식물 단백질 곤충 세포에서 분 비 생산 잠재 식 벡터를 수정

JoVE Journal
Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

여기, 선물이 곤충 세포 및 잠재 단백질 식 시스템 단백질 결정 화에 대 한 분 비 하는 식물 단백질의 대량 생산에 활용에 대 한 프로토콜. 잠재 식 벡터 GP67 또는 곤충 hemolin 신호 펩 티 드 식물 곤충 세포에서 단백질 분 비 식에 대 한 수정 되었습니다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

그것은 구조 및 생화학 연구 재조합 분 비 진 핵 단백질을 표현 하는 과학자에 대 한 도전이 되었습니다. 잠재 중재 곤충 세포 표현 시스템 일부 포스트 번역 상 수정 재조합 진 핵 세포 분 비 단백질을 표현 하는 데 사용 하는 시스템 중 하나입니다. 분 비 단백질 단백질 glycosylation, 이황화 결합 형성, 및 다른 포스트 번역 상 수정 분 비 경로 통해 라우팅할 필요가 있다. 를 개선 하기 위해 분 비 식물 단백질의 기존 곤충 세포 표현 잠재 식 벡터 중 하나는 GP67의 추가 또는 발기인 및 다중 복제 사이트 간에 hemolin 신호 펩 티 드 순서에 의해 수정 됩니다. 이 새롭게 설계 된 수정된 벡터 시스템은 성공적으로 애기 thaliana의 수용 성 재조합 분 비 식물 수용 체 단백질의 높은 수익률을 생산. 두 애기 TDR 및 PRK3 원형질 막 수용 체의 세포 외 도메인 표현된 식물 단백질의 x 선 결정학 연구 화 시키는 했다. 수정 된 벡터 시스템 뿐만 아니라 동물의 왕국에 있는 재조합 형 분 비 단백질의 표정을 위해 잠재적으로 이용 될 수 있는 향상 된 도구입니다.

Introduction

특히 x 선 결정학 연구에 대 한 생화학 및 생물 characterizations 위해 균질 재조합 단백질의 대량 생산의 수 연구 실험실을 위한 필수적입니다. 대장균, 효 모, 곤충 세포, 포유류 세포, 식물 세포, 그들의 사이에서 많은 확고 분리 식 시스템, 잠재 중재 곤충 세포 표현 시스템은 가장 중 일반적으로 구조적으로 접힌된 대형 재조합 진 핵 단백질의 단백질 결정 화1대량 생산 기법을 사용.

잠재 식 시스템의 식 벡터는 강한 polyhedrin 또는 재조합 세포내 단백질2,3의 높은 수익률을 생산 하는 P10 발기인을 포함 하도록 설계 되었습니다. 재조합 잠재 수 있도록, 관심사의 유전자 Autographa californica nucleopolyhedroviral 멀티 게놈의 polyhedrin (polh) 로커 스를 포함 하는 곤충 벡터에 복제 됩니다. 결과 구문 다음 시퀀스 및 올바른 열려있는 독서 프레임 (ORF) 확인. 올바른 구문 다음 transfection의 과정을 통해 호스트 곤충 세포에 도입 되었습니다. 관심사의 유전자는 상 동 재조합에 의해 바이러스 성 게놈에 삽입 됩니다. 이 이벤트는 재조합 생산 하는 후 복제 바이러스 입자1언약궤 재조합 형 바이러스 성 게놈의 생산에서 발생 합니다.

곤충 세포 표현 시스템에서 가장 일반적으로 사용 되는 Sf9 및 높은 5 (Hi5) 세포 이다. Sf9 세포는 Sf21, Spodoptera frugiperda의 번데기 난소 세포에서 파생 된의 클론 분리 되며 Hi5 세포 클론 분리는 부모의 Trichoplusia ni 난소 세포 선 테네시-3684,5에서 파생 된. Hi5 셀 일반적으로 재조합 단백질6의 더 높은 양을 생성을 선택 하는 동안 공동 transfections, 바이러스 증폭 및 상 패 분석 실험, Sf9 세포에 지휘 된다. Hi5 세포는 돌연변이 바이러스를 생산 하는 그들의 추세 때문에 세대 및 바이러스 progenies의 증폭에 적합 하지 않습니다 지적 가치가 있다. 전통적으로, 25-30 ° C의 온도 범위는 곤충 세포의 경작에 좋은 것으로 간주 됩니다. 그러나, 그것은 27-28 ° C 곤충 세포 성장과 감염7,8에 대 한 최적의 온도 보고 되었습니다.

강한 신호 순서 선행 하는 유전자의 소개 secreted 단백질의 높은 식이 필요 합니다. 신호 순서 효율적으로 단백질 분 비와 포스트 번역 상 수정 적절 한 접는 및 안정화3에 필요한에 대 한 바인딩과 그물에 번역 된 재조합 단백질을 안내 것입니다. 신호 펩 티 드 순서는 잠재 봉투 단백질 GP64/67, 꿀벌 melittin, 그리고 다른 사람, 같이 잠재 중재 식 시스템3분 비 재조합 형 단백질의 표정을 촉진 하기 위해 선택 되었습니다. GP67의 신호 펩 티 드의 도입 대상 유전자9의 내장 신호 펩 티 드를 사용 하 여 비교 secreted 재조합 단백질의 식 수율을 개선 하기 위해 표시 되었습니다. Hemolin는 거 대 한 실크 나 방 Hyalophora cecropia, 박테리아 감염10시 유도의 hemolymph 단백질 이다. 유도 식의 상대적으로 높은 수준으로 인해 유전자의 신호 펩 티 드 순서 잠재 곤충 세포 시스템에서 재조합 단백질의 분 비 식 중재에 사용할 수 있습니다.

A. thaliana Tracheary 요소 차별화 금지 요인 수용 체 (TDR)와 꽃가루 수용 체 키 니 아 제 3 (PRK3) 둘 다 단백질11,12의 식물 신 부유한 반복 같은 수용 체 키 니 아 제 (LRR-RLK) 가족에 속하는 . 구조와 공장 수용 체 단백질의, 뿐만 아니라 다른 식물 분 비 단백질의 구조 및 생 화 확 적인 특성 있을이 가족의 기능을 공부 하기 위하여 잠재 곤충 세포 표현 시스템 수정 되었습니다. 단백질의 품질 및 생산 수율을 향상 시킵니다. TDR 및 PRK3의 세포 외 도메인 성공적으로 두 개의 수정된 식 벡터를 사용 하 여 잠재 곤충 세포 표현 시스템에서 표현 되었습니다. TDR 및 PRK3 단백질의 extracellular 도메인 모두 화 시키는 되는. 이 문서는 GP67 또는 발기인 및 여러 복제 사이 hemolin 신호 순서를 통합 하 여 표현과 많은 양의 두 수정된 잠재 식 벡터와 재조합 분 비 식물 단백질의 정화를 보고 사이트입니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

참고: 분 비 식물 단백질 표정 및 결정 화에 대 한 수정 된 식 벡터와 곤충 셀/잠재 시스템 사용 됩니다.

1. 식물 단백질 분 비 식 GP67 신호 펩 티 드와 잠재 식 벡터의 수정

  1. 5' BglII 절단 사이트13, GP67 분 비 신호 순서, 노트, BamHI, EcoRI, StuI, 사리, SpeI, XbaI, PstI, 및 XhoI (그림 1A)의 다중 복제 사이트를 포함 하는 DNA 파편을 음성 합성.
    참고: BglII와 BamHI 소화 이후 같은 접착제 끝 귀착되 었 다 DNA, 선형화 벡터 단련된 결 찰 순서에 BglII 및 BamHI 사이트 여 쪼갤은 시퀀스를 변경 될 것입니다 하는 동안 소화 DNA 단편에 선 수 있습니다. BglII 또는 BamHI14.
  2. BglII와 XhoI, DNA의 다이제스트 4 µ g 그리고 BamHI 및 XhoI14는 식 벡터 DNA의 4 µ g. Dna 농도 반응 버퍼 (50mm 칼륨 아세테이트, 20 mM 트리 아세테이트, 10 m m 마그네슘 아세테이트, 및 100 µ g/mL BSA, pH 7.9 25 ° C에서) x 1에 각 제한 효소의 10 단위를 혼합 하 고 37 ° C 4 h에서 혼합물을 품 어.
    1. 삭제 DNA 파편 및 선형화 벡터 DNA는 DNA 젤 추출 키트15정화.
  3. 400 선형화 벡터 DNA의 믹스 100 ng ng 소화 DNA의 x T4 DNA 리가 반응 버퍼 (50 mM Tris HCl, 10 m m MgCl2, 1 ATP, 그리고 10 mM DTT, pH 7.5 25 ° C에서)와 T4 DNA의 5 대 1을 포함 하는 10 µ L 결 찰 반응 혼합물에서 조각 리가입니다. 16 h 16 ° C에서 반응 혼합물을 품 어.
  4. 100 µ L DH5α 유능한 세포 표준 변환 프로토콜을 다음의 결 찰 혼합물의 5 µ L를 변환 하 고 암 피 실린-파운드 한 접시16에 결과 식민지를 선택 합니다. 5-10 식민지를 선택 하 고 220 rpm 및 16 h 떨고 인큐베이터에서 37 ° C에서 100 µ g/mL 암 피 실린 포함 된 파운드 매체의 2 mL에 각 식민지를 성장.
  5. DNA miniprep 키트17 각 플라스 미드 DNA를 추출 하 고 AGTATTTTACTGTTTTCGTAACAG 뇌관 DNA 연속 클론을 확인.
  6. PCR 증폭 A. thaliana TDR 유전자 조각 인코딩 잔류물 구성 합성 TDR 유전자에서 30-642 (뇌관을 앞으로: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, 반전 뇌관: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). 0.5 m m dNTP 믹스, 0.2 µ M 뇌관, 템플릿 DNA의 0.1 µ g, 0.4 m m MgCl2및 DNA 중 합 효소의 1 반응 단위를 포함 하는 DNA 중 합 효소 반응 버퍼에 30 사이클에 대 한 DNA를 증폭.
    1. 95 ° c 30에 대 한 초기 변성 PCR 주기 단계에 대 한 설정 들, 그리고 다음 30 주기 변성 95 ° C에서 30 s, 30 s 및 1 분에 72 ° C에서 5 분 동안 72 ° C에서 최종 확장 확장에 대 한 55 ° C에 어 닐 링.
  7. PCR 파편 및 노트와 BamHI 제한 endonuclease 효소 수정된 벡터 다이제스트. 선형화 벡터와 유전자 단편 선 400 선형화 벡터 DNA의 믹스 100 ng ng 소화 DNA의 조각 T4 DNA 리가 반응 버퍼 및 T4 DNA 리가의 5 단위를 포함 하는 10 µ L 결 찰 반응 혼합물에서. 16 h 16 ° C에서 반응 혼합물을 품 어.
  8. 100 µ L DH5α 유능한 세포 표준 변환 프로토콜을 다음의 결 찰 혼합물의 5 µ L를 변환 하 고 암 피 실린-파운드 한 접시16에 결과 식민지를 선택 합니다. DNA 시퀀싱에 의해 정확한 복제를 확인 합니다.

2. 식물 단백질 분 비 식 곤충 Hemolin 신호 펩 티 드와 잠재 식 벡터의 수정

  1. 5' BglII 절단 사이트13, 곤충 hemolin 분 비 신호 순서, 노트, BamHI, EcoRI, StuI, 사리, SpeI, XbaI, PstI, 및 XhoI (그림 1B)의 다중 복제 사이트를 포함 하는 DNA 파편을 음성 합성.
  2. BglII와 XhoI, DNA의 다이제스트 4 µ g 그리고 BamHI 및 XhoI14는 식 벡터 DNA의 4 µ g. Dna 농도 반응 버퍼 (50mm 칼륨 아세테이트, 20 mM 트리 아세테이트, 10 m m 마그네슘 아세테이트, 및 100 µ g/mL BSA, pH 7.9 25 ° C에서) x 1에 각 제한 효소의 10 단위를 혼합 하 고 37 ° C 4 h에서 혼합물을 품 어.
    1. 삭제 DNA 파편 및 선형화 벡터 DNA는 DNA 젤 추출 키트15정화.
  3. 400 선형화 벡터 DNA의 믹스 100 ng ng 소화 DNA의 x T4 DNA 리가 반응 버퍼 (50 mM Tris HCl, 10 m m MgCl2, 1 ATP, 그리고 10 mM DTT, pH 7.5 25 ° C에서)와 T4 DNA의 5 대 1을 포함 하는 10 µ L 결 찰 반응 혼합물에서 조각 리가입니다. 16 h 16 ° C에서 반응 혼합물을 품 어.
  4. 100 µ L DH5α 유능한 세포의 결 찰 혼합물의 5 µ L를 변환 하 고 암 피 실린-파운드 한 접시에 식민지를 선택 합니다. 5-10 식민지를 선택 하 고 포함 하는 100 µ g/mL 암 피 실린 220 rpm 및 16 h 떨고 인큐베이터에서 37 ° C에서의 2 mL 파운드 매체에 각 식민지를 성장.
  5. DNA miniprep 키트17 플라스 미드 DNA를 추출 하 고 AGTATTTTACTGTTTTCGTAACAG 뇌관 DNA 연속 클론을 확인 합니다.
  6. PCR 증폭를 A. thaliana 꽃가루 수용 체 키 니 아 제 3 (PRK3) 유전자 조각 잔류물 20-237 합성 PRK3 유전자 구성에서 인코딩 (뇌관을 앞으로: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, 반전 뇌관: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC)입니다. 0.5 m m dNTP 믹스, 0.2 µ M 뇌관, 템플릿 DNA의 0.1 µ g, 0.4 m m MgCl2및 DNA 중 합 효소의 1 반응 단위를 포함 하는 DNA 중 합 효소 반응 버퍼에 30 사이클에 대 한 DNA를 증폭.
    1. 초기 변성 95 ° C 30에 대 한 설정에 대 한 PCR 주기 단계 s, 그리고 다음 30 주기 변성 95 ° C에서 30 s, 30 s 및 30에 대 한 72 ° C에서 확장 하는 55 ° C에서 어 닐 링 각 주기 및 5 분 동안 72 ° C에서 마지막 확장 내에서 s.
  7. PCR 파편 및 노트와 BamHI 제한 endonuclease 효소 수정된 벡터 다이제스트. 선형화 벡터와 유전자 단편 선 400 선형화 벡터 DNA의 믹스 100 ng ng 소화 DNA의 조각 T4 DNA 리가 반응 버퍼 및 T4 DNA 리가의 5 단위를 포함 하는 10 µ L 결 찰 반응 혼합물에서. 16 h 16 ° C에서 반응 혼합물을 품 어.
  8. 100 µ L DH5α 유능한 세포 표준 변환 프로토콜을 다음의 결 찰 혼합물의 5 µ L를 변환 하 고 암 피 실린-파운드 한 접시16에 결과 식민지를 선택 합니다. DNA 시퀀싱에 의해 정확한 복제를 확인 합니다.

3. 생산 및 잠재의 증폭 재조합 형 단백질 표정 카세트를 품고 생성

  1. DH10Bac 유능한 세포 잠재 식 시스템1의 프로토콜을 다음의 40 µ L 변환 구문 플라스 미드의 사용 100 ng. 48 h에 대 한 37 ° C에서 변환 접시를 품 어.
  2. 각 변환 플레이트에서 두 개의 백색 식민지를, 각 식민지 파운드 매체 50 µ g/mL 대, 7 µ g/mL gentamicin, 그리고 10 µ g/mL 항생물질의 2 mL에 접종. 추출 하 고 bacmid DNA 확인 잠재 식 시스템1 의 프로토콜을 따릅니다. Aliquot 20 µ L 각와 함께 두 개의 튜브에서 각 DNA-20 ° c.에 튜브를 저장
    참고: 다음 단계는 무 균 작업이 필요합니다.
  3. 27 ° C에서 10% 태아 둔감 한 혈 청 (FBS)와 100 µ g/mL (또는 100 I.U./mL) 문화 미디어 스 페니실린 항생제에 Sf9 세포의 단층 6 잘 플레이트 합류 점 80% 성장. 합류의 조직 문화 접시에 덮여 영역 비율에 따라 백분율을 예상 하고있다.
  4. 2 살 균 1.5 mL 원심 분리기 튜브에 다음과 같은 솔루션을 준비 합니다.
    1. 1 관: 각 transfection에 대 한 항생제 없이 unsupplemented Sf9 세포 배양 매체의 100 µ L로 bacmid DNA의 20 µ L 희석. 튜브의 측면을 터치 하 여 희석을 부드럽게 혼합.
    2. 2 관: 각 transfection에 대 한 항생제 없이 unsupplemented Sf9 세포 배양 매체의 100 µ L로 지질 transfection 시 약의 8 µ L를 희석. 6 x를 위아래로 pipetting으로 희석을 철저 하 게 혼합.
  5. 두 솔루션을 결합, 3 x를 위아래로 천천히 pipetting으로 그들을 부드럽게 혼합 하 고 실 온에서 20-40 분 동안 그들을 품 어.
  6. 각 잘 Sf9 단층의 세포 항생제 없이 unsupplemented Sf9 세포 배양 매체의 3 mL 2 x 세척. 각 transfection 지질-DNA 혼합물을 포함 하는 각 관에 항생제 없이 unsupplemented Sf9 세포 배양 매체의 0.8 mL를 추가 합니다. 3 x를 위아래로 천천히 pipetting으로 튜브의 내용의 부드럽게 혼합. Transfection 혼합 샘플을 오버레이 및 격판덮개에서 세척 미디어 발음.
  7. Transfection 혼합물의 추가 후에 품 어 27 ° c.에 5 h transfected 플레이트 10 %FBS 100 µ g/mL (100 I.U./mL) 포함 된 완전 한 Sf9 세포 배양 매체 transfection 미디어 바꿉니다 항생제 페니실린 스. 4 d 27 ° C에서 transfected 접시를 품 어.
  8. 수확 하 고 재조합 잠재 증폭.
    1. 외피의 4 d 후 살 균 15 mL 원뿔 튜브에 감염 된 접시의 상쾌한을 수집 합니다. 1010 x g 세포 파편을 제거 하 5 분에 상쾌한 스핀. 펠 릿을 삭제 하 고 깨끗 한 튜브에 상쾌한 가만히 따르다 4 ° C에서 최대 1 년 동안 그것을 저장.
      참고: 이것은 P0 바이러스입니다. 그것은 시간이 더 긴 기간 aliquoted 및-80 ° C에서 저장 될 수 있습니다.
    2. 각 재조합 바이러스를 증폭, 80% 합류 150 mm 접시에 Sf9 세포의 단층 성장. 접시에서 미디어를 발음 접시에 세포 부착에 P0 바이러스의 2 개 mL를 추가 하 고 품 어 27 ° C 배양 기에서 1 시간에 대 한 접시. 셀으로 매체를 혼합 판 매 15 분 바위.
      1. 10 %FBS 100 µ g/mL (100 I.U./mL)를 포함 하는 완전 한 그레이스의 미디어의 25 mL를 추가 항생제 페니실린 스. P1 통행 바이러스를 27 ° C 인큐베이터에서 3 d 격판덮개를 품 어.
    3. 살 균 50 mL 원뿔 튜브에 세포 파편을 제거 하 5 분에 대 한 1010 x g 에서 스핀 감염 된 접시의 상쾌한을 수집 합니다. 깨끗 한 튜브에 상쾌한 가만히 따르다 고 최대 1 년 동안 4 ° C에서 그것을 저장 합니다.
      참고: P1 바이러스 수 있습니다 aliquoted-80 ° C에서 저장 시간이 더 긴 기간에 대 한.
    4. P1에서 P2 통행 바이러스를 증폭, 90% 합류를 150 mm 접시에 Sf9 세포의 단층을 성장 하 고, 접시의 미디어를 발음 하 고, 접시, P1 바이러스의 2 개 mL를 추가 한 27 ° C 배양 기에서 1 시간을 위해 그것을 품 어.
    5. 3.8.2 및 3.8.3 바이러스의 P2 및 P3 구절을 단계를 반복 합니다. 2 개월 이상 P3 바이러스를 저장 하지 마십시오.

4. 단백질 식, NiNTA, 및 결정 화 정화

  1. 27 ° C 배양 기 통에 100 rpm에서 2 x 106 의 밀도 100 µ g/mL (100 I.U./mL) 문화 미디어 페니실린 스 항생제에 Hi5 곤충 세포의 1 L 문화. 570 x g 5 분에 셀 아래로 회전 시키십시오, 가만히 따르다는 상쾌한, 갓 생산된 P3 바이러스의 20 mL에 셀 resuspend 그리고 1 헤 부드럽게 흔들어 각 15 분 x 1 셀 resuspend 스핀 병에 대 한 실내 온도에서 보관.
  2. 와 100 µ g/mL (100 I.U./mL) 문화 미디어 스 페니실린 항생제의 1 l 셀을 전송 하 고 72 h. 스핀 1,010 x g 5 분에 셀 아래에 27 ° C 배양 기 통에 100 rpm에서 셀 문화는 상쾌한을 수집 합니다.
  3. 사용 pH 지시자 0.1 M HCl 또는 0.1 M NaOH 추가 하 여 상쾌한 8.0의 pH를 조정 하 고 최종 농도, pH 8.0, 100 mM NaCl, 20 mM Tris 버퍼 및 5mm 이미에 바인딩 버퍼를 추가를 제거 합니다. 표현된 그의 태그 재조합 단백질의 예상된 수익률에 따라 NiNTA 수 지 (10-40 mL)의 일정 금액을 추가 합니다.
    1. 수 지 1 h. 워시 4 ° C에서 낮은 속도와 자기 파문에 솔루션을 혼합 하 고 표준 NiNTA 정화 프로토콜18다음 바인딩된 단백질을 elute.
  4. 이온 교환 정제 단백질 주제와 젤 여과 착 색 인쇄기, 뿐만 아니라 다른 단백질 정화 방법, 균질 샘플을 얻을.
    참고: TDR ectodomain, 20 mM Tris, pH 8, 100 mM NaCl 젤 여과 버퍼로 사용 했다. PRK3 ectodomain, 20 m m 두번째-트리 스에 대 한 pH 6, 100 mM NaCl 선호 젤 여과 버퍼로 사용 되었다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

그림 1에서 보듯이 두 수정된 pFastBac1 잠재 식 벡터는 GP67 또는 hemolin 신호 순서 대상 유전자의 본질적인 신호 순서를 대체 하는 secreted 단백질을 표현 하기 위해 사용 되었다. 바이러스 성 GP67와 곤충 hemolin 유전자 세포에 있는 높은 분 비 식 수준 입증 되었습니다. 융해 단백질이 두 신호 시퀀스 중 하나가 크게 분 비 식 수준 향상으로 예상 된다. 동일한 다 수 클로닝 위치 (MCS) 이러한 두 수정된 벡터에서 설계 했다. 노트 사이트 노트 8-뉴클레오티드 순서 보다는 가장 일반적인 6 뉴클레오티드 순서 다른 많은 금지 사이트에 있기 때문에 가장 5'-측면에 있는 MCS의 신중 하 게 배치 했다. 따라서, 노트 사이트는 대부분의 다른 제한 사이트, 제한 소화를 만들고 사용 하 여 다른 제한 사이트에 비해 더 실현 가능한 대부분 대상 유전자의 클로닝 보다 덜 대상 유전자에 존재. 대상 유전자는 노트와 다운스트림 제한 사이트 간의 복제 3 아미노산 잔류물, GGR, 이전 대상 유전자를 소개 합니다.

PBac1-GP67 및 pBac1 헴 성공적으로 이용 되었습니다 TDR 및 PRK3, A. thaliana 수용 체의 세포 외 도메인을 각각 표현 하 (그림 2). 재조합 단백질 공학 C 터미널 6 히스티딘 태그를 사용 하 여 NiNTA에 의해 순화 했다, 후 평균 단백질 수확량 20 mg/L Hi5 셀 주위 일관 했다. 각 단백질의 순도 가까이 또는 SDS 페이지와 Coomassie 얼룩 검사 50% 보다 높은.

TDR 및 PRK3의 세포 외 도메인의 재조합 단백질 크기 배제 크로마토그래피 (그림 2)에 의해 더 순화 했다. 순화 된 단백질 5 mg/mL에 집중 되었고 결정 심사를 받게. 20 µ m 보다 더 큰 크기와 함께 단백질 결정 (그림 3) 관찰 되었다 때까지 각 단백질의 예비 결정 나왔고, 조건 최적화 했다. 두 단백질의 크리스탈 구조 보고11,12되었습니다.

Figure 1
그림 1: 수정된 pFastBac1 벡터 지도. 이 패널에 표시 된 DNA 시퀀스 삽입 된 신호 펩 티 드 순서 및 대상 유전자에 대 한 여러 복제 사이트 (MCS)를 소유 하는 pFastBac1 벡터의 polyhedrin 발기인의 하류. 두 벡터는 동일한 MCS를 포함 되어 있습니다. (A)이이 패널 pBac1 GP67 벡터에 polyhedrin 발기인의 하류 복제 사이트의 시퀀스를 표시 합니다. 번역 된 GP67 신호 펩 티 드 아미노산 시퀀스는 빨간색으로 채색 된다. MCS에서 각 고유 제한 사이트 밑줄이, 위에 표시 된 사이트의 이름으로. (B)이이 패널 pBac1 헴 벡터 polyhedrin 발기인의 하류 복제 사이트의 시퀀스를 보여 줍니다. 번역 된 hemolin 신호 펩 티 드 아미노산 시퀀스는 빨간색으로 채색 된다. MCS에서 각 고유 제한 사이트 밑줄이, 위에 표시 된 사이트의 이름으로. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 잠재 곤충 세포 시스템에서 수정 된 pFastBac1 벡터와 단백질 표정. (A) TDR의 ectodomain Hi5 곤충 세포, 니켈 친 화력과 크기 배제 크로마토그래피 (S)에 의해 순화 표현 되었고 SDS 페이지 젤에 해결. 니켈 수 지 5mm 이미 (1), 세척 및 20 m m 이미 (2 세)와 두 번째 시간을 포함 하는 버퍼와 한번 세척 했다. (B)이 PRK3 ectodomain의 크기 배제 크로마토그래피 뿐만 아니라 식 니켈 친 화력 정화 (NiNTA)을 보여주는 SDS 페이지 분석 이다. 해당 크기와 분자량 (MW) 마커 표시 되어 있습니다. 각 패널에 빨간색 화살표는 식 및 재조합 TDR의 예상된 크기와 PRK3 ectodomain 단백질을 나타냅니다. 표현한 단백질의 멀티 밴드 본성 때문에 이기종 glycosylation 높습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: 단백질 결정의 애기 thaliana TDR 및 PRK3의 세포 외 도메인. (A)이이 패널 A. thaliana TDR의 세포 외 도메인의 단백질 결정을 보여 줍니다. (B)이이 패널 A. thaliana PRK3의 세포 외 도메인의 단백질 결정을 보여줍니다. 눈금 막대는 각 사진 아래 표시 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

크기 및 생물 학적 시스템에 단백질의 수천의 안정성에 다양성을 감안할 때, 그것은 종종 경험적 연구에 대 한 실험실을 분리 표현 시스템을 결정 하는 특정 단백질의 표현에 대 한 선택. 대장균 식 시스템은 종종19최대 규모 박테리아, 문화 미디어, 그리고 상대적으로 완화의 저렴 한 비용의 짧은 라이프 사이클에 따른 단백질 표정에 대 한 첫 번째 선택. 그러나 60 kDa,, 대장균 을 사용 하 여 보다는 더 크기와 큰 진 핵 단백질의 표현에 대 한 시스템은 종종 포함 본문 또는 집계20에서 불용 성 단백질에 결과. 그 어려운 단백질의 표정을 위해, 그리고 다른 secreted 단백질에 대 한 잠재-곤충 세포 표현 시스템 전자 대장균보다 더 유리한 수 있습니다. 진 핵 단백질 분 비를 표현 하는 경우에 특히이 수정된 잠재 곤충 세포 표현 시스템 선호 하는 선택 일 수 있었다.

많은 secreted 진 핵 단백질, 분 비 하는 식물 단백질을 포함 하 여 복잡 한 glycosylation, 이황화 형성, 및 다른 포스트 번역 상 수정 단백질 폴딩과 분 비21동안 필요 합니다. 대장균 시스템 진 핵 단백질22의 많은에 필요한 복잡 한 수정 처리 세포질 기계 장치는 없습니다. 효 모는 대장균23보다 상대적으로 더 고급 glycosylation 시스템. 그러나, 더 높은 핵 종 및 식물에서 secreted 단백질의 표현에 대 한 잠재-곤충 세포 시스템 상당한 이점을 제공합니다. 이후 glycosylation 단백질 폴딩에 영향을 미치는 안정성24, secreted 재조합 단백질의 많은 표현에 대장균 과 효 모 시스템 낮은 수율 있고 집계 하는, 아마도 잘못 된 단백질 접기 때문에 하는 경향이 있다. 잠재 곤충 시스템 단백질 glycosylation, 그것에 게 진 핵 단백질 분 비25의 표현에 대 한 이상적인 시스템을 개선 하기 위해 수정 되었습니다. 이 연구에는 GP67와 hemolin는 펩 티 드 단백질 결정 화에 대 한 두 개의 공장 수용 체 단백질의 분 비 식 안내 하는 성공적으로 이용 되었다 신호. 마음에 이러한 연구와 함께 하지만, 어느 신호 펩 티 드의 선택은 중요 한 단계, 그리고 그것은 다른 유기 체에서 대상 유전자의 세트와 함께 더 체계적인 비교 연구 필요.

GP67와 hemolin 신호 펩 티 드 단백질 분 비 식 향상을 사용 하는 아이디어는 두 유전자의 높은 식 수율에 의해 주도 되었다. 그러나, 단백질 분 비와 식 호스트의 posttranslational 수정 기계를 표현 재조합 단백질 오버 로드, secreted 재조합 단백질 없을 수 충분 한 수정, glycosylation 특히. 두 수정된 벡터 성공적으로 수많은 공장 분 비 단백질11,,1226는 많은 잘못 된 또는 부적절 한 glycosylation 때문에 아마 이다 집계 하는 경향이 익스프레스에 사용 되었습니다. 따라서, 그 어려운 단백질의 표정을 위해 모두 강하고 약한 신호 펩 티 드 순서 테스트 해야 하 고 표현된 재조합 단백질의 품질 비교 해야 키를 누릅니다. 약한 신호 펩 티 드 순서 단백질;의 전체 수익률을 낮출 것 이다 명심 하십시오 그러나, 그것은 단백질 분 비와 수정 처리 하는 데 충분 한 용량 식 호스트의 분 비 기계 줄 수 있습니다.

곤충 세포에서 분리 분 비 단백질의 표현 뿐만 아니라 포유류 세포 및 식물 세포 식 시스템에 사용 되었습니다 성공적으로 재조합 포유류의 overexpression 및 식물 단백질, 각각27, , 2829. 분리 시스템, 근처 생 식에 비해 상태는 포유류 나 분 비 하는 식물 단백질의 잘 접힌된 단백질을 호스트 세포에 거의 네이티브 수정 기계를 해야한다. 근처-네이티브 식 시스템을 사용 하 여 경고는 표현된 재조합 단백질 잠재적으로 단백질의 최종 식 수익률에 악영향을 미칠 수 있습니다 세포의 생리 기능 방해할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgments

이 작품 Guozhou Xu에 대 한 노스 캐롤라이나 주립 대학에서 새로운 교수 시작 자금에 의해 지원 되었다.

Materials

Name Company Catalog Number Comments
Incubator shaker VWR Model Excella E25 27 oC
Incubator VWR Model 2005 27 oC
Centrifuge BECKMAN Model J-6 with a swing bucket rotor
Herculase II Fusion DNA Polymerase Agilent 600677-51 For PCR amplification of DNA
Thermal Cycler BIO-RAD Model C1000 Touch For PCR amplification of DNA
Incubator shaker New Brunswick Scientific Model I 24 For growing baceria culture
Customer DNA synthesis GENSCRIPT
BamHI (HF) New England Biolabs R3136S Restriction Endonuclease
BglII New England Biolabs R0144S Restriction Endonuclease
NotI (HF) New England Biolabs R3189S Restriction Endonuclease
XhoI New England Biolabs R0146S Restriction Endonuclease
T4 DNA ligase New England Biolabs M0202T DNA ligation
QIAquick Gel Extraction Kit Qiagen 28704 DNA purification from Agorase gel
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid DNA purification from bacteria culture
Agarose Thermo Fisher Scientific 15510-019 For DNA gel electropherosis
MAX Efficiency DH5α competen cell Invitrogen 18-258-012 For transformation of DNA ligation mixture
Lennox L LB Broth Research Product International Corp. L24066-5000.0 For making bacteria culture
Ampicillin sodium salt Thermo Fisher Scientific 11593-019 Antibiotics
Kanamycin Sulfate Thermo Fisher Scientific 15160-054 Antibiotics
Tetracycline Thermo Fisher Scientific 64-75-5 Antibiotics
Gentamicin Thermo Fisher Scientific 15710-064 Antibiotics
MAX Efficiency DH10Bac competent cells Thermo Fisher Scientific 10361-012 For making bacmid DNA
S.O.C. Medium Thermo Fisher Scientific 15544-034 For DNA transformation
CellFECTIN II Reagent Thermo Fisher Scientific 10362-101 Insect cell transfection reagent
Bac-to-Bac Expression System Thermo Fisher Scientific 10359-016 Baculovirus-insect cells expression kit
Bluo-gal Thermo Fisher Scientific 15519-028 For isolation of recominant Bacmid DNA
IPTG Thermo Fisher Scientific 15529-019 For isolation of recominant Bacmid DNA
pFastBac1 Thermo Fisher Scientific 10360014 Baculorirus expression vector
Sf9 cells Thermo Fisher Scientific 11496015 Sf9 monolayer cells
Hi5 cells Thermo Fisher Scientific B85502 High Five insect cells
Grace’s insect medium, unsupplemented Thermo Fisher Scientific 11595030 Sf9 cell transfection minimum medium
Grace’s insect medium, supplemented Thermo Fisher Scientific 11605102 Sf9 monolayer cell culture complete medium
Sf-900 II SFM Thermo Fisher Scientific 10902104 Sf9 suspension cell culture medium without FBS
Express Five SFM Thermo Fisher Scientific 10486025 Hi5 cell culture medium
Penicillin-Streptomycin Thermo Fisher Scientific 15140122 100 ml (10,000 I.U./ml)
L-Glutamine (200 mM) Thermo Fisher Scientific 25030081 100 ml
FBS Certified Thermo Fisher Scientific 16000-044 500 ml
6-well plates Thermo Fisher Scientific 08-772-1B Flat-bottom
150 mm plates Thermo Fisher Scientific 353025 100/case
1.5 ml Microcentrifuge Tubes USA Scientific 1415-2500 500 tubes/bag
15 ml conical screw cap centrifuge tubes USA Scientific 1475-0511 25 tubes/bag
50 ml conical screw cap centrifuge tubes USA Scientific 1500-1211 25 tubes/bag
Ni-NTA Superflow Qiagen 30430 NiNTA resin
pH-indicator strips EMD Millipore Corporation 1.09535.0001 pH 0 - 14

DOWNLOAD MATERIALS LIST

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317 (2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796 (2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics