Изменение бакуловирусы векторы выражения производить выделяется растительных белков в клетках насекомых

JoVE Journal
Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Здесь мы представляем протоколы для использования насекомых клеток и бакуловирусы системе выражения протеина для производства большого количества белков растений выделяется для кристаллизации белка. Вектор выражения бакуловирусы был изменен с GP67 или насекомое hemolin пептид сигнала для растений секрецию белков в клетках насекомых.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Это был вызов для ученых выразить рекомбинантных белков секреторной эукариотических структурных и биохимических исследований. Система выражение бакуловирусы опосредованной насекомых клеток является одной из систем, используемых для Экспресс рекомбинантных белков эукариотических секреторной с некоторыми столб-поступательные изменения. Выделительные протеины должны направляться через выделительные пути гликозилирования белков, формирования дисульфидными облигаций и других столб-поступательные изменения. Для улучшения существующих насекомых клеток выражение секреторной растительных белков, вектор выражения бакуловирусы изменяется путем добавления либо GP67 или hemolin сигнал пептид последовательность между промоутер и клонирование несколько сайтов. Этот недавно разработанный изменение вектора системы успешно производит высокий урожай растворимых рекомбинантных выделяется завод рецептор белков Arabidopsis thaliana. Два из выраженных растительных белков, внеклеточных доменов Arabidopsis ДТР и PRK3 плазмы мембранных рецепторов, были обобщены кристаллографических рентгеновских исследований. Изменение вектора система является усовершенствованный инструмент, который потенциально может использоваться для выражения рекомбинантных белков секреторной в животном царстве также.

Introduction

Это необходимо для научно-исследовательская лаборатория быть способны производить большое количество однородных рекомбинантных белков на биохимические и биофизические характеристики, особенно для рентгеновских кристаллографических исследований. Существует много устоявшихся гетерологичных выражение систем, таких как кишечная палочка, дрожжи, насекомых клетки, клетки млекопитающих, клетки растений, и т.д. среди них, система выражение бакуловирусы опосредованной насекомых клеток является одним из самых часто используемых методов для получения большого количества структурно сложенном крупногабаритных рекомбинантных эукариотических белков для кристаллизации протеина1.

Векторы выражения бакуловирусы выражение системы разработаны для содержать сильное polyhedrin или P10 промоутер для получения высокой доходности рекомбинантных внутриклеточные белки2,3. Чтобы сделать рекомбинантных бакуловирусы, гена интереса клонируется в насекомых вектор, содержащий очагов генома multi-nucleopolyhedroviral californica Металловидка polyhedrin (polh). Результате конструкция затем упорядочивать и проверить его правильное чтение открытые рамки (ORF). Правильную конструкцию затем вводят в клетки-хозяина насекомых в процессе transfection. Гена интереса вставляется в вирусного генома гомологичная рекомбинация. Это событие приводит к производству рекомбинантных вирусного генома, который затем реплицирует производить рекомбинантные окулировкой вирусных частиц1.

Насекомое клетки, которые наиболее часто используются в системе выражения являются Sf9 и высокий пять (Hi5) клетки. Sf9 клетки являются клоновых изолировать Sf21, производные от куколки яичников клетки Spodoptera frugiperda, и Hi5 клетки клоновых изолировать, производные от родительского Trichoplusia ni яичников клеток линии TN-3684,5. Со transfections, вирус амплификации и налета анализы проводятся на Sf9 клетки, в то время как Hi5 клетки обычно выбираются производить большее количество рекомбинантных белков6. Стоит отметить, что клетки Hi5 не подходят для генерации и усиления потомков вируса из-за их тенденция производить мутантов вирусов. Традиционно в диапазоне температур 25-30 ° c считается хорошо для культивирования клеток насекомых. Однако сообщалось, что 27-28 ° C — оптимальная температура для насекомых клеток роста и инфекции7,8.

Введение сильный сигнал последовательности предыдущих ген необходима высокая экспрессия секретируемые белки. Последовательность сигнала будет эффективно руководство перевод рекомбинантных белков в эндоплазматический ретикулум секрецию белка и столб-поступательные изменения, необходимые для надлежащего складные и стабилизации3. Сигнальные последовательности пептид, такие как бакуловирусы конверт белков GP64/67, мелиттин медоносной пчелы и другие, были выбраны для облегчения выражение секреторной рекомбинантных белков в бакуловирусы опосредованной выражение систем3. Было показано, что введение сигнала пептидные GP67 улучшить доходность выражение секретируемые рекомбинантных белков, по сравнению с использованием встроенных сигнала пептид целевого гена9. Hemolin — гемолимфа белок гигантский мотылек шелка Hyalophora цекропии, индуцированных после бактерии инфекции10. Из-за относительно высокого уровня индуцированного выражения сигнал пептид последовательность гена может использоваться посредником секрецию выражение рекомбинантных белков в системе бакуловирусы насекомое клеток.

A. thaliana Tracheary элемент дифференциации тормозящий фактор рецептор (ДТР) и 3 киназы рецепторов пыльцы (PRK3), оба принадлежат к семейству растений лейцин богатые киназы рецепторов как повтор (LRR-RLK) белки11,12 . Для того, чтобы изучить структуру и функции этого семейства растений рецептор белков, а также облегчения структурных и биохимических характеристик других выделяется растительных белков, клеток бакуловирусы насекомое выражение системы была изменена для улучшение качества и производства урожайность белка. Внеклеточных доменов ДТР и PRK3 успешно были выражены с помощью двух векторов измененное выражение в системе выражение бакуловирусы насекомое клеток. Было выкристаллизовывано внеклеточных доменов ДТР и PRK3 белков. Эта статья сообщает выражение и очистки больших объемов рекомбинантных секретируемые растительных белков с двух модифицированных бакуловирусы векторы выражения путем включения GP67 либо hemolin последовательность сигнала между организатором и несколько клонирования сайтов.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Примечание: Используется система насекомых клеток/бакуловирусы с измененное выражение векторы выражения белка секреторных завод и кристаллизации.

1. модификация бакуловирусы вектора выражения с пептида GP67 сигнал для секреции белков растений

  1. Синтезировать фрагмент ДНК, содержащие 5' BglII резки сайт13, последовательность сигнала GP67 секреции и мульти Клонирование сайт с персо, BamHI, EcoRI, StuI, Сали, SpeI, XbaI, PstI и XhoI (рис. 1A).
    Примечание: Так как BglII и BamHI переваривается ДНК в результате же клей концы, линеаризованного вектора можно перевязать переваривается фрагмент ДНК, в то время как BglII и BamHI сайтов в отожженном лигирование последовательности будет мутировал в последовательность, которая не горные BglII или BamHI14.
  2. Дайджест 4 мкг ДНК с BglII и XhoI и 4 мкг дна вектора выражения с BamHI и XhoI14. Смешайте 10 единиц каждого энзима ограничения с ДНК в 1 x концентрации реакции буфера (ацетат калия 50 мм, 20 мм трис ацетат, ацетат магния 10 мм и 100 мкг/мл BSA, pH 7,9 при 25 ° C) и инкубировать смесь при 37 ° C в течение 4 ч.
    1. Очищают подакцизным фрагмент ДНК и линеаризованного вектора ДНК путем экстракции ДНК gel15.
  3. Смесь 100 нг линеаризованного вектора ДНК с 400 нг переваривается ДНК фрагмента в 10-мкл лигирование реакционной смеси, содержащие 1 x T4 ДНК лигаза реакции буфера (50 мм трис-HCl, MgCl 10 мм2, АТФ 1 мм и 10 мм DTT, pH 7.5 при 25 ° C) и 5 единиц T4 ДНК Лигаза. Инкубируйте реакционную смесь на 16 ° C для 16 h.
  4. Превратить 5 мкл лигирование смеси в 100 мкл DH5α компетентных клеток после стандартного преобразования протокол и выберите результирующий колоний на ампициллин LB агар пластины16. Возьмите 5-10 колоний и расти в каждой колонии в 2 мл LB носитель, содержащий 100 мкг/мл ампициллин 220 об/мин, 37 ° C в тряску инкубатор для 16 h.
  5. Извлечь каждый плазмида ДНК с ДНК алкалический комплект17 и подтвердить клонов секвенирования ДНК с AGTATTTTACTGTTTTCGTAACAG грунтом.
  6. ПЦР усилить гена ДТР A. thaliana фрагмент кодирования остатков 30-642 от синтетических генов ДТР построить (вперед грунтовка: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, обратный грунтовка: GC GGATCC CTA GTG GTG ГПТ GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Усилить ДНК для 30 циклов в буфер реакции ДНК-полимеразы, содержащий 0,5 мм dNTP смеси, грунтовки 0,2 мкм, 0,1 µg дна шаблона, 0.4 мм MgCl2и 1 единица реакции полимеразы дна.
    1. Для шаги цикла PCR, установите первоначальный Денатурация при 95 ° C за 30 s, а затем 30 циклов Денатурация при 95 ° C за 30 сек, отжиг при температуре 55 ° C для 30 s и расширение в 72 ° C в течение 1 мин, с расширением окончательный при 72 ° C за 5 мин.
  7. Дайджест ПЦР фрагментов и изменение вектора с Ноти и BamHI Энзимы эндонуклеазы ограничения. Перевязать фрагмента гена с линеаризованного вектора. Смесь 100 нг линеаризованного вектора ДНК с 400 нг переваривается ДНК фрагмента в 10-мкл лигирование реакционной смеси, содержащие T4 ДНК лигаза реакции буфер и 5 единиц T4 ДНК лигаза. Инкубируйте реакционную смесь на 16 ° C для 16 h.
  8. Превратить 5 мкл лигирование смеси в 100 мкл DH5α компетентных клеток после стандартного преобразования протокол и выберите результирующий колоний на ампициллин LB агар пластины16. Подтверждения правильного клоны секвенирования ДНК.

2. модификация бакуловирусы вектора выражения с насекомых Hemolin сигнал пептидные для секреции белков растений

  1. Синтезировать фрагмент ДНК, содержащие 5' BglII резки сайт13, последовательность сигнала насекомых hemolin секреции и мульти Клонирование сайт с персо, BamHI, EcoRI, StuI, Сали, SpeI, XbaI, PstI и XhoI (рис. 1B).
  2. Дайджест 4 мкг ДНК с BglII и XhoI и 4 мкг дна вектора выражения с BamHI и XhoI14. Смешайте 10 единиц каждого энзима ограничения с ДНК в 1 x концентрации реакции буфера (ацетат калия 50 мм, 20 мм трис ацетат, ацетат магния 10 мм и 100 мкг/мл BSA, pH 7,9 при 25 ° C) и инкубировать смесь при 37 ° C в течение 4 ч.
    1. Очищают подакцизным фрагмент ДНК и линеаризованного вектора ДНК путем экстракции ДНК gel15.
  3. Смесь 100 нг линеаризованного вектора ДНК с 400 нг переваривается ДНК фрагмента в 10-мкл лигирование реакционной смеси, содержащие 1 x T4 ДНК лигаза реакции буфера (50 мм трис-HCl, MgCl 10 мм2, АТФ 1 мм и 10 мм DTT, pH 7.5 при 25 ° C) и 5 единиц T4 ДНК Лигаза. Инкубируйте реакционную смесь на 16 ° C для 16 h.
  4. Превратить 5 мкл лигирование смеси в 100 мкл DH5α компетентным ячеек и выберите колоний на плите агар ампициллин ЛБ. Возьмите 5-10 колоний и расти в каждой колонии в 2-мл LB среде, содержащей 100 мкг/мл ампициллина 220 об/мин, 37 ° C в тряску инкубатор для 16 h.
  5. Извлечь плазмида ДНК с ДНК алкалический комплект17 и подтвердить клонов секвенирования ДНК с AGTATTTTACTGTTTTCGTAACAG грунтом.
  6. ПЦР усиливают A. thaliana 3 киназы рецепторов пыльцы (PRK3) ген фрагмент кодирования остатков 20-237 от синтетических конструкции гена PRK3 (вперед грунтовка: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, обратный грунтовка: CGC GGATCC CTA GTG GTG ГПТ GTG GTG ГТГ TGAAGGTTTCTCATCGCATTCTATATTC). Усилить ДНК для 30 циклов в буфер реакции ДНК-полимеразы, содержащий 0,5 мм dNTP смеси, грунтовки 0,2 мкм, 0,1 µg дна шаблона, 0.4 мм MgCl2и 1 единица реакции полимеразы дна.
    1. Для шаги цикла PCR, установите первоначальный Денатурация при 95 ° C за 30 s, а затем 30 циклов Денатурация при 95 ° C за 30 сек, отжиг при температуре 55 ° C 30 s, и расширение в 72 ° C за 30 s в рамках каждого цикла и окончательное расширение при 72 ° C за 5 мин.
  7. Дайджест ПЦР фрагментов и изменение вектора с Ноти и BamHI Энзимы эндонуклеазы ограничения. Перевязать фрагмента гена с линеаризованного вектора. Смесь 100 нг линеаризованного вектора ДНК с 400 нг переваривается ДНК фрагмента в 10-мкл лигирование реакционной смеси, содержащие T4 ДНК лигаза реакции буфер и 5 единиц T4 ДНК лигаза. Инкубируйте реакционную смесь на 16 ° C для 16 h.
  8. Превратить 5 мкл лигирование смеси в 100 мкл DH5α компетентных клеток после стандартного преобразования протокол и выберите результирующий колоний на ампициллин LB агар пластины16. Подтверждения правильного клоны секвенирования ДНК.

3. производство и усиления бакуловирусы создает укрывательство кассеты выражение рекомбинантных белков

  1. Использование 100 нг плазмидные конструкции преобразовать 40 мкл DH10Bac компетентных клеток после протокол бакуловирусы выражение системы1. Инкубируйте преобразования пластины при 37 ° C в течение 48 часов.
  2. Подобрать два белых колоний от каждого преобразования пластины, прививок каждой колонии в 2 мл LB среде, содержащей 50 мкг/мл канамицин, гентамицин 7 мкг/мл и 10 мкг/мл тетрациклин. Следуйте протокол бакуловирусы выражение системы1 для извлечения и проверки bacmid ДНК. Аликвота каждый ДНК в две трубы с 20 мкл каждого и хранить трубы при-20 ° C.
    Примечание: Следующие шаги требуют асептических операцию.
  3. Растут монослоя Sf9 клеток в культуре средств массовой информации с 10% плода бычьим сывороточным (ФБС) и 100 мкг/мл (или 100 I.U./mL) пенициллина и стрептомицина антибиотики при 27 ° C до 80% слияния в пластине 6-хорошо. Оцените процент слияния, основанные на процентах площадь на пластину культуры ткани.
  4. Подготовьте следующие решения в двух стерильных 1.5 мл пробирок.
    1. Труба 1: Для каждого трансфекции, Разбавьте 20 мкл bacmid ДНК в 100 мкл unsupplemented Sf9 клеток питательной среды без антибиотиков. Осторожно перемешать разрежения, стряхивая стороне трубки.
    2. Труба 2: Для каждого трансфекции, развести 8 мкл Реагента трансфекции липидов в 100 мкл unsupplemented Sf9 клеток питательной среды без антибиотиков. Тщательно перемешать разрежения, закупорить вверх и вниз для 6 x.
  5. Объединить два решения, осторожно перемешать их, закупорить медленно вверх и вниз для 3 x и проинкубируйте 20-40 мин при комнатной температуре.
  6. Мыть каждый хорошо Sf9 монослой клеток 2 x 3 мл unsupplemented Sf9 клеток питательной среды без антибиотиков. Для каждого трансфекции добавьте 0,8 мл unsupplemented Sf9 клеток питательной среды без антибиотиков в пробирки, содержащие смесь липидов ДНК. Осторожно перемешайте содержимое трубки, закупорить медленно вверх и вниз для 3 x. Аспирационная мыть СМИ от пластин и наложения образцы с трансфекции смеси.
  7. После добавления трансфекции смеси Инкубируйте transfected пластина для 5 h 27 ° c. Заменить трансфекции медиа с полной Sf9 клеток питательной среды, содержащие 10% FBS и 100 мкг/мл (или 100 I.U./mL) антибиотики пенициллин стрептомицином. Инкубируйте transfected пластины при 27 ° C для 4 d.
  8. Урожай и усилить рекомбинантных бакуловирусы.
    1. Соберите супернатант зараженных пластины в стерильную пробирку 15 мл конические после 4 d инкубации. Спиновые супернатант в 1010 x g 5 мин для удаления мусора ячейки. Отменить гранулы и сцеживаться супернатант в чистой трубку и хранить его на 4 ° C на срок до 1 года.
      Примечание: Это вирус P0. Это может быть aliquoted и хранятся при температуре-80 ° C для более длительного периода времени.
    2. Для того чтобы усилить каждый рекомбинантных вирус, растут монослоя клеток Sf9 на тарелку, 150-мм до 80% слияния. Аспирационная СМИ от плиты, добавить 2 мл P0 вируса клетки приверженцем пластину и инкубировать пластину за 1 ч в инкубаторе 27 ° C. Рок плита каждые 15 мин смешать носитель с клетками.
      1. Добавить 25 мл полное благодати СМИ, содержащие 10% FBS и 100 мкг/мл (или 100 I.U./mL) антибиотики пенициллин стрептомицином. Инкубируйте пластину для 3 d в инкубаторе 27 ° C для получения вирус проход P1.
    3. Соберите супернатант зараженных пластины в стерильную пробирку 50 мл конические и спина на 1010 x g 5 мин для удаления мусора ячейки. Декант супернатант в чистой трубку и хранить его на 4 ° C на срок до 1 года.
      Примечание: P1 вирус может быть aliquoted и хранятся при температуре-80 ° C для более длительного периода времени.
    4. Для того чтобы усилить вируса от P1 P2 проход, растут монослоя клеток Sf9 на тарелку, 150-мм до 90% слияния, аспирационная СМИ пластины, добавить 2 мл P1 вируса к пластине и проинкубируйте 1 ч в инкубаторе 27 ° C.
    5. Повторите шаги 3.8.2 и 3.8.3 для получения P2 и P3 проходы вирусов. Не храните вирусом P3 для более чем 2 месяцев.

4. белков, очистки с NiNTA и кристаллизации

  1. Культура 1 Л Hi5 насекомых клеток в антибиотики пенициллин стрептомицином культуры СМИ с 100 мкг/мл (или 100 I.U./mL) к плотности6 2 x 10 при 100 об/мин в шейкер инкубатор 27 ° C. Спин вниз клетки на 570 x g 5 мин, сцеживаться супернатанта, Ресуспензируйте клетки в 20 мл свежезаваренным производства вирусом P3 и держать его при комнатной температуре, по 1 ч. Осторожно встряхните бутылку спин Ресуспензируйте клетки 1 x каждые 15 мин.
  2. Клетки перехода к 1 Л антибиотики пенициллин стрептомицином культуры СМИ с 100 мкг/мл (или 100 I.U./mL), культура клетки на 100 об/мин в шейкер инкубатор 27 ° C за 72 ч. спин вниз клетки на 1010 x g 5 мин и собирать супернатант.
  3. Использование pH индикатор полосы для регулировки рН супернатант 8.0, добавив 0,1 М HCl или 0,1 М NaOH и добавить привязку буфера в конечной концентрации, содержащий буфер Tris 20 мм при pH 8.0, 100 мм NaCl и 5 мм имидазола. Добавьте определенное количество смолы NiNTA (10-40 мл) на основе сметных доходность выразил его меткой рекомбинантных белков.
    1. Mix решение на магнитные перемешать с низкой скоростью при 4 ° C на 1 ч. мыть смолы и элюировать связанный протеин после стандартного NiNTA очистки протокол18.
  4. При условии очищенный протеин ионного обмена и гель хромотографии фильтрации, а также другие методы очистки белков, для получения однородной образца.
    Примечание: Для ectodomain ДТР, 20 мм трис, рН 8, 100 мм NaCl были использованы в качестве буфера фильтрации геля. Для PRK3 ectodomain, 20 мм бис трис, рН 6, 100 мм NaCl были использованы в качестве предпочтительного гель фильтрации буфера.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Как показано на рисунке 1, двух векторов выражения бакуловирусы модифицированных pFastBac1 были использованы выразить секретируемые белки с GP67 или hemolin сигнал последовательности заменить встроенные сигнал последовательности целевого гена. Было продемонстрировано, что вирусный GP67 и гены насекомых hemolin имеют высокую секрецию выражение уровни в клетках. Синтез белков с любой из этих двух последовательностей сигнала, как ожидается, значительно улучшились секрецию выражение уровня. Идентичные несколько клонирования сайтов (MCS) были разработаны в этих двух модифицированных векторов. Ноти сайт был намеренно размещены на наиболее 5'-стороне MCS, потому что Ноти имеет восемь нуклеотидной последовательности, вместо того, чтобы наиболее распространенные шесть нуклеотидной последовательности настоящий во многих других местах ограничения. Таким образом Ноти сайт менее присутствует в целевых генов, чем большинство других сайтов ограничение, делая ограничения пищеварение и клонирование большинства генов-мишеней, более целесообразным по сравнению с использованием других места ограничения. Клонирование целевых генов между Ноти и ниже по течению ограничение сайта представит только три аминокислотных остатков, ГГР, предшествующий целевого гена.

PBac1-GP67 и pBac1-Хем были успешно использованы выразить внеклеточных доменов A. thaliana рецепторов ДТР и PRK3, соответственно (Рисунок 2). После того, как рекомбинантных белков были очищены от NiNTA, с помощью инженерных Терминал C 6-гистидина, средняя белка урожая согласуется около 20 мг/Л Hi5 клеток. Чистота каждого белка — близко к или выше, чем на 50%, с SDS-PAGE и Окрашивание Кумасси.

Рекомбинантных белков внеклеточного доменов ДТР и PRK3 были неразделимая размер гель-проникающей хроматографии (рис. 2). Очищенный протеин было сосредоточено до 5 мг/мл, а затем подвергаются кристаллизации скрининга. Условий, которые дали предварительный кристаллы каждого белка, были оптимизированы пока белковых кристаллов с размером больше, чем 20 мкм были замечены (рис. 3). Кристаллические структуры обоих белков были сообщил11,12.

Figure 1
Рисунок 1: карты векторов, модифицированных pFastBac1. Последовательностей ДНК, показано в этих групп были вставлены вниз по течению от polyhedrin промоутер pFastBac1 вектора, обладать пептид последовательность сигнала и несколько клонирования сайтов (MCS) для целевых генов. Обе векторы содержат же MCS. (A) Эта панель показывает последовательность клонирования сайтов по течению polyhedrin промоутер в векторе pBac1-GP67. Перевод GP67 сигнала пептид аминокислотной последовательности окрашивается в красный. Каждое уникальное ограничение сайта в MCS подчеркивается, с именем узла, помечены выше. (B) Эта группа показывает последовательность клонирования сайтов по течению polyhedrin промоутер в векторе pBac1-Хем. Последовательность аминокислот пептидной сигнала перевод hemolin окрашивается красным цветом. Каждое уникальное ограничение сайта в MCS подчеркивается, с именем узла, помечены выше. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: выражение протеина с модифицированных pFastBac1 векторов в системе бакуловирусы насекомое клеток. (A) ectodomain ДТР была выражена в Hi5 насекомых клеток, очистить хромотографией сродства никеля и размер изоляции (S) и решен на геля SDS-PAGE. Никелем смолы промывали один раз с буфер, содержащий 5 мм имидазола (мыть 1) и во второй раз с 20 мм имидазола (Уош 2). (B) это SDS-PAGE анализ показаны выражения и очищение сродства никеля (NiNTA), а также размер исключения хроматографии PRK3 ectodomain. Молекулярный вес (МВт) маркеры с соответствующими размерами помечены. Красные стрелки в каждой панели обозначают выражения и ожидаемые размеры рекомбинантного ДТР и PRK3 ectodomain белков. Многополосный природ выраженной белков, вероятно, из-за разнородных гликозилирования. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: Белковых кристаллов внеклеточных доменов Arabidopsis thaliana ДТР и PRK3. (A) Эта панель показывает белковых кристаллов внеклеточных доменов A. thaliana ДТР. (B) группа показывает белковых кристаллов внеклеточных доменов A. thaliana PRK3. Линейки шкалы отображается под каждой картинкой. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Учитывая разнообразие в размер и стабильность тысяч белков, присутствующих в биологических системах, это часто эмпирических исследований лаборатории решить какие гетерологичных выражение системы должен быть выбран для выражения определенного белка. Выражение системы E. coli часто является первым выбором для выражения протеина из-за короткий жизненный цикл бактерий, низкая стоимость культуры средств массовой информации, и относительная легкость масштабирования до19. Для выражения крупных эукариотических белков с размерами, более чем 60 кДа, однако, с помощью кишечной палочки системы часто приводит к нерастворимые белки в теле включение или агрегирования20. Для выражения этих сложных белков и для других секретируемые белки клетки бакуловирусы насекомое выражение система может быть более выгодным, чем E coli. Особенно когда выражая секретируемые белки эукариот, эта система выражение измененных клеток бакуловирусы насекомое может быть предпочтительным выбором.

Многие выделяется эукариотических белки, включая завод выделяется белков, требуется комплекс гликозилирования, дисульфида формирования и другие столб-поступательные изменения во время складывания и секрецию белка21. E. coli системы не имеют клеточными для обработки сложных изменений, необходимых для многих эукариотических белки22. Дрожжи имеет относительно более продвинутые системы гликозилирования чем E. coli23. Однако для выражения секретируемые белки в высших эукариотических видов и растений, системе бакуловирусы насекомое клеток представляет значительное преимущество. Поскольку гликозилирования влияет на сворачивание белков и стабильности24, многие из секретируемые рекомбинантных белков выражается в E. coli и дрожжей системы имеют низкий выход и склонны агрегировать, предположительно за счет сворачивания белка неверно. Бакуловирусы насекомое система была изменена для улучшения гликозилирования белков, что делает его идеальной системы для выражения эукариотических секретируемые белки25. В этом исследовании GP67 и hemolin сигнал пептиды были успешно использованы для руководства выражение секрецию двух растений рецептор белков для кристаллизации белка. С этих исследований в виду, хотя, выбор либо сигнал пептида является важным шагом, и он нуждается в более систематические сравнительные исследования с набором генов-мишеней от различных организмов.

Идея использования GP67 и hemolin сигнал пептиды для повышения секреции белков был обусловлен высоким выражение дает обоих генов. Однако если секрецию белка и Посттрансляционная модификация оборудования узла выражение перегружены с выраженной рекомбинантных белков, секретируемые рекомбинантных белков может не адекватные изменения, особенно гликозилирования. Как изменение векторов были использованы успешно выразить многочисленные завод выделительные протеины11,12,26, многие из которых, как правило, агрегат, который, вероятно, из-за неправильной или недостаточной гликозилирования. Таким образом для выражения этих сложных белков, обе последовательности пептид сильного и слабого сигнала должны быть проверены и качество выраженной рекомбинантных белков необходимо сравнить. Имейте в виду, что последовательность пептид слабый сигнал будет снизить урожайность белка; Однако это может дать механизма секреции принимающего выражение достаточно потенциала для обработки секрецию белка и модификации.

Помимо выражения гетерологичных секретируемые белков в клетках насекомых клеток млекопитающих и систем выражение клеток растений успешно использовались в гиперэкспрессия рекомбинантного млекопитающих и растительных белков, соответственно27, 28,29. По сравнению с гетерологичных систем, вблизи эндогенного выражение состояния млекопитающих или белки выделяется завод будет иметь почти родной модификации механизмов в клетки хозяина давать хорошо сложенный белков. Ограничение использования системы почти родной выражение является, что выраженную рекомбинантных белков может мешать физиологические функции клеток, которые потенциально могут оказывать неблагоприятное воздействие на урожайность окончательное выражение белков.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Эта работа была поддержана новый факультет запуска средства от университета штата Северная Каролина сайта для Guozhou Xu.

Materials

Name Company Catalog Number Comments
Incubator shaker VWR Model Excella E25 27 oC
Incubator VWR Model 2005 27 oC
Centrifuge BECKMAN Model J-6 with a swing bucket rotor
Herculase II Fusion DNA Polymerase Agilent 600677-51 For PCR amplification of DNA
Thermal Cycler BIO-RAD Model C1000 Touch For PCR amplification of DNA
Incubator shaker New Brunswick Scientific Model I 24 For growing baceria culture
Customer DNA synthesis GENSCRIPT
BamHI (HF) New England Biolabs R3136S Restriction Endonuclease
BglII New England Biolabs R0144S Restriction Endonuclease
NotI (HF) New England Biolabs R3189S Restriction Endonuclease
XhoI New England Biolabs R0146S Restriction Endonuclease
T4 DNA ligase New England Biolabs M0202T DNA ligation
QIAquick Gel Extraction Kit Qiagen 28704 DNA purification from Agorase gel
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid DNA purification from bacteria culture
Agarose Thermo Fisher Scientific 15510-019 For DNA gel electropherosis
MAX Efficiency DH5α competen cell Invitrogen 18-258-012 For transformation of DNA ligation mixture
Lennox L LB Broth Research Product International Corp. L24066-5000.0 For making bacteria culture
Ampicillin sodium salt Thermo Fisher Scientific 11593-019 Antibiotics
Kanamycin Sulfate Thermo Fisher Scientific 15160-054 Antibiotics
Tetracycline Thermo Fisher Scientific 64-75-5 Antibiotics
Gentamicin Thermo Fisher Scientific 15710-064 Antibiotics
MAX Efficiency DH10Bac competent cells Thermo Fisher Scientific 10361-012 For making bacmid DNA
S.O.C. Medium Thermo Fisher Scientific 15544-034 For DNA transformation
CellFECTIN II Reagent Thermo Fisher Scientific 10362-101 Insect cell transfection reagent
Bac-to-Bac Expression System Thermo Fisher Scientific 10359-016 Baculovirus-insect cells expression kit
Bluo-gal Thermo Fisher Scientific 15519-028 For isolation of recominant Bacmid DNA
IPTG Thermo Fisher Scientific 15529-019 For isolation of recominant Bacmid DNA
pFastBac1 Thermo Fisher Scientific 10360014 Baculorirus expression vector
Sf9 cells Thermo Fisher Scientific 11496015 Sf9 monolayer cells
Hi5 cells Thermo Fisher Scientific B85502 High Five insect cells
Grace’s insect medium, unsupplemented Thermo Fisher Scientific 11595030 Sf9 cell transfection minimum medium
Grace’s insect medium, supplemented Thermo Fisher Scientific 11605102 Sf9 monolayer cell culture complete medium
Sf-900 II SFM Thermo Fisher Scientific 10902104 Sf9 suspension cell culture medium without FBS
Express Five SFM Thermo Fisher Scientific 10486025 Hi5 cell culture medium
Penicillin-Streptomycin Thermo Fisher Scientific 15140122 100 ml (10,000 I.U./ml)
L-Glutamine (200 mM) Thermo Fisher Scientific 25030081 100 ml
FBS Certified Thermo Fisher Scientific 16000-044 500 ml
6-well plates Thermo Fisher Scientific 08-772-1B Flat-bottom
150 mm plates Thermo Fisher Scientific 353025 100/case
1.5 ml Microcentrifuge Tubes USA Scientific 1415-2500 500 tubes/bag
15 ml conical screw cap centrifuge tubes USA Scientific 1475-0511 25 tubes/bag
50 ml conical screw cap centrifuge tubes USA Scientific 1500-1211 25 tubes/bag
Ni-NTA Superflow Qiagen 30430 NiNTA resin
pH-indicator strips EMD Millipore Corporation 1.09535.0001 pH 0 - 14

DOWNLOAD MATERIALS LIST

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317 (2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796 (2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics