Une stratégie efficace pour générer des systèmes de Transcription binaire spécifique des tissus chez la drosophile par modification du génome

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Nous présentons ici une méthode pour générer des systèmes de transcription binaire spécifique des tissus chez la drosophile en remplaçant le premier exon codante des gènes avec les pilotes de la transcription. La méthode CRISPR/Cas9 met une séquence transactivateur en vertu du règlement endogène d’un gène remplacé et par conséquent facilite transctivator expression exclusivement dans des modèles spatio-temporels de gène-spécifique.

Cite this Article

Copy Citation | Download Citations

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Systèmes de transcription binaires sont de puissants outils génétiques, largement utilisés pour visualiser et manipuler des cellules sort et l’expression génétique dans des groupes spécifiques de cellules ou tissus chez les organismes modèles. Ces systèmes contiennent deux composantes dans des lignes distinctes de transgéniques. Une ligne pilote exprime un activateur de la transcription sous le contrôle des promoteurs/exhausteurs de tissu-spécifiques et un ports de ligne journaliste/effecteur un gène cible placé en aval du site de liaison de l’activateur de transcription. Animaux hébergeant les deux composants induire la transactivation de tissu-spécifique d’une expression du gène cible. Expression spatio-temporelle précise du gène dans les tissus ciblés est critique pour l’interprétation impartiale de l’activité cellulaire/génétique. Par conséquent, l’élaboration d’une méthode pour générer les lignes exclusives spécifiques des cellules/tissus conducteur est essentiel. Nous présentons une méthode pour générer le système hautement spécifique aux tissus expression ciblée en employant un « groupés régulièrement Interspaced Short palindromique Repeat/CRISPR-associés » (CRISPR/AR)-base de génome édition technique. Dans cette méthode, l’endonucléase Cas9 est ciblé par deux chimérique guide RNAs (gRNA) à des sites spécifiques dans le premier exon codante d’un gène dans le génome de la drosophile pour créer des cassures double-brin (DSB). Par la suite, les mécanismes de réparation cellulaire autonome à l’aide d’un plasmide de donneurs exogènes qui contient la séquence de transactivateur, permet réparation axés sur l’homologie (HDR) de l’ORD, ayant pour résultat précise suppression et le remplacement de l’exon avec le transactivateur séquence. Le transactivateur frappé composant logiciel enfichable est exprimée exclusivement dans les cellules où le cis-éléments de régulation du gène remplacé sont fonctionnels. Le protocole étape par étape détaillé présenté ici pour générer un pilote binaire de transcriptional exprimé dans drosophile fgf/sans branches-produisant des cellules épithéliales/neuronales peut être adoptée pour n’importe quelle expression de gène - ou tissu-spécifique.

Introduction

La boîte à outils génétique pour l’expression des gènes ciblés a été bien développé chez la drosophile, ce qui en fait l’un des meilleurs systèmes de modèle pour étudier la fonction des gènes impliqués dans une grande variété de processus cellulaires. Systèmes d’expression binaire, telles que la levure Gal4/UAS (séquence activatrice en amont), a été adopté pour les études de piégeage et gène exhausteur de tissu-spécifiques dans la drosophile modèle génétique1 (Figure 1). Ce système a facilité l’élaboration d’un grand nombre de techniques telles que le règlement spatio-temporelle de la surexpression du gène, études, knockout dans certains groupes de cellules ainsi que dans l’ablation de la cellule, marquage cellulaire, traçage direct du cellulaire et moléculaire processus en embryon et tissus, suivi de lignée et analyses de mosaïque au cours du développement. Un certain nombre de système de transcription binaires, tels que les bactéries LexA/LexAop système (Figure 1) et Q-système de Neurospora , sont de puissants outils génétiques qui sont maintenant largement utilisés chez la drosophile, en plus de le système de Gal4/UAS original pour l’expression de gène ciblé pour1,2,3.

Nous présentons ici une méthode pour générer le système très fiable expression binaire spécifique des tissus en employant une technique de modification du génome. Les progrès récents dans la technologie d’édition CRISPR/Cas9 génome ont permis des possibilités sans précédent apporter des modifications du génome dirigée dans un large éventail d’organismes. Par rapport aux autres techniques de modification du génome disponible, le système CRISPR/Cas9 est peu coûteux, efficace et fiable. Cette technologie utilise des composants du système immunitaire adaptatif bactérien : une endonucléase Cas9 de Streptococcus pyogenes qui crée une pause bicaténaires (DSB) et un ARN chimérique guide (gRNA), qui guide le Cas9 à un site particulier génome pour ORD ciblée4. Les cellules contiennent la machinerie pour réparer l’ORD en utilisant différentes voies. Fin non homologue rejoindre (NHEJ) conduit à petites insertions ou suppressions de perturber la fonction du gène, alors que la réparation axés sur l’homologie (HDR) introduit un défini réalisé/recherchées génomique dans/knock-knock-out par une donneuse HDR exogène en utilisant comme modèle. La stratégie de remplacement axés sur le HDR peut être efficacement utilisée pour générer un système hautement fiable expression binaire spécifique des tissus qui peut surmonter toutes les limites des méthodes traditionnelles enhancer trap. Nous décrivons une procédure pas à pas pour une utilisation de réparation de base CRISPR/Cas9 HDR dans la production d’une ligne pilote binaire de transcription qui s’exprime sous le contrôle d’endogène régulation transcriptionnelle et post-transcriptionnelle d’un Drosophila gène. Dans ce protocole, nous démontrons la génération d’une ligne pilote spécifique pour dépourvu de branches (bnl) gène codant pour une protéine de famille FGF qui réglemente la morphogenèse ramification de trachéale bronchique épithélium5. Dans cet exemple, le premier codage exon du gène bnl a été remplacé par l’enchaînement d’une séquence de transactivateur LexA bactérienne sans altérer toute endogène cis-séquences régulatrices du gène bnl . Nous montrons que la stratégie a généré une ligne pilote de bnl-LexA spatio-temporelle contrôle l’expression d’un gène rapporteur placé en aval de LexAoperator (LexAop ou LexO) exclusivement dans bnl- cellules épithéliales/mésenchymateuses/neuronales exprimant.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. concevoir et construire le gRNA vecteur d’Expression

  1. Pour justement remplacer une région bien définie d’un exon, utilisez un gRNA double approche6, dans lequel chaque gRNA peut cibler spécifiquement les deux extrémités de la région sélectionnée d’intérêt. Pour obtenir une expression spatio-temporelle précise de gène-spécifique du pilote, sélectionnez deux sites de cibles gRNA dans le premier exon codante du gène.
  2. Pour Drosophila melanogaster, sélectionnez les sites cibles gRNA à l’aide de l’outil de recherche de cible optimale de le flyCRISPR (http://tools.flycrispr.molbio.wisc.edu/targetFinder/). Autres outils de conception CRISPR disponibles peuvent être utilisés aussi bien, y compris l’outil optimisé CRISPR Design (http://crispr.mit.edu), FlyCas9 (https://shigen.nig.ac.jp/fly/nigfly/cas9) et E-CRISP (www.e-crisp.org/E-CRISP).
    NOTE : Les protocoles suivants de conception gRNA et le clonage a été adopté des méthodes décrites précédemment6,7.
    1. Copier la séquence réelle dans la case prévue dans l’outil en ligne. Sélectionnez la plus récente Drosophila melanogaster génome annotation version, « r_6, » dans le menu déroulant « Select génome. » Dans la champ « Select guide longueur (nt), » entrée « 20 ». Sélectionnez cette option pour trouver « Toutes les cibles CRISPR » et cliquez sur « Trouver CRISPR cibles ».
    2. Évaluer toutes les cibles de gRNA candidat en définissant « Maximum » pour la « Rigueur » et « NGG Only » pour « PAM ». Essayez de sélectionner les sites gRNA sans aucun hors-cibles potentielles ou un nombre minimum de possible hors-cibles. Utilisation de l’outil web décrit dans Doench al 2014 8 pour sélectionner gRNAs avec un score de « bonne » activité potentielle.
    3. En même temps, s’assurer qu’il n’y a aucun polymorphisme simple nucléotide dans les cibles gRNA dans le génome de la ligne mouche parent sélectionné pour injection (Par exemple, amendements-Cas9 sur le chromosome X, BL # 54591). Suivez le protocole décrit à Gratz et coll. 20157 pour extraire l’ADN génomique de la ligne mouche parent. PCR amplification, approximativement, les régions de nt 500 – 1 000 en utilisant des amorces qui flanquent la séquence d’intérêt et une polymérase d’ADN de haute fidélité ; séquence-vérifier les produits PCR amplifié.
  3. Pour générer un vecteur d’expression gRNA tandem, suivre une ligature indépendante clonage Protocole6 pour introduire deux séquences de protospacer dans un vecteur d’expression de RNA pCFD4. Notez qu’un vecteur d’expression multi-gRNA améliorée (pCFD5) est maintenant disponible dans laquelle les deux sgRNAs sont exprimés de la forte U6:3 promoteurs9 (https://www.crisprflydesign.org). Utiliser une méthode d’assemblage de l’ADN à cloner le gRNAs dans le vecteur pCFD4.
    1. Concevoir et de commander les amorces avant et arrière pour introduire deux séquences de protospacer dans le RNA expression vector pCFD4 (tableau 1). Comme décrit précédemment6, l’apprêt avant contient la première séquence de protospacer flanquée de régions dont le promoteur U6-1 et gRNA core dans pCFD4 ; l’apprêt inversée contient la séquence inverse de complément de la deuxième protospacer flanquée de régions correspondant au noyau gRNA et promoteur U6-3 en pCDF4.
    2. Remettre en suspension les amorces à 100 μM et DNase et RNase sans eau bidistillée (ddH2O). Faire une amorce de concentration 10 μM travail. Utilisez le plasmide pCFD4 comme modèle et mettre en place une réaction de PCR utilisant une polymérase de haute fidélité et paramètres pour PCR réaction6recommandés.
    3. Pour cloner le produit amplifié dans pCFD4, digérer le plasmide pCFD4 avec enzyme BbsI en mettant en place la réaction suivante : 2 – 5 μg de plasmide pCFD4, 5 μL de digestion mémoire tampon 10 x, 1 μL de BbsI enzyme et FD2O pour porter le volume final à 50 μL. Mélanger le contenu de la réaction par doucement tapant le tube et collecte toutes les gouttelettes dispersées de la paroi du tube au fond d’un essorage bref. Incuber le mélange réactionnel à 37 ° C pendant 2 h.
    4. Faire fonctionner l’appareil PCR à l’étape 2 et le produit digéré de l’étape 3 sur un gel d’agarose à 1 %. Effectuer l’électrophorèse pour assez de temps pour séparer complètement les bandes d’ADN. Couper à la bonne taille des bandes d’ADN sous un UV trans-illuminateur avant de purifier les produits attendus à l’aide de la colonne élution de gel suivant les instructions du fabricant (voir Table des matières). Le produit PCR devrait être 600 bp et le plasmide linéarisé pCFD4 devraient être ~6.4 Ko 6.
    5. Mettre en place la réaction de l’Assemblée de l’ADN dans un tube PCR, par les instructions du fabricant (voir Table des matières).
    6. Transformer 2 μl du produit Assemblée des bactéries compétentes (DH5α ou des souches similaires avec ΔrecA1, Δ,endA1), plaque d’identification sur l’ampicilline (100 μg/mL) contenant des plaques de gélose LB (LB/Amp) et incuber à 37 ° C pendant la nuit. Notez que le mélange de l’Assemblée de l’ADN peut être toxique pour certaines souches de bactéries, mais diluer le mélange de l’Assemblée peut réduire la toxicité.
    7. Choisir des colonies résistantes à l’ampicilline 3 et 4 de la plaque incubés pendant la nuit, inoculer la colonie dans 3 mL LB contenant 100 ampicilline μg/mL et cultiver des bactéries inoculées dans un shaker de 37 ° C pendant la nuit. Extrait de plasmide de bactéries cultivées pendant la nuit en utilisant le kit de mini-préparent de plasmide suivant les instructions du fabricant (voir Table des matières).
    8. Les plasmides avec T3 amorce universelle pour dépister les clones corrects contenant la tandem gRNA insertion de séquences. Mettre en place un stock de glycérol de bactéries transformées avec une séquence-vérifié pCFD4-gRNA dans 20 % de glycérol et de stocker dans un congélateur à-80 ° C pour une utilisation future.

2. concevoir et construire le donateur HDR

  1. Pour génomique knock-in d’une séquence de Gal4 ou LexA , concevoir un donneur HDR double brin qui contient la séquence de transactivateur flanquée de deux bras de l’homologie.
    1. Utilisation > 1,5 Ko gauche et bras droit d’homologie flanquant le ciblage gRNA site (s). Bras étendus homologie accroître l’efficacité de HDR durant le processus de réparation 10.
    2. PCR amplifier les bras d’homologie de l’ADN génomique (ADNg) extrait de la ligne mouche parent sélectionnée pour injection (Par exemple, amendements-Cas9 (sur le chromosome X), BL # 54591). Utiliser une relecture hot-start Taq ADN polymérase enzyme adapté aux longues extension de PCR (voir Table des matières). Séquence-vérifier.
  2. Pour éviter de reciblage de la gRNA au locus machiné, concevoir le donateur de remplacement de telle manière que les sites de reconnaissance gRNA soient perturbés par la séquence exogène introduite.
    Remarque : pour éviter d’altérer les éléments cis-régulateurs putatifs, toujours choisir les sites de reconnaissance gRNA au sein de la région codante de l’exon.
  3. Pour générer une cassette de remplacement, planifier la stratégie de l’Assemblée de l’ADN pour réunir les quatre segments : les bras d’homologie 5' et 3', la séquence d’ADN intermédiaire transactivateur exogènes et le clonage linéarisé vecteur colonne vertébrale (par exemple, pUC19 ou autre couramment utilisé la clonage vecteurs). Suivant les directives du fabricant pour l’assemblage de l’ADN (voir Table des matières), concevoir les amorces convenables pour l’amplification PCR et l’assemblage de chaque segment. Remettre en suspension les amorces à 100 μM avec FD2O. faire une amorce de concentration 10 μM travail. Utilisez haute fidélité polymérase pour toutes les réactions de PCR. Suivre le protocole suivant :
    1. PCR amplifier une cassette d’expression de Gal4 ou LexA de vecteur disponible (par exemple, nls-LexA:p65; les plasmides d’expression de Gal4/LexA/QF2 idéales peuvent être trouvés et obtenus à partir des ressources communes telles que Addgene) à l’aide de la amorces répertoriés dans le tableau 1 b.
      1. Pour conserver tous les règlements transcriptionnelles et post-transcriptionnelle originales de l’exon remplacé sur l’expression de la séquence d’ADN transactivateur, concevoir la cassette de telle manière que l’allèle génomique édité exprimerait un ARNm chimérique de la transactivateur et le gène. Préserver l’extrémité 5' et 3' de l’exon ciblée de conserver tout signal d’épissage.
      2. Incorporer une séquence de peptide de T2A un clivage entre les résidus de 5' codage exon et la séquence de transactivateur pour empêcher la traduction en protéine chimérique. Ajouter un codon d’arrêt traduction après la séquence exogène transactivateur (Figure 5).
    2. PCR amplifier les bras d’homologie de l’ADN génomique (ADNg) extrait de la ligne mouche parent sélectionnée pour injection (Par exemple, amendements-Cas9 (sur le chromosome X), BL # 54591) avec les amorces qui figurent dans le tableau 1 b. Utiliser la polymérase haute fidélité pour toutes les réactions de PCR utilisant les systèmes comme suit : 5 μL de 5 x tampon de réaction, 0,5 μL des dNTPs 10 mM, 1.25 μL de 10 μM Forward Primer, 1,25 μL de 10 μM Reverse Primer, 0,5 μL de modèle ADN, 0,25 μL de haute fidélité ADN polymérase , 16.25 μL de ddH2O.
    3. Utiliser le vecteur linéarisé de clonage tel que pUC19. Un certain nombre de vecteurs de donateurs est maintenant disponible. Voir la liste complète sur le site suivant-http://flycrispr.molbio.wisc.edu.
    4. Exécuter les produits PCR sur un gel d’agarose à 1 %. Effectuer l’électrophorèse pour assez de temps pour assurer une séparation claire de la bande souhaitée des bandes indésirables non spécifique (le cas échéant). Gel-purifier les fragments d’ADN attendues. Mesurer la concentration de chaque fragment d’ADN purifié à l’aide d’un spectrophotomètre.
    5. Mettre en place la réaction de l’Assemblée d’ADN suivant les instructions du fabricant. Mélanger les fragments clonage linéarisés de vecteur et cible de l’étape 3 et l’étape 4 dans la réaction suivante : 1 μL de linéaire clonage vector (50 ng/μl), 2 – 3 fois excès de chaque fragment de la cible, 10 μL de 2 x mélange principal d’ADN Assemblée, porter le volume réactionnel final à 20 μL avec ddH < C21 > 2O. Incuber le mélange pendant 1 heure à 50 ° C.
    6. Transformer 2 μl du produit Assemblée en bactéries compétentes, plaque sur plaques de gélose LB/Amp contenant 100 ampicilline μg/mL. En outre, ajouter X-Gal + IPTG sur la plaque pour le dépistage de bleu/blanc.
    7. Prélever des colonies blancs 3 et 4 de la plaque incubés pendant la nuit, inoculer la colonie dans 3 mL LB contenant 100 ampicilline μg/mL et grandir à 37 ° C durant la nuit dans un shaker. Manuel de l’extrait de plasmide de bactéries cultivées pendant la nuit en utilisant le kit de mini-préparent de plasmide suivant le fabricant (voir Table des matières).
    8. Écran la colonie positif par PCR ou la restriction de la digestion.
    9. Séquence de vérifier la région de donateurs HDR du plasmide final. Sauver un stock bactérien transformé avec les clones correctes en glycérol de 20 % à-80 ° C pour l’inoculation future.

3. embryon Injection, mouche de la génétique et le dépistage pour l’édition de génome

  1. Préparer le grand vecteur d’expression exempte d’endotoxine gRNA pureté ainsi que le plasmide de donateurs HDR à l’aide d’un plasmide maxiprep nécessaire (voir la Table des matières).
  2. Co, injecter le plasmide d’expression gRNA (100 ng/μL) et le donateur de remplacement (500 ng/μL) dans la lignée germinale des Amendements-Cas9 embryons6. Remarque : nous utilisons un service commercial pour l’injection, mais cette procédure peut être effectuée aussi bien en laboratoire.
  3. Mouche de la génétique et le dépistage (Figure 2 et Figure 3) :
    1. Lorsque les embryons injectées se développent en adultes, Croix chaque unique G0 vole à balancer les mouches. Sélectionnez équilibreur adapté pour le chromosome contenant l’allèle ciblée.
    2. Anesthésier la F1 progéniture de chaque G0 traverse sur un bloc de2 CO et choisir au hasard 10 à 20 hommes sous un stéréomicroscope. Les croix individuellement aux femelles équilibreur tel qu’illustré à la Figure 3.
    3. Quand l’éclosion de larves de F2, choisissez le père célibataire de F1 de chaque croisement et extrait ADNg en utilisant la mouche protocole ADN génomique unique préparation :
      1. Préparer le tampon d’extraction ADNg : pH 10 mM Tris-Cl 8.2, EDTA 1 mM, 25 mM NaCl, conserver à température ambiante. Préparer 20 mg/mL solution protéinase K et stocker dans le congélateur.
      2. Mettre chaque volée dans un tube à centrifuger-micro 1,5 mL et l’étiquette du tube. Garder au congélateur à-80 ° C durant la nuit.
      3. Préparer un volume de travail frais de tampon d’extraction ADNg contenant la concentration finale de 200 µg/mL de protéinase K.
        Remarque : N’utilisez pas un vieux tampon pour cette étape.
      4. Écraser chaque volée pour 10 à 15 s avec un embout de la pipette contenant 50 μL d’empiète sur le tampon sans distribuer le liquide. Diluer le tampon reste dans le tube et bien mélanger. Incuber à 37 ° C pendant 20 à 30 min.
      5. Mettre les tubes dans le bloc chauffant 95 ° C pendant 1 à 2 minutes inactiver la protéinase k
      6. Tournez vers le bas pendant 5 min à 10 000 x g. Stocker la préparation à 4 ° C pour une analyse ultérieure des PCR.
  4. Utiliser la même méthode pour préparer ADNg d’une mouche Amendements-Cas9 , qui sert de témoin négatif. Effectuer des écrans PCR selon trois étapes afin d’identifier le HDR (Figure 2, Figure 5) correct « finit par » utilisant ADNg de chaque mâle F1 comme un modèle de5. Utiliser 1 μL de la préparation de l’ADN dans le système de réaction PCR suivant : 10 μL de 2 x PCR Master Mix avec colorant, 1 μL de chaque amorce (10 μM), 1 μL de la matrice d’ADN et 7 μL de ddH2O.
  5. Comme le montre la Figure 5 a, effectuer des PCR avec des amorces fwd1 et rev1 à l’écran pour l’existence de l’insertion ou remplacement ; effectuer des PCR avec des amorces fwd2 et rev2 pour vérifier l’insertion ou remplacement de la région 3' ; effectuer le PCR avec des amorces M13F et rev3 pour vérifier « se termine en » HDR (tableau 1).
  6. Garder les lignes mouches avec le HDR extrémités-out confirmé et d’établir des stocks équilibrées de la génération F2. Croiser à le mouches équilibreur nouveau pour enlever toute mutations inattendues sur d’autres chromosomes.
  7. Préparer l’ADNg de haute qualité provenant des stocks établis d’amplification PCR longue (> 800-1 000 nt) amplicon avec haute fidélité Taq polymérase et entièrement la séquence vérifier les amplicons obtenus à partir des régions génomiques machinées. Également utiliser ADNg brut extrait comme décrit précédemment pour amplifier plus courte (< 800 nt), chevauchement des produits PCR pour séquence-valider le génome modifié. Le protocole suivant permet de préparer l’ADN génomique de drosophile de bonne qualité :
    1. Mettre environ 25 mouches adultes dans un tube de microtubes de 1,5 mL et gel dans le congélateur-20 ° C ou à-80 ° C pendant au moins 1 heure.
    2. Ajouter 250 μL de Solution A (pH 9,0 Tris HCl 0,1 M, EDTA 0,1 M, SDS 1 %).
    3. Homogénéiser les mouches à l’aide de l’homogénéisation pilons dans des microtubes à centrifuger et mettre le tube sur la glace.
    4. Incuber à 70 ° C pendant 30 min.
    5. Ajouter 35 μL de KACO (5 M), secouer et bien mélanger, mais ne pas vortexer.
    6. Incuber sur glace pendant 30 min.
    7. Tournant à 12 000 g pendant 15 min.
    8. Avec une micropipette de 1 mL, soigneusement transférer seulement le surnageant clair dans un nouveau tube, laissant retourner n’importe quel précipité ou interphase.
    9. Ajouter 150 μL d’isopropanol pour le surnageant. Mélanger doucement par inversion.
    10. Filer à 10 000 x g pendant 5 min.
    11. Avec précaution, retirez le surnageant et laisser le diabolo dans le tube.
    12. Laver le culot avec 1 mL 70 % EtOH.
    13. Tournant à 12 000 x g pendant 5 min.
    14. Retirez le surnageant. Sécher à l’air le culot pour 15 à 20 min. Ne pas sécher le culot.
    15. Dissoudre le culot dans 100 μl de ddH2O.
    16. Utilisez haute fidélité ADN polymérase adapté aux longues amplicon (> 800 bp) pour amplifier la région éditée complete. Idéalement, prenez deux amorces en dehors de la cassette insérée pour amplifier la région génomique. Gel de purifier le produit PCR, et comme décrit précédemment, la séquence vérifier le produit avec des amorces multiples qui se chevauchent.
  8. Valider les configurations d’expression spatio-temporelle correcte de tissus/embryons disséqués des lignes mouches ingénieries :
    1. Effectuer RT-PCR à partir de l’ARN total pour vérifier l’expression du produit ARNm hybride (tableau 1).
    2. Effectuer une hybridation in situ du produit de l’intérêt dans le tissus/embryon larvaire de valider l’expression ARNm.
    3. À l’écran pour les modèles précis expression spatio-temporelle spécifique des tissus parmi les lignes de sortie se termine séquence-vérifié, traverser chaque ligne modifiée obtenue pour le pilote d’expression binaire avec le LexO- GFP ou LexO- DP (pour LexA pilote) line (disponible auprès des centres de stock de Bloomington) et observez la LexA ou Gal4 conduit l’expression du gène rapporteur dans des tissus embryonnaires, larves et adultes sous un microscope à fluorescence.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Ce protocole a été utilisé avec succès pour générer une expression binaire ciblées journaliste système spécifique pour bnl exprimant les cellules5. Le cis-éléments de régulation (CREs) qui contrôlent l’expression spatio-temporelle complexe bnl ne sont pas caractérisés. Par conséquent, pour atteindre l’expression spatio-temporelle sous le contrôle de la séquence de réglementation endogène bnl , seulement le premier exon codage de bnl a été conçu doit être remplacé par la séquence de la transactivateur LexA bactérienne. Une cassette d’amélioration nls-LexA::p65 connue pour fournir une expression optimale chez la drosophile a été sélectionnée.

La stratégie de remplacement visant à générer une chimère nls-LexA:p65-bnl mRNA sous un contrôle transcriptionnel et post-transcriptionnelle endogène. Cet ARNm chimérique contenait un intact bnl 5' UTR, partie de l’extrémité 5' et l’extrémité 3' de l' édition bnl codage exon (premier exon) et le complète en aval bnl introns et exons. Afin de préserver l’épissage de bnl RNA spécifique de l’exon remplacé, petites extrémités 5' et 3' de l’exon codage remplacé ont été retenues. Toutefois, afin d’empêcher la synthèse d’une protéine chimérique de Bnl fusionnée à nls -LexA: p65, une T2A Self clivage séquence peptidique a été constituée entre le résiduel de 5' bnl région et l’ATG de codage nls-LexA:p65. En outre, un codon d’arrêt de traduction a été ajouté après la nls-LexA:p65 séquence d’éviter co traduction tronquée Bnl protéine5 (Figure 4 et Figure 5 a).

Un donneur de remplacement contenant toutes ces caractéristiques a été utilisé, qui avait la T2A-nls-LexA:p65 séquence et 2 kb en 5' - 1,8 kb en 3' - homologie d’armes. Homologie long armes ont été utilisées pour HDR efficace et l’insertion d’un grand fragment d’ADN sur le site de réparation (T2A-nls-LexA:p65 est de 1,8 kb) (Figure 5 a).

Deux gRNAs ont servi à créer la CDB aux positions définies à supprimer la plupart du premier exon codage de bnl. Deux gRNAs correspondant à tous les critères définis à l’article 1.3 (séquence du PAM a souligné) étaient les suivants :
gRNA1 : TGTATCTGCGATGCCCCTCATGG
gRNA2 : ATCCTTCAGATATTGCGGGATGG

Les deux sites de reconnaissance gRNA ont été perturbés chez le donneur de remplacement par le exogène T2A-nls-LexA:p65 séquence, qui est la meilleure façon d’éviter le reciblage du gRNAs au locus machiné. Les séquences de reconnaissance gRNA perturbé chez le donneur de remplacement (les séquences exogènes qui ont perturbé les sites de reconnaissance gRNA en italique) étaient :
gRNA1 : TGTATCTGCG -GGCTCCGGCGAAGGAC...
gRNA2 :... AAAAACTCGTTTAGA- CGGGATGG

Le vecteur d’expression gRNA pCFD4 contenant ces gRNAs, ainsi que le donateur de remplacement, a été conjointement injecté dans la lignée germinale des Amendements-Cas9 embryons. Par la suite, le protocole décrit ici a été suivi pour dépister le remplacement prévu (Figure 5 b, C). Environ 67 % des animaux de G0 injectées étaient fertiles. Et 56 % de la G0s fertiles étaient les fondateurs, qui ont donné lieu aux descendants du HDR-positif. Parmi la progéniture F1 vérifiée, environ 23 % étaient positifs pour HDR réussie, et 73 % de l’HDR positif étaient « extrémités-out » (tableau 2). Depuis le premier codage exon de bnl a été « assommé », toutes les canalisations de l’HDR trouvées homozygote létale et les stocks ont été maintenus sur les programmes d’équilibrage.

La génération d’un ARNm de LexA-bnl chimérique dans les cellules a été validée par des analyses de RT-PCR (Figure 5). Pour vérifier si la obtenu bnl-LexA lignes étaient exprimées dans le modèle d’expression endogène de bnl , chaque ligne HDR « extrémités-out » a été franchi au LexO-mCherryCAAX mouches transgéniques5et le modèle d’expression de journaliste a été examinée dans la progéniture embryons et des larves. 42 des 46 lignes a montré l’expression spatio-temporelle précise conformes à la rapportées antérieurement bnl modèles5 (Figure 6). Quatre lignes ont montré deux modèles d’expressions faibles ou non spécifiques. Nous prévoyons que ces lignes pourraient avoir accumulé des mutations, dont nous avons besoin de vérifier avec les analyses de séquençage complet. Ensemble, ces résultats confirment que la stratégie de remplacement HDR-mediated exon pourrait être utilisée avec succès pour générer un système d’expression binaire ciblées pour un gène. L’outil peut être utilisé avec succès pour exprimer des journaliste ou des gènes ectopiques dans les patrons spatio-temporels du gène bnl .

Figure 1
Figure 1 : schéma d’un système de transcription binaire pour l’expression des gènes ciblés. Un transactivateur (GAL4 ou LexA), exprimée sous le contrôle du cis-éléments régulateurs (CREs) d’un gène, conduit un transgène effecteur placé en aval des sites de liaison spécifiques de transcription (SAMU de Gal4 (ou LexAop pour LexA). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : un aperçu des flux de travail pour génome CRISPR/Cas9-mediated édition pour générer un système de transcription binaire. La durée de temps approximatif requise pour chaque étape est indiquée. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : illustration de la CRISPR dépistage et génétique Croix régime permettant d’établir des lignes mouches édités par génome. Dans les croisements génétiques, R représente l’allèle éditée qui se trouve sur le chromosome 3rd . MKRS (MRS Tp (3 ; 3), M (3) 76 a ry de kar [1] [1] [2] Sb [1]), est un marqueur de chromosome 3rd ; TM6B (En TM6B (3LR), Antp [en] [Hu] e [1] Tb[1]) est un équilibreur de chromosome 3rd . Stocks de voler sous la direction de génome sont vérifiées par PCR amplifiant les régions cibles d’intérêt de l’ADN génomique extrait de mouches de génération F2 ou F3 et séquence d’identifier les produits de PCR. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : génération de la cassette de remplacement par l’Assemblée de l’ADN. Un dessin schématique illustrant l’amplification par PCR et l’assemblage des différents produits PCR (a, b et c) dans le vecteur de donateurs (d) en utilisant une méthode d’assemblage de l’ADN. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : Génération de bnl-LexA par remplacement d’exon CRISPR/Cas9-médiée. (A) schéma illustrant la stratégie de la CRISPR/Cas9 médiée par HDR pour le remplacement de l’exon dans le locus de bnl . Boîte - exon ; ligne-intron ; donneur de remplacement (pDonor -bnl:LexA) et deux résultats possibles de l’HDR ont été présentés. Le pDonor -bnl:LexA a les caractéristiques suivantes : (1)T2A-nls-LexA:p65 (~1.8kb) séquence flanqué de 2 Ko et 1,8 Ko long bras de l’homologie (pointillés), (2) un peptide Self clivage T2A entre l’exon de terminal bnl N résiduel et la nls-LexA:p65et (3) un codon d’arrêt de translation (rouge *) après le nls-LexA:p65 séquence. Le produit HDR conservé tout le contrôle transcriptionnel et post-transcriptionnelle de bnlet la LexA: protéine p65 devrait être produit dans le même schéma qu’endogène Bnl. Small noir flèches indiquent les sites de liaison relatif (pas en l’échelle) des amorces PCR (tableau 1) utilisés pour le dépistage de 3 étapes ou validation de RT-PCR. (B) gel d’Agarose d’images montrant des résultats de la projection de PCR de 3 étapes. Produits PCR amplifiés à partir de l’ADN génomique de quatre lignes HDR réussies des extrémités-out sont indiquées ; témoin, l’ADN génomique de nosnégatif-Cas9 lignée parentale ; contrôle positif, pDonor -bnl:LexA de plasmide ; M, marqueur (échelle d’ADN de SL2K). (C) un exemple du gel projection montrant le produit attendu de la PCR en utilisant des amorces M13F et rev3 pour extrémités-en lignes ; 7-M8 et M9-6 sont les deux extrémités en lignes ; témoins négatifs et positifs, le même qu’en B ; M, marqueur (échelle d’ADN de NEB 1 Ko). (D) analyse de RT-PCR sur l’ARN total de bnl-LexA et le contrôle de nos-Cas9 vole. Primer avant se lie à une région spécifique de LexA , apprêt inverse se lie à une région d’exon en aval bnl ; ~ 440 bp (paires de bases) amplification bande (*) a été détectée de RT-PCR sur bnl-LexA ARNm, mais pas à partir du contrôle RNA. M, 100 bp marqueur (NEB). Adapté de Figures 2 et S1 en Du et al. 2017,5. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 6
Figure 6 : Validation de l’expression tissu-spécifique et conditionnelle bnl-LexA dans différents tissus. (A-D) d’expression de bnl (rouge) dans différents tissus larvaires, avec le btl exprimant des cellules en vert. (A, A') Aile disque bnl source devant le primordium de sac aérien croissant (ASP). (B, C) expression de BNL dans TR5 transversal conjonctif (TC) (B) et branche dorsale TR2 (DB) (C). (D) les expression de bnl en disques génitales. (E.-j.) Expression dynamique bnl (rouge) au cours de la structuration de la branche trachéale embryonnaire (vert) ; Petites flèches, cinq sources de bnl entourant la placode trachéale à l’étape 10. Génotypes : A-J ; BTL-Gal4, SAMU- CD8GFP / + ; bnl-LexA, LexO- CherryCAAX /+. (K-L ») Hypoxieinduite par le profil d’expression de bnl-LexA dans disques alaires et associés TR2 trachéale métamère (TC, DB, tronc dorsal-DT). Génotype : bnl-LexA, LexO -CherryCAAX / +. (K) disques de contrôle de ex vivo cultivé des organes sans CoCl2. Disques d’aile (L-L ») (L, L') et de la trachée (DT, (L'')) cultivées ex vivo des organes avec CoCl2 induit par l’hypoxie. Étoile, ectopique expression induite par l’hypoxie. Barreaux de l’échelle = 30 µm ; 50 µm (K-L »). Adapté de la Figure 3 dans Du et al. 2017,5. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

A. gRNA clonage et séquençage
BNL-lexA gRNA fwd TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
BNL-lexA gRNA rev ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
ÀcGACGTTAAATTGAAAATAGGTC
T3 apprêt utilisé pour le séquençage CAATTA ACCCTCACTAAAGG-3'
Remarque : nucléotides soulignés recuisent au promoteur U6 ou gRNA core sur pCFD4 vector, le minuscule g/c a été ajouté à U6 transcription de promoteur-dépendante de l’aide
Construction de donateurs HDR B.
BNL N-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
BNL-lexA-N-R tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
C
lexA-F CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
lexA-R CTAAACGAGTTTTTAAGCAAACTCACTC
BNL lexA-C Fwd TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
BNL C-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
Remarque : nucléotides capital chevauchement avec le vecteur pUC19 Gibson l’Assemblée, a souligné les nucléotides ont été surplomb de séquence pour l’ajout de peptide T2A.
C. séquençage et dépistage HDR
BNL-lexA scr fwd1 GTGGCGCACGCCCAATAAAC
BNL-lexA scr rev1 GATCCCAGCCAATCTCCGTTG
BNL-lexA scr fwd2 CAACGGAGATTGGCTGGGATC
BNL-lexA scr rev2 CTGGCCAACTGTAGGGAAGTC
extrémités-in check-rev3 GCAATGTTATGCAATGCGTTGAC
BNL-lexA seq fwd3 CACTTGTCGCCCATATTGATACAATTG
Remarque : Ces amorces ont été utilisées pour l’ACP de dépistage et de séquençage, l’emplacement approximatif des sites de liaison d’amorce est présentées dans la Figure 5 a fwd1-2 et 3-rev1.
D. analyse RT-PCR
RT-f GATATGGATTTCTCCGCTTTGCTG
RT-r CCATGCAGAGATACAGGCAAGTG

Tableau 1 : les amorces utilisées dans cette étude. (A) des amorces pour gRNA expression vecteur de clonage et séquençage. (B) des amorces pour le clonage modèle donneur HDR. (C) des amorces pour le dépistage et le séquençage des produits HDR. (D) amorces utilisées pour la vérification de la RT-PCR du produit ARNm LexA-bnl chimérique.

génotype Taux de transmission HDR % (rendement HDR G0 / # fertile G0 #) # HDR séropositifs F1 / # F1 total vérifié (%) sortie # « extrémités » HDR / # HDR total (%)
BNL-LexA 56 (15/27) 23 (60/259) 73 (46/60)

Tableau 2 : l’efficacité du HDR CRISPR/Cas9-mediated. Le taux de transmission de HDR est calculé comme le nombre de rendement HDR G0/Nbre de G0 fertile total. Succès HDR % est calculé comme le nombre de séropositifs au HDR F1/Nbre de F1 total projeté. « Extrémités-out » % est calculé comme le nombre d’extrémités « sortie » HDR/Nbre de HDR positif total.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Traditionnellement, pièges de renforceur de drosophile ont été générés par deux méthodes différentes. Une des façons comprend insertion aléatoire d’un conducteur (eg., Gal4) séquence du génome par transposition (e.g., transposition de l’élément P)1 . Par ailleurs, les séquences de conducteur peuvent être placés sous le contrôle transcriptionnel d’une région d’enhancer/promoteur présumé dans une construction de plasmide, qui serait ensuite intégrée dans un site ectopique du génome3,11. Bien que ces méthodes ont généré une grande piscine de Gal4 ou LexA enhancer pièges pour la drosophile, ils présentent plusieurs limites. L’insertion aléatoire véhiculée par P-élément dans le génome peut perturber l’activité réglementaire des critiques cis-séquences régulatrices. En raison de la transposition au hasard dans le génome, expression transactivateur peut-être déclarer des patrons de plusieurs gènes voisins. En revanche, une connaissance préalable des séquences cis-régulatrices d’un gène est nécessaire pour une construction de plasmide enhancer-piège. Il y a également une limite à la longueur d’une séquence qui peut être clonée et testée dans une construction de plasmide. Isoler et clonage qu’un fragment partiel de l’ADN hors du contexte génomique endogène ne peuvent pas reproduire un schémas complète expression de gène-spécifique. Par exemple, la ligne de bnl-Gal4 (NP2211), qui a été générée par l’insertion d’élément P d’un piège de renforceur Gal4 élément juste devant le gène de la bnl , ne reproduit pas complètement les patrons d’expression de gène-spécifique dans l’embryon5 . Par conséquent, en vertu de tels contextes, les techniques de Reengineering, tels que les HACK (homologie assistée CRISPR knock-in), que peut convertir la Gal4 existantes les lignes dans un autre LexA ou Q-système basé pilote ligne12 peut-être pas très utile. Pour surmonter ces limites, ici, nous avons décrit une méthode efficace et parallèles pour générer des systèmes d’expression binaire par modification du génome. Dans cette méthode, le premier exon codante d’un gène est échangé avec le transactivateur (eg., LexA ou Gal4) afin que l’expression du pilote transcription exclusivement imite les patrons spatio-temporelle de l’expression du gène de la séquence. Bien que la stratégie et les protocoles décrits ici ont été optimisées pour bnl -expression, la méthode peut facilement être adoptée pour d’autres gènes.

C’est l’étape la plus importante dans cette stratégie expérimentale de déterminer un site d’insertion au sein de la région du gène ciblé. La méthode que nous avons présenté a été conçue pour conserver tout l’original transcription ainsi que les règlements post-transcriptionnelle du gène bnl 5. Par conséquent, nous avions prévu de supprimer la plupart du premier codage exon du gène bnl et remplacez-la par la cassette de LexA . Le remplacement est prévu de telle sorte que l’allèle édité exprime un hybride LexA-bnl ARNm endogène transcription et traduction commencer site de bnl tout en conservant toutes les régions intronic. Toutefois, l’hybride à l’ARNm a été conçu pour produire seule protéine LexA , mais pas de Bnl. Nous avons montré que la stratégie avait généré avec succès un bnl-LexA /LexO-basé le système de transcription et que le système pourrait signaler avec précision les patrons d’expression dynamique, spatio-temporelle bnl (Figure 5),5 . Une limitation de ce processus est la létalité homozygote dans les lignes de la drosophile , si le gène ciblé est essentiel pour la survie. En outre, l’utilisation d’une stratégie double gRNA peut augmenter les chances de montage hors cible. Une autre stratégie peut être utilisée pour éviter ces problèmes. Dans cette stratégie, une cassette de LexA ou Gal4 peut être placée droit sur le site de départ ATG du gène remplacé et une T2A Self clivage séquence peptidique peut être placé entre la cassette LexA/Gal4 et le début de l’exon codage intact de le gène de la cible. Cette stratégie devrait produire un ARNm chimériques qui peut être traduit à la fois le transctivator et le produit du gène fonctionnelle. Une telle conception pourrait éventuellement réduire les risques de létalité homozygote. Dans cette stratégie, un gRNA seul est suffisant pour la modification du génome. Toutefois, en présence de deux copies des gènes fonctionnels, expression des variantes protéines transgéniques piloté par le pilote de Gal4/LexA (eg., bnl-LexA piloté par expression de LexO- Bnl : GFP fusions, ou protéines de Bnl avec délétions) ne fournira pas d’informations de la fonctionnalité des protéines variant.

Une limitation de la stratégie d’édition de génome est le laborieux processus de ciblage et de modification d’un gène unique à la fois. Cependant, la simplicité et l’efficacité de CRISPR/Cas9-mediated génome édition méthode ont révolutionné la ciblée génomique knock-in/knock-out et technologie de remplacement qui peut facilement être adoptée dans n’importe quel laboratoire standard mis en place. Dans ces dernières années, Drosophila chercheurs ont mis au point des boîtes à outils pratique pour l’édition de génome qui peuvent être utilisées pour étendre les ensembles d’outils génétiques indispensables pour comprendre les processus biologiques fondamentaux7,13 . Le génome du montage et contrôle des processus décrits ici est relativement plus rapide et dure environ deux mois par rapport à n’importe quel autre homologue remplacement axée sur la recombinaison. Résultats édition de génome réussi et efficace, il est important de suivre plusieurs étapes critiques sur le plan technique : 1) chaque gRNA est sélectionnée par la rigueur maximale et l’activité sans potentiel hors-cible ; 2) le donneur HDR contient ~1.5 Ko homologie bras flanquant le gRNA ciblant les sites. Bras plus longs de l’homologie (1,8 à 2 Ko) sont utilisés pour augmenter l’efficacité du HDR quand un grand fragment d’ADN exogène doit être inséré ; 3) le donneur HDR est conçu pour être libre des sites gRNA reconnaissance afin d’éviter de reciblage de la gRNA au locus machiné ; et 4) un plan élaboré à toute épreuve et la coordination du calendrier des croisements génétiques avec projection basées sur la PCR en 3 étapes pour sélectionner une ligne HDR « extrémités-out ».

Contrairement à transposition aléatoire ou constructions enhancer cloné, la stratégie et les protocoles nous décrit ici assure la génération d’une cible exclusivement les système binaires transcription de gène-spécifique. Étant donné que l’expression du pilote remplace un exon du gène natif, expression de gène-spécifique du conducteur est aussi polyvalente et devrait imiter les profils d’expression génique sous toutes les conditions du développement, métaboliques et physiologiques5. Expression de gène/cellule-spécifique est le critère plus désirable de toutes les lignes de pilote binaire lorsqu’ils sont utilisés dans diverses cellules et méthodes de la biologie du développement. Par exemple, expression de gène-spécifique des gènes rapporteurs par un conducteur de transcription facilite les analyses fiables lignée des cellules exprimant le gène cible. Il permet également d’imagerie direct et le suivi de l’expression spatio-temporelle, la migration et restructuration des cellules au cours du développement. Pour étudier les événements moléculaires et cellulaires au cours de la morphogenèse de tissu, Gal4 ou LexA piloté par la surexpression/études de divers transgènes et gènes RNAi précipitation dans des ensembles de cellules spécifiques sont indispensables. Système d’expression ciblée hautement spécifique fournit une impartiale des analyses et l’interprétation des résultats. Base de CRISPR/Cas9 ciblage d’un exon du gène et son remplacement par une séquence de transactivateur offre donc une meilleure alternative pour générer des systèmes d’expression de gène ciblé très spécifique.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont aucun conflit d’intérêt à divulguer.

Acknowledgments

Nous remercions le Dr F. Port, K. Dr. o ' Connor-Giles et Dr S. Feng pour des discussions sur la stratégie de CRISPR ; Dr. T.B. Kornberg et le centre de Stock Bloomington réactifs ; Installation de base d’imagerie UMD ; et le financement du NIH : R00HL114867 et R35GM124878 à SR.

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics