g., n º s-Cas9 (no cromossoma X), BL # 54591) usar as primeiras demão listados na tabela 1B. Use polymerase de alta fidelidade para todas as reações de PCR utilizando os sistemas da seguinte forma: 5 μL de 5x do amortecedor da reação, 0,5 µ l de dNTPs 10 mM, 1.25 μL de 10 μM para a frente, Primer, 1.25 μL de 10 μM Primer Reverse, 0,5 μL de DNA modelo, 0.25 μL de DNA polimerase de alta-fidelidade , 16.25 μL de DDQ2O.
    3. Usa o vetor de clonagem linear como pUC19. Um número de vetores de doadores está agora disponível. Ver uma lista completa para o seguinte site-http://flycrispr.molbio.wisc.edu.
    4. Execute os produtos PCR em um gel de agarose 1%. Realize a eletroforese por tempo suficiente para garantir uma clara separação entre a banda desejada das bandas inespecíficas indesejadas (se houver). Gel-purifica os fragmentos de DNA a esperada. Medir a concentração de cada fragmento de DNA purificado utilizando um espectrofotômetro.
    5. Configure a reação de montagem de DNA seguindo as instruções do fabricante. Misturar os fragmentos clonagem linear vector e alvo do passo 3 e passo 4 na seguinte reação: 1 μL de linear clonagem vector (50 ng/μL), excesso de dobra de 2 – 3 de cada fragmento do alvo, 10 μL de 2 x mistura mestre da montagem de DNA, trazer o volume final de reação de 20 μL com DDQ < C21 > 2O. Incubar a mistura de reação durante 1 hora a 50 ° C.
    6. Transforme 2 μL do produto montagem em bactérias competentes, placa em placas de ágar LB/Amp contendo 100 ampicilina μg/mL. Também, adicione X-galão + IPTG na placa para rastreio de azul/branco.
    7. Escolha 3 – 4 colônias brancas da placa incubados durante a noite, inocular a colônia em 3 mL contendo 100 ampicilina μg/mL LB e cresce a 37 ° C durante a noite em uma coqueteleira. Manual do extrato de plasmídeo da bactéria durante a noite-cultivadas usando o plasmídeo prep mini kit seguindo o fabricante (ver Tabela de materiais).
    8. Tela da colônia positiva por PCR ou restrição de digestão.
    9. Sequência verificar a região do doador HDR do plasmídeo final. Salve um estoque bacteriano transformado com os clones corretos em glicerol 20% a-80 ° C para inoculação de futura.

3. embrião injeção, mosca genética e rastreio para edição de genoma

  1. Preparar a alta vector de expressão livre de endotoxinas gRNA pureza, bem como o plasmídeo de doador HDR usando um plasmídeo maxiprep kit (veja a Tabela de materiais).
  2. Co injete o plasmídeo de expressão gRNA (100 ng/μL) e o doador de reposição (500 ng/μL) do germline de N º s-Cas9 embriões6. Nota: nós usamos um serviço comercial para a injeção, mas este procedimento pode ser realizado em laboratório também.
  3. Voe, genética e rastreio (Figura 2 e Figura 3):
    1. Quando os embriões injetados desenvolvem-se em adultos, cruz cada único G0 voa para balanceador moscas. Selecione o balanceador apropriado para o cromossomo contendo o alelo alvo.
    2. Anestesia o F1 descendentes de cada G0 cruzam sobre uma almofada de2 CO e escolher aleatoriamente 10-20 machos sob um estereomicroscópio. Cruzá-los individualmente para as fêmeas de balanceador conforme mostrado na Figura 3.
    3. Quando a escotilha de larvas de F2, escolher o único pai de F1 de cada cruzamento e extrair gDNA usando o única mosca genomic DNA preparação protocolo:
      1. Preparar gDNA solução tampão: pH 10 mM Tris-Cl 8.2, 1 mM EDTA, 25 mM de NaCl, armazenar em temperatura ambiente. Prepare-se 20 mg/mL solução de Proteinase K e guarde no congelador.
      2. Coloque cada mosca em um tubo de microcentrífuga de 1,5 mL e rótulo do tubo. Manter em freezer a-80 ° C durante a noite.
      3. Preparar um volume de trabalho fresca de gDNA solução tampão contendo a concentração final de 200 µ g/mL de Proteinase K.
        Nota: Não utilize um buffer antigo para esta etapa.
      4. Espremer cada mosca para 10-15 s com uma ponta de pipeta contendo 50 μL de esmagar o tampão sem dispensar o líquido. Dispense o buffer restante no tubo e misture bem. Incube a 37 ° C, durante 20 a 30 min.
      5. Colocar os tubos no bloco de calor 95 ° C por 1 – 2 min inactivar a Proteinase K.
      6. Spin para baixo por 5 min a 10.000 x g. Armazene a preparação em 4 ° C para posterior análise PCR.
  4. Use o mesmo método para preparar gDNA de uma mosca de N º s-Cas9 , que serve como um controle negativo. Executar telas PCR com base em três etapas para identificar o corretas "extremidades fora" HDR (Figura 2, Figura 5) usando gDNA de cada macho F1 como um modelo5. Use 1 μL da preparação do DNA no sistema de reação de PCR seguinte: 10 μL de 2x PCR Master Mix com tintura, 1 μL de cada primer (10 μM), 1 μL do molde do ADN e 7 μL de DDQ2O.
  5. Como mostrado na Figura 5A, realizar PCR utilizando primers fwd1 e rev1 a tela para a existência da inserção ou substituição; realizar PCR utilizando primers fwd2 e rev2 para verificar a inserção ou substituição de 3' região; Realize PCR utilizando primers M13F e rev3 para verificar "termina em" HDR (tabela 1).
  6. Manter as linhas de voar com o HDR de extremidades-fora confirmado e estabelecer ações equilibradas da geração F2. Outcross para as moscas balanceador novamente para remover quaisquer mutações não intencionais em outros cromossomos.
  7. Preparar gDNA de alta qualidade das existências estabelecidas para amplificar o PCR longo (> 800 – 1.000 nt) amplicon com polymerase de Taq de alta-fidelidade e totalmente sequência verificar os amplicons obtidos a partir das regiões genômicas engenharia. Como alternativa, usar extrato bruto gDNA conforme descrito anteriormente para amplificar mais curto (< 800 nt), sobreposição de produtos PCR para validar a sequência do genoma editado. Use o seguinte protocolo para preparar o DNA genômico de Drosophila de boa qualidade:
    1. Colocar cerca de 25 adultas moscas em um tubo de microcentrifugadora de 1,5 mL e congelar no freezer-20 ° C ou -80 ° C durante pelo menos 1 hora.
    2. Adicionar 250 μL da solução A (pH 9.0 Tris HCl 0,1 M, EDTA 0,1 M, SDS 1%).
    3. Homogeneizar as moscas usando os homogeneização macacos em tubos microcentrifuga e colocar o tubo no gelo.
    4. Incube a 70 ° C durante 30 min.
    5. Adicione 35 μL de KOAc (5 M), shake e misture bem, mas fazer não vórtice.
    6. Incube no gelo por 30 min.
    7. Girar a 12.000 x g por 15 min.
    8. Com uma micropipeta de 1 mL, cuidadosamente apenas o sobrenadante claro de transferência para um novo tubo, deixando voltar qualquer precipitado ou interfase.
    9. Adicione 150 μL de isopropanol para o sobrenadante. Misture suavemente por inversão.
    10. Girar a 10.000 x g por 5 min.
    11. Retire o sobrenadante cuidadosamente e deixar a pelota no tubo.
    12. Lavar o sedimento com 1 mL 70% EtOH.
    13. Girar a 12.000 x g por 5 min.
    14. Remova o sobrenadante. Ar seco a pelota por 15 a 20 min. Não seque a pelota.
    15. Dissolva a pelota em 100 μL de DDQ2O.
    16. Use alta fidelidade DNA polimerase apropriado para amplicon longo (> 800 bp) para amplificar a região completa editada. Idealmente, tome duas primeiras demão fora a fita inserida para amplificar a região genômica. Gel de purificar o produto do PCR, e conforme descrito anteriormente, a sequência verificar o produto com múltiplos primers sobrepostos.
  8. Valide os padrões de expressão spatiotemporal correto de embriões e tecidos dissecados das linhas projetadas voar:
    1. Execute o RT-PCR do RNA total para verificar a expressão do produto híbrido do mRNA (tabela 1).
    2. Execute uma hibridação in situ do produto do interesse em tecidos/embrião larval para validar a expressão do mRNA.
    3. A tela para os padrões de exata expressão spatiotemporal de tecido-específica entre as sequência-verificado linhas de extremidades-out, atravessar cada uma das linhas editadas obtidos para o driver de expressão binário com o seguir- GFP ou seguir- RFP (para LexA motorista) (disponível a partir dos centros de estoque Bloomington) de linha e observar o LexA ou Gal4 conduzido a expressão do gene repórter em tecidos de larvas e adultos de embrião, sob um microscópio de fluorescência.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Este protocolo foi utilizado com sucesso para gerar um alvo expressão binário repórter sistema específico para bnl expressando células5. O cis-elementos reguladores (CREs) que controlam a expressão complexa spatiotemporal bnl não são caracterizados. Portanto, para alcançar expressão spatiotemporal sob o controlo da sequência reguladora endógena bnl , somente o primeiro exon codificação do bnl foi projetado para ser substituído com a sequência da bacteriana LexA liberada. Uma gaveta de melhoria nls-LexA::p65 conhecida para proporcionar expressão ideal em Drosophila foi selecionada.

A estratégia de substituição visa gerar um quimérico nls-LexA:p65-bnl mRNA sob controle transcricional e pós-transcricional endógeno. Este RNAm quimérico continha uma intacta bnl 5' UTR, parte da extremidade 5' e 3' final do editado bnl codificação exon (primeiro exon) e a completa a jusante bnl intrões e exões. Para preservar o bnl específicas de RNA splicing o exon substituído, pequenas extremidades 5' e 3' do substituiu exon codificação foram retidas. No entanto impedir a síntese de uma proteína de Bnl quimérico fundido a nls -LexA: p65, um T2A Self chicotada sequência do peptide foi incorporada entre o residual 5' bnl codificação a região e o ATG de nls-LexA:p65. Além disso, um códon de parada de tradução foi adicionado após o nls-LexA:p65 sequência para evitar co tradução de truncado Bnl proteína5 (Figura 4 e Figura 5A).

Foi usado um doador de substituição contendo todas estas características, que tinha o T2A-nls-LexA:p65 sequência e 2 kb 5' e 3' com 1,8 kb - braços de homologia. Braços longos homologia foram usados para HDR eficiente e inserção de um fragmento de DNA grande no local do reparo (T2A-nls-LexA:p65 é 1,8 kb) (Figura 5A).

Dois gRNAs foram usados para criar DSBs nas posições definidas para excluir a maior parte do primeiro exon codificação do bnl. Foram dois gRNAs que correspondem a todos os critérios descritos na seção 1.3 (sequência de PAM sublinhada):
gRNA1: TGTATCTGCGATGCCCCTCATGG
gRNA2: ATCCTTCAGATATTGCGGGATGG

Ambos os sites de reconhecimento gRNA foram perturbados do dador de substituição pela exógena T2A-nls-LexA:p65 sequência, que é a maneira mais fácil de evitar redirecionamento do gRNAs para o locus de engenharia. As sequências de reconhecimento gRNA interrompidos no doador de reposição (as sequências exógenas que rompida gRNA sites de reconhecimento em itálico) foram:
gRNA1: TGTATCTGCG -GGCTCCGGCGAAGGAC...
gRNA2:... AAAAACTCGTTTAGA- CGGGATGG

O vetor de expressão de gRNA pCFD4 contendo estes gRNAs, juntamente com o doador de reposição, foi co injetado o germline de N º s-Cas9 embriões. Posteriormente, seguiu-se o protocolo descrito aqui a tela para a substituição pretendida (Figura 5B, C). Cerca de 67% dos animais de G0 injetados eram férteis. E 56% do G0s férteis foram os fundadores, que deu origem à descendência de HDR-positivo. Entre os descendentes de F1 verificado, cerca de 23% foram positivas para HDR bem sucedido, e 73% do HDR positivo fosse o "pontas" (tabela 2). Desde a primeira codificação exão da bnl foi "nocauteado", todas as linhas HDR foram encontradas para ser homozigoto letal e os estoques foram mantidos sobre balanceadores de.

A geração de um mRNA de LexA-bnl quimérico nas células foi validada por análises de RT-PCR (Figura 5). Para verificar se o obtidos bnl-LexA linhas foram expressas no padrão de expressão endógena bnl , cada linha HDR "saída de extremidades" foi cruzada para seguir-mCherryCAAX moscas transgênicas5e o padrão de expressão de repórter analisou-se a progênie embriões e larvas. 42 de 46 linhas mostraram exata expressão spatiotemporal consistente com os padrões anteriormente relatados bnl 5 (Figura 6). Quatro linhas mostraram ou padrões de expressão fraca ou não-específica. Podemos prever que estas linhas podem ter acumulado mutações, que precisamos verificar com análises de sequenciação completa. Juntos, estes resultados confirmaram que a estratégia de substituição do exon HDR-mediada pode ser empregada com sucesso para gerar um sistema de expressão binário direcionados para um gene. A ferramenta pode ser usada com sucesso para expressar repórter ou gravidez ectópica genes nos padrões spatiotemporal do gene do bnl .

Figure 1
Figura 1: esquema de um sistema binário de transcrição para a expressão do gene alvo. Uma liberada (GAL4 ou LexA), expressada sob o controle do cis-elementos reguladores (CREs) de um gene, dirige um transgene effector colocado a jusante dos sites de vinculação específica de transcrição (UAS para Gal4 ou LexAop para LexA). Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: uma visão geral do fluxo de trabalho para genoma CRISPR/Cas9-mediada de edição para gerar um sistema binário transcrição. A duração de tempo aproximado necessária para cada etapa é indicada. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: ilustração do CRISPR triagem e genética Cruz esquema para estabelecer linhas de voar genoma-edição. Em cruzamentos genéticos, R representa o alelo editado que é no cromossomo 3rd . MKRS (MRS Tp (3; 3), M (3) 76A ry de kar [1] [1] [2] Sb [1]), é um marcador do cromossomo 3rd ; TM6B (Em TM6B (3LR), Antp [Hu] e [1] Tb[1]) é um equilibrador do cromossoma 3rd . Estoques de mosca genoma editado são verificadas pelo PCR amplificando as regiões alvo de interesse de DNA genômico extraído de moscas de geração F2 ou F3 e sequência determinar os produtos PCR. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: geração da gaveta de substituição pela Assembleia DNA. Um desenho esquemático mostrando amplificação por PCR e montagem de diferentes produtos PCR (a, b e c) para o vetor do doador (d) usando um método de montagem de DNA. Clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5: Geração de bnl-LexA pela substituição de exon CRISPR/Cas9-mediada. (A) desenho retratando a estratégia do CRISPR/Cas9 esquemático mediada HDR para substituição do exon no locus do bnl . Caixa - exão; linha-intron; doador de substituição (pDonor -bnl:LexA) e dois possíveis resultados do HDR foram mostrados. O pDonor -bnl:LexA tinha as seguintes características: (1)T2A-nls-LexA:p65 (~1.8kb) sequência ladeado por 2 kb e 1,8 kb tempo homologia braços (linhas tracejadas), (2) um peptídeo Self chicotado T2A entre o exon de terminal bnl N residual e o NLS-LexA:p65e (3) um códon de parada de tradução (vermelho *) após o nls-LexA:p65 sequência. O produto HDR reteve todo o controle transcricional e pós-transcricional da bnle a LexA: p65 proteína é esperada para ser produzido no mesmo padrão como setas endógenas do Bnl. Small preto mostram os locais de ligação relativo (não em escala) dos primers PCR (tabela 1) utilizados para triagem de 3 etapas ou validação de RT-PCR. (B) fotos de gel de Agarose mostrando resultados da análise passo 3-PCR. Produtos PCR amplificados a partir do DNA genômico de quatro linhas HDR de extremidades-out bem sucedidas são mostrados; controle, o DNA genômico de n º snegativo-Cas9 linha parental; controlo positivo, pDonor -bnl:LexA do plasmídeo; M, marcador (escada de DNA SL2K). (C) um exemplo do rastreio gel mostrando o esperado produto PCR utilizando primers M13F e rev3 para extremidades em linhas; 7-M8 e M9-6 são duas extremidades-em linhas; controles positivos e negativos, o mesmo que B; M, marcador (NEB 1 kb escada de DNA). (D) análise de RT-PCR de RNA total de bnl-LexA e o controle de N º s-Cas9 voa. Cartilha frente vincula-se a uma região específica de LexA , primer reverso vincula-se a uma região de jusante bnl exão; ~ banda de amplificação 440 bp (pares de base) (*) foi detectado de RT-PCR na bnl-LexA mRNA, mas não do controle de RNA. M, 100 bp marcador (NEB). Adaptado de figuras 2 e S1 em Du et al. 20175. Clique aqui para ver uma versão maior desta figura.

Figure 6
Figura 6: Validação da expressão tecido-específica e condicional bnl-LexA em diferentes tecidos. (A-D) expressão de bnl (vermelho) em diferentes tecidos larvais, com o btl expressando células mostradas em verde. (A, A') Asa disco bnl fonte antes do primórdio sac de ar crescente (ASP). (B, C) expressão do BNL no TR5 transversal conjuntivo (TC) (B) e ramo dorsal TR2 (DB) (C). (D) expressão de bnl em discos genitais. (E-J) Expressão dinâmica bnl (vermelho) durante a padronização do ramo traqueal embrionário (verde); Pequenas setas, cinco fontes de bnl em torno do placode traqueal fase 10. Genótipos: A-J; btl-Gal4, UAS- CD8GFP / +; BNL-LexA, seguir- CherryCAAX /+. (K-L ") Hipoxiainduzida por perfil de expressão bnl-LexA em discos de asa e associados TR2 metamere traqueal (TC, DB, dorsal do tronco-DT). Genótipo: Bnl-LexA, seguir -CherryCAAX / +. (K) discos de controlo de ex vivo cultivadas órgãos sem um CoCl2. Discos de asa (L-L") (L, L') e da traqueia (DT, (L ')) do culto ex vivo de órgãos com um CoCl2 induzidas por hipóxia. Estrela, gravidez ectópica expressão induzida por hipóxia. Escala de barras = 30 µm; 50 µm (K-L"). Adaptado de Figura 3 em Du et al. 20175. Clique aqui para ver uma versão maior desta figura.

A. gRNA clonagem e sequenciamento
BNL-lexA gRNA fwd TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
BNL-lexA gRNA rev ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
EMcGACGTTAAATTGAAAATAGGTC
Cartilha de T3 usada para sequenciamento CAATTA ACCCTCACTAAAGG-3'
Nota: nucleotídeos sublinhados anneal U6 promotor ou gRNA core no vetor pCFD4, a minúscula g/c foi adicionado para auxiliar a transcrição de promotor-dependente U6
Construção do doador B. HDR
BNL N-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
BNL-lexA-N-R tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
C
lexA-F CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
lexA-R CTAAACGAGTTTTTAAGCAAACTCACTC
BNL lexA-C Fwd TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
BNL C-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
Nota: nucleotídeos na capital sobreposição com vetor de pUC19 para montagem de Gibson, nucleotídeos sublinhados foram saliência de sequência para adição de peptídeo T2A.
C. sequenciamento e rastreio de HDR
BNL-lexA scr fwd1 GTGGCGCACGCCCAATAAAC
BNL-lexA scr rev1 GATCCCAGCCAATCTCCGTTG
BNL-lexA scr fwd2 CAACGGAGATTGGCTGGGATC
BNL-lexA scr rev2 CTGGCCAACTGTAGGGAAGTC
extremidades-em cheque rev3 GCAATGTTATGCAATGCGTTGAC
BNL-lexA seq fwd3 CACTTGTCGCCCATATTGATACAATTG
Nota: Estas primeiras demão foram usada para o PCR do rastreio e sequenciamento, as localizações aproximadas dos sítios de ligação da primeira demão são mostradas na figura 5A como fwd1-2 e 3-rev1.
M. análise de RT-PCR de
RT-f GATATGGATTTCTCCGCTTTGCTG
RT-r CCATGCAGAGATACAGGCAAGTG

Tabela 1: Primers utilizados neste estudo. (A) Primers para vetor de expressão gRNA de clonagem e sequenciamento. (B) Primers para clonagem modelo doador HDR. (C) Primers para triagem e sequenciamento dos produtos HDR. (D) Primers utilizados para verificação de RT-PCR, o produto de RNAm quimérico LexA-bnl .

genótipo % De taxa de transmissão de HDR (# HDR-rendendo G0 / # fértil G0) # HDR-positivo F1 / # F1 total verificado (%) # "saída de extremidades" HDR / # HDR total (%)
BNL-LexA 56 (15/27) 23 (60/259) 73 (46/60)

Tabela 2: A eficiência de HDR CRISPR/Cas9-mediada. A taxa de transmissão de HDR é calculada como o # de HDR-rendendo G0 / # of total G0 fértil. Sucesso % HDR é calculado como o # de HDR-positivo F1 / # de F1 total exibido. % De "Saída de extremidades" é calculado como o n º de "saída de extremidades" HDR / # of total positivo HDR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Tradicionalmente, as armadilhas potenciador de Drosophila foram geradas por dois métodos diferentes. Uma das maneiras inclui inserção aleatória de um driver (eg., Gal4) sequência no genoma por transposição (EG., transposição de P-elemento)1 . Alternativamente, as sequências de motorista podem ser colocadas sob o controle transcricional de uma região de putativo realçador/promotor em uma construção do plasmídeo, que iria então ser integrada em um site de gravidez ectópica do genoma3,11. Embora esses métodos têm gerado uma grande piscina de Gal4 ou armadilhas de potenciador de LexA para drosófila, eles têm várias limitações. A inserção aleatória no genoma, P-elemento-mediado pode interromper a actividade regulamentar de crítica cis-sequências reguladoras. Devido a transposição aleatória no genoma, expressão liberada pode relatar padrões de múltiplos genes vizinhos. Por outro lado, um conhecimento prévio das sequências cis-reguladora de um gene é necessário para uma construção de plasmídeo potenciador-armadilha. Há também um limite para o comprimento de uma sequência que pode ser clonada e testado em uma construção de plasmídeo. Isolamento e clonagem apenas um fragmento parcial de DNA fora do contexto genômico endógeno podem não ser reproduzido um padrões de expressão completa do gene-específico. Por exemplo, a linha de bnl-Gal4 (NP2211), que foi gerada por inserção de P-elemento de uma armadilha de realçador Gal4 elemento à frente do gene da bnl , completamente não reproduz os padrões de expressão de gene-específico no embrião5 . Portanto, em tais contextos, as técnicas de redefinição de objetivos, tais como HACK (homologia assistida CRISPR bater-em), que pode converter a Gal4 existentes linhas em outra LexA ou Q-sistema baseado motorista linha12 pode não ser muito útil. Para superar essas limitações, aqui, nós descrevemos um método alternativo e eficiente para a geração de sistemas de expressão binário editando genoma. Neste método, o primeiro exon codificação de um gene é trocado com a liberada (eg., LexA ou Gal4) sequência de modo que a expressão do driver transcrição exclusivamente imita os padrões spatiotemporal da expressão do gene. Embora a estratégia e os protocolos descritos aqui foram otimizados para bnl -expressão, o método facilmente pode ser adotado por outros genes.

Determinar um local de inserção dentro da região do gene alvo é o passo mais crítico nesta estratégia experimental. O método que apresentamos foi projetado para reter todo o original transcricional, bem como os regulamentos pós-transcricional do bnl gene5. Portanto, planejamos excluir a maior parte do primeiro exon codificação do gene da bnl e substituí-lo com a gaveta de LexA . A substituição foi planejada de forma a que o alelo editado expressa um híbrido LexA-bnl mRNA do endógeno da transcrição e tradução iniciar site da bnl , mantendo todas as regiões intrônicas. No entanto, o híbrido mRNA foi projetada para produzir única LexA proteína, mas não o Bnl. Nós mostramos que a estratégia com sucesso tinha gerado um bnl-LexA /seguir-com base em sistema de transcrição, e que o sistema com precisão pode relatar os padrões de expressão dinâmica, spatiotemporal bnl (Figura 5),5 . Uma limitação deste processo é a letalidade homozigota nas linhas de drosófila se o gene alvo é essencial para a sobrevivência. Além disso, o uso de uma estratégia dupla gRNA pode aumentar a chance de edição fora do alvo. Uma estratégia alternativa pode ser empregada para evitar estes problemas. Nesta estratégia, pode ser colocada uma fita LexA ou Gal4 direito no site ATG início do gene da substituído e um T2A Self chicotada sequência peptídica pode ser colocada entre a gaveta de LexA/Gal4 e o início do exon intacto e codificação de o gene alvo. Esta estratégia deverá produzir um RNAm quimérico que pode ser traduzido em ambos o transctivator e o produto do gene funcional. Esse projeto poderia, possivelmente, reduzir a chance de letalidade homozigota. Nesta estratégia, uma gRNA único é suficiente para edição de genoma. No entanto, na presença de duas cópias de genes funcionais, expressão das variantes da proteína transgénica conduzido pelo condutor Gal4/LexA (eg., bnl-LexA conduzido a expressão de seguir- Bnl: GFP fusões ou Bnl proteínas com exclusões) não fornecerá informações da funcionalidade das proteínas de variante.

Uma limitação da estratégia da edição de genoma é o laborioso processo de segmentação e edição de um único gene de cada vez. No entanto, a simplicidade e a eficiência do método de edição de genoma CRISPR/Cas9-mediada revolucionaram o alvo genômico bater-em/knock-out e tecnologia de substituição que pode ser facilmente adotada em qualquer laboratório padrão configurado. Nos últimos anos, pesquisadores de Drosophila desenvolveram conveniente kits de ferramentas para edição de genoma que podem ser empregadas para expandir os conjuntos de ferramentas genéticos essenciais para a compreensão fundamental biológico processa7,13 . O genoma de edição e seleção de processos descritos aqui é relativamente mais rápido e leva cerca de dois meses, em comparação com qualquer outra substituição homóloga recombinação-baseado. Para resultados genoma-edição bem sucedidos e eficientes, é importante seguir vários passos tecnicamente críticos: 1) cada gRNA é selecionado pelo máximo rigor e atividade sem potencial fora do alvo; 2) o doador HDR contém ~1.5 kb homologia armas flanqueando a gRNA em sítios. Braços compridos de homologia (1.8-2 kb) são usados para aumentar a eficiência do HDR quando um fragmento de DNA exógeno grande precisa ser inserido; 3) o doador HDR é projetado para ser livre de sites de reconhecimento a gRNA para evitar redirecionamento da gRNA para o locus de engenharia; e 4) um plano infalível e coordenação do calendário de cruzamentos genéticos com 3 passos baseados em PCR triagem para selecionar uma linha HDR "extremidades-para fora".

Ao contrário de transposição aleatória ou clonado potenciador construções, a estratégia e os protocolos que descrevemos aqui assegura a geração de um alvo exclusivamente sistema binário transcrição de gene-específico. Desde que a expressão do driver substitui um exon do gene nativo, expressão de gene-específico do driver também é versátil e é esperado para imitar os padrões de expressão de gene sob todas as condições de desenvolvimento, metabólicos e fisiológicos5. Expressão de gene/célula-específico é os critérios mais desejáveis de todas as linhas de driver binário quando eles são usados em várias células e métodos de biologia do desenvolvimento. Por exemplo, o gene-específico expressão de genes repórter por um motorista de transcrição facilita análises de linhagem confiável das células expressando o gene alvo. Ele também permite ao vivo de imagem e rastreamento da expressão spatiotemporal, migração e reorganização das células durante o desenvolvimento. Para investigar os eventos celulares e moleculares durante a morfogênese de tecido, Gal4 ou LexA conduzido superexpressão/misexpression de vários transgenes e mediada por RNAi gene knock-down em conjuntos específicos de células são essenciais. Sistema de expressão alvo altamente específica fornece um imparcial análise e interpretação dos resultados. Portanto, baseado em CRISPR/Cas9 direcionamento de um exão do gene e sua substituição por uma sequência de liberada fornece uma alternativa melhor para a geração de sistemas de expressão do gene alvo altamente específico.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores têm sem conflitos de interesse a divulgar.

Acknowledgments

Agradecemos o Dr. F. Porto, Dr. K. o ' Connor-Giles e Dr. S. Feng para discussões sobre estratégia CRISPR; Dr. T.B. Kornberg e o centro de estoque de Bloomington para reagentes; Instalação de núcleo de imagens de UMD; e financiamento do NIH: R00HL114867 e R35GM124878 ao Sr.

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics