שינוי Baculovirus וקטורים ביטוי לייצר מופרש צמח חלבונים בתאי חרקים

JoVE Journal
Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

כאן, אנו מציגים את הפרוטוקולים עבור ניצול של חרקים תא baculovirus חלבון ביטוי ומערכת לייצר כמויות גדולות של חלבונים צמח מופרש על התגבשות חלבון. וקטור ביטוי baculovirus השתנה עם GP67 או hemolin חרקים פפטיד אות לביטוי הפרשת חלבון צמחי בתאי חרקים.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

זה כבר אתגר עבור מדענים לבטא הפרשה האיקריוטים חומרים ללימודי הביוכימי מבניים. מערכת ביטוי בתיווך baculovirus תא חרקים היא אחת ממערכות שנועדה להביע האיקריוטים הפרשה חומרים עם מספר שינויים post-translational. הפרשה החלבונים צריכים להיות מנותב המסלולים הפרשה גליקוזילציה חלבון, היווצרות חוב דיסולפידי של שינויים post-translational אחרים. כדי לשפר את הביטוי תא חרקים הקיים של פרוטאינים צמחיים הפרשה, וקטור ביטוי baculovirus הוא שונה על-ידי התוספת של או GP67 או hemolin אות פפטיד רצף בין מקדם אתרים שכפול מרובה. מערכת זו וקטור שונה שעוצבו לאחרונה הפיקה בהצלחה תשואה גבוהה של חלבונים מסיסים צמח המופרש רקומביננטי קולטן של תודרנית לבנה. שני החלבונים צמח ביטוי, התחומים חוץ-תאי של קולטני ממברנה פלזמה תודרנית TDR ו- PRK3, היו גיבש ללימודי לחקר הגבישים רנטגן. מערכת וקטור ששונה הוא כלי משופרת פוטנציאל שיכול לשמש עבור הביטוי של חומרים הפרשה בממלכת החיות גם כן.

Introduction

זה הכרחי עבור מעבדת מחקר להיות מסוגל לייצר כמויות גדולות של חומרים הומוגנית על אפיוני הביוכימי, biophysical, במיוחד ללימודי לחקר הגבישים רנטגן. ישנן מערכות רבות ומבוססת ביטוי heterologous כגון Escherichia coli, שמרים, בתאי חרקים, בתרבית של תאים, תאי צמחים, וכו ביניהם, מערכת ביטוי בתיווך baculovirus תא חרקים היא אחת ביותר נפוץ טכניקות לייצר כמויות גדולות של מבנית מקופל גדול בגודל האיקריוטים חומרים עבור התגבשות חלבון1.

הווקטורים ביטוי במערכת הביטוי baculovirus מתוכננים להכיל polyhedrin חזק או יזם P10 לייצר תשואה גבוהה של חלבונים תאיים רקומביננטי2,3. כדי להפוך את baculovirus רקומביננטי, הגן עניין שוכפל לתוך וקטור חרקים המכיל את לוקוס polyhedrin (polh) של הגנום מולטי-nucleopolyhedroviral Autographa קליפורניה הבונה וכתוצאה מכך הוא ואז וסודרו ולאמת את המסגרת הנכונה קריאה פתוחה (ORF). הבונה הנכון ואז מוחדרים התא המארח חרקים בתהליך של תרביות תאים. הגן עניין מוכנס לתוך הגנום הנגיפי מאת רקומבינציה הומולוגית. אירוע זה תוצאות בייצור של הגנום הנגיפי רקומביננטי, אשר משכפל ואז לייצר רקומביננטי budded חלקיקי וירוס1.

התאים חרקים המשמשים בדרך כלל במערכת הביטוי הם תאים (Hi5) Sf9 וגבוהה חמש. תאים Sf9 הם בידוד המשובטים של Sf21, נגזר מן התאים השחלות הגולמי של זחל כנימה frugiperda, והם Hi5 תאים בידוד המשובטים נגזר הורים Trichoplusia ni תא השחלות קו TN-3684,5. Transfections שיתוף וירוס הגברה, מבחני פלאק מתנהלים על תאים Sf9, ואילו תאים Hi5 נבחרו בדרך כלל לייצר כמויות גבוהות של חומרים6. ראוי לציין כי התאים Hi5 אינם מתאימים עבור דור ו הגברה של וירוס progenies נטייתם לייצר וירוסים מוטציה. באופן מסורתי, טווח טמפרטורה 25-30 מעלות צלזיוס נחשבת טובה לגידול תאים חרקים. עם זאת, דווח שיש 27-28 מעלות צלזיוס טמפרטורה אופטימלית עבור תא חרקים וצמיחה של זיהום7,8.

המבוא של רצף קליטה טובה שקדמו הגן נדרש עבור הביטוי גבוהה של החלבונים המופרש. הרצף אות ביעילות ידריך את חלבון רקומביננטי מתורגם לתוך רשתית תוך-פלזמית עבור הפרשת חלבונים ושינויים post-translational הכרחי עבור קיפול תקין וייצוב3. האות פפטיד רצפים, כגון אופפים baculovirus חלבון GP64/67, דבורת דבש melittin ואחרים, נבחרו כדי להקל על הביטוי של הפרשה חומרים של מערכות ביטוי בתיווך baculovirus3. המבוא של פפטיד האות של GP67 הוכח לשפר את התשואה ביטוי של חלבון רקומביננטי המופרש, לעומת שימוש של פפטיד אות מהותי של ג'ין היעד9. Hemolin הוא חלבון hemolymph של ענק משי העש Hyalophora cecropia, המושרה על זיהום חיידקים10. בשל רמה גבוהה יחסית של ביטוי מושרה, אות פפטיד רצף הגן יכול לשמש כדי לתווך הביטוי הפרשה חומרים במערכת baculovirus-חרק תא.

לבנה א Tracheary רכיב בידול מעכבות פקטור קולטן (TDR) ואבקה קולטן קינאז 3 (PRK3) שניהם שייכים למשפחת חוזר קולטן דמוי קינאז (LRR-RLK) צמח לאוצין-עשיר של חלבונים11,12 . כדי ללמוד את המבנה והתפקוד של משפחה זו של קולטן פרוטאינים צמחיים, כמו גם כדי להקל על אפיון הביוכימי מבניים אחרים פרוטאינים צמחיים מופרש למערכת ביטוי תא baculovirus-חרק שונתה כדי לשפר את התשואה איכות, ייצור חלבונים. חוץ-תאית לתחומי TDR והן PRK3 בהצלחה כבר הביעו באמצעות שני וקטורים ביטוי שונה במערכת הביטוי תא baculovirus-חרק. יש כבר גיבש בשני תחומים חוץ-תאית החלבונים TDR ו- PRK3. מאמר זה מדווח את הביטוי ואת טיהור של כמויות גדולות של חלבונים רקומביננטי צמח מופרשים עם שני baculovirus ששונה ביטוי וקטורים על ידי שילוב של GP67 או hemolin אות רצף בין יזם את שיבוט מרובים אתרים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

הערה: מערכת תא חרקים/baculovirus עם ביטוי שונה וקטורים עבור ביטוי חלבון צמחי הפרשה וגיבוש משמש.

1. שינוי של וקטור הביטוי Baculovirus עם פפטיד אות GP67 לביטוי הפרשת חלבון צמחי

  1. לסנתז קטע DNA המכיל של 5' BglII חיתוך האתר13הרצף אות הפרשת GP67, אתר רב-שיבוט עם NotI, BamHI, EcoRI, StuI, סאלי, SpeI, XbaI, PstI ו XhoI (איור 1 א').
    הערה: מאז הן BglII והן BamHI מתעכל דנ א הביא הקצוות דבק אותו, הווקטור ליניארית ניתן מאתרים ומפסיקים למקטע הדנ א מתעכל בעוד אתרים הן BglII והן BamHI ברצף מצדו annealed מוטציה רצף שאינו cleavable על ידי או BglII או BamHI14.
  2. תקציר 4 µg של ה-DNA עם BglII, XhoI, µg 4 של וקטור ביטוי DNA עם BamHI ו- XhoI14. לערבב 10 יחידות של כל אנזים הגבלה עם דנ א ב 1 x ריכוז מאגר התגובה (אצטט אשלגן 50 מ מ, 20 מ מ טריס-אצטט אצטט מגנזיום 10 מ מ, 100 µg/mL BSA, pH 7.9 25 ° c), דגירה התערובת ב 37 מעלות צלזיוס במשך 4 שעות.
    1. לטהר את מקטע ה-DNA נכרת, הווקטור ליניארית DNA על-ידי ערכת15החילוץ ג'ל הדנ א.
  3. מיקס 100 ננוגרם של וקטור ליניארית DNA עם 400 ננוגרם של ה-DNA מתעכל קטע בתוך תערובת התגובה מצדו 10-µL המכילה 1-T4 DNA ליגאז התגובה מאגר (50 מ מ טריס-HCl, 10 מ מ MgCl2, 1 מ מ ATP ו- 10 מ"מ. DTT, pH 7.5 ב- 25 ° C) ו- 5 יחידות של ה-DNA T4 ליגאז. דגירה תערובת התגובה ב 16 ° C עבור 16 h.
  4. להפוך µL 5 של תערובת מצדו µL 100 DH5α תאים המוסמכת בעקבות פרוטוקול סטנדרטי טרנספורמציה ובחר את המושבות המתקבלת על מטוס צלחת אגר אמפיצילין-LB16. לאסוף 5-10 מושבות ולגדול כל המושבה ב 2 מ ל LB בינוני המכיל אמפיצילין µg/mL 100 ב 220 סל ד ו- 37 מעלות צלזיוס חממה חזק עבור 16 h.
  5. תמצית כל פלסמיד DNA עם ערכת miniprep17 דנ א ואשר השיבוטים מאת רצפי DNA עם פריימר AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-להגביר הגן TDR לבנה א קטע קידוד שאריות 30-642 מן הגן TDR סינתטי לבנות (קדימה פריימר: פול GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, פריימר הפוכה: GC GGATCC CTA חברתנו חברתנו ATG חברתנו חברתנו חברתנו ACCGTCTATATCTGCATTTCCGGC). להגביר את ה-DNA 30 מחזורים במאגר תגובת ה-DNA פולימראז המכיל תערובת dNTP 0.5 מ מ, 0.2 µM תחל, µg 0.1 של תבנית ה-DNA, MgCl 0.4 מ מ2ו- 1 יחידה התגובה של ה-DNA פולימראז.
    1. עבור הצעדים מחזור ה-PCR, להגדיר את דנטורציה הראשונית ב 95 ° C ל 30 s ולאחר מכן 30 מחזורים של דנטורציה ב 95 ° C ל 30 s, חישול ב 55 ° C s 30, ואת סיומת ב-72 מעלות עבור 1 דקות, עם סיומת הסופי ב-72 מעלות במשך 5 דקות.
  7. לעכל את מקטע ה-PCR והן וקטור שונה עם אנזימי הגבלה endonuclease NotI ו- BamHI. מאתרים ומפסיקים את השבר ג'ין עם וקטור ליניארית. מיקס 100 ננוגרם של וקטור ליניארית DNA עם 400 ננוגרם של ה-DNA מתעכל קטע בתוך תערובת התגובה מצדו 10-µL T4 DNA ליגאז התגובה מאגר המכיל 5 יח ל T4 DNA ליגאז. דגירה תערובת התגובה ב 16 ° C עבור 16 h.
  8. להפוך µL 5 של תערובת מצדו µL 100 DH5α תאים המוסמכת בעקבות פרוטוקול סטנדרטי טרנספורמציה ובחר את המושבות המתקבלת על מטוס צלחת אגר אמפיצילין-LB16. לאשר את השיכפולים הנכונה על ידי רצפי DNA.

2. שינוי של וקטור הביטוי Baculovirus עם פפטיד אות חרקים Hemolin לביטוי הפרשת חלבון צמחי

  1. לסנתז קטע DNA המכיל של 5' BglII חיתוך האתר13, הרצף אות הפרשת hemolin חרקים ו אתר רב-שיבוט עם NotI, BamHI, EcoRI, StuI, סאלי, SpeI, XbaI, PstI ו XhoI (איור 1B).
  2. תקציר 4 µg של ה-DNA עם BglII, XhoI, µg 4 של וקטור ביטוי DNA עם BamHI ו- XhoI14. לערבב 10 יחידות של כל אנזים הגבלה עם דנ א ב 1 x ריכוז מאגר התגובה (אצטט אשלגן 50 מ מ, 20 מ מ טריס-אצטט אצטט מגנזיום 10 מ מ, 100 µg/mL BSA, pH 7.9 25 ° c), דגירה התערובת ב 37 מעלות צלזיוס במשך 4 שעות.
    1. לטהר את מקטע ה-DNA נכרת, הווקטור ליניארית DNA על-ידי ערכת15החילוץ ג'ל הדנ א.
  3. מיקס 100 ננוגרם של וקטור ליניארית DNA עם 400 ננוגרם של ה-DNA מתעכל קטע בתוך תערובת התגובה מצדו 10-µL המכילה 1-T4 DNA ליגאז התגובה מאגר (50 מ מ טריס-HCl, 10 מ מ MgCl2, 1 מ מ ATP ו- 10 מ"מ. DTT, pH 7.5 ב- 25 ° C) ו- 5 יחידות של ה-DNA T4 ליגאז. דגירה תערובת התגובה ב 16 ° C עבור 16 h.
  4. להפוך µL 5 של תערובת מצדו µL 100 DH5α תאים המוסמכת ובחר את המושבות על צלחת אגר אמפיצילין-LB. לאסוף 5-10 מושבות ולגדול כל המושבה במדיום LB 2-mL המכיל 100 µg/mL של אמפיצילין-220 סל ד ו- 37 מעלות צלזיוס חממה חזק עבור 16 h.
  5. לחלץ את הדנ א פלסמיד עם ערכת miniprep17 דנ א ואשר השיבוטים מאת רצפי DNA עם פריימר AGTATTTTACTGTTTTCGTAACAG.
  6. להגביר את-PCR לבנה א אבקה קולטן קינאז 3 (PRK3) ג'ין פרגמנט קידוד שאריות 20-237 מ בונה ג'ין PRK3 סינתטי (קדימה פריימר: פול GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, פריימר הפוכה: CGC GGATCC CTA חברתנו חברתנו ATG חברתנו חברתנו חברתנו TGAAGGTTTCTCATCGCATTCTATATTC). להגביר את ה-DNA 30 מחזורים במאגר תגובת ה-DNA פולימראז המכיל תערובת dNTP 0.5 מ מ, 0.2 µM תחל, µg 0.1 של תבנית ה-DNA, MgCl 0.4 מ מ2ו- 1 יחידה התגובה של ה-DNA פולימראז.
    1. עבור הצעדים מחזור ה-PCR, להגדיר את דנטורציה הראשונית ב 95 ° C ל 30 s ולאחר מכן 30 מחזורים של דנטורציה ב 95 ° C ל 30 s, חישול ב 55 ° C s 30, ואת סיומת ב-72 מעלות ל 30 s בתוך כל מחזור, והסיומת הסופי ב-72 מעלות במשך 5 דקות.
  7. לעכל את מקטע ה-PCR והן וקטור שונה עם אנזימי הגבלה endonuclease NotI ו- BamHI. מאתרים ומפסיקים את השבר ג'ין עם וקטור ליניארית. מיקס 100 ננוגרם של וקטור ליניארית DNA עם 400 ננוגרם של ה-DNA מתעכל קטע בתוך תערובת התגובה מצדו 10-µL T4 DNA ליגאז התגובה מאגר המכיל 5 יח ל T4 DNA ליגאז. דגירה תערובת התגובה ב 16 ° C עבור 16 h.
  8. להפוך µL 5 של תערובת מצדו µL 100 DH5α תאים המוסמכת בעקבות פרוטוקול סטנדרטי טרנספורמציה ובחר את המושבות המתקבלת על מטוס צלחת אגר אמפיצילין-LB16. לאשר את השיכפולים הנכונה על ידי רצפי DNA.

3. ייצור, הגברה של Baculovirus בונה מחסה בקלטת ביטוי חלבון רקומביננטי

  1. שימוש 100 ננוגרם של פלסמיד לבנות להפוך µL 40 תאי המוסמכת DH10Bac בעקבות הפרוטוקול של מערכת ביטוי baculovirus1. דגירה הלוחות טרנספורמציה ב 37 מעלות צלזיוס במשך 48 שעות.
  2. לאסוף שתי מושבות לבן של כל צלחת טרנספורמציה, לחסן כל המושבה לתוך 2 מ ל LB בינוני המכיל 50 µg/mL kanamycin, גנטמיצין µg/mL 7 ו- 10 µg/mL טטרציקלין. לפי התקנון של baculovirus ביטוי מערכת1 כדי לחלץ ולוודא את bacmid ה-DNA. Aliquot כל DNA שני צינורות עם 20 µL כל אחד, ולאחסן את הצינורות ב-20 ° C.
    הערה: השלבים הבאים מחייבים פעולה אספטי.
  3. לגדול עם טפט של תאים Sf9 האנטיביוטיקה פניצילין-סטרפטומיצין תרבות המדיה עם 10% סרום שור עוברית (FBS) ו- 100 µg/mL (או 100 I.U./mL) ב 27 ° C 80% זרימה לתוך צלחת 6-. טוב. להעריך את אחוז הנהרות בהתאם לאחוז אזור מכוסה בצלחת תרביות רקמה.
  4. הכינו את הפתרונות הבאים לפי שני צינורות סטרילי 1.5-mL צנטריפוגה.
    1. צינור 1: עבור כל תרביות תאים, למהול 20 µL של bacmid ה-DNA לתוך µL 100 unsupplemented Sf9 תא תרבות בינוני ללא אנטיביוטיקה. מערבבים בעדינות הדילול על ידי מצליף את הצד של הצינור.
    2. צינור 2: עבור כל תרביות תאים, לדלל 8 µL של השומנים תרביות תאים ריאגנט לתוך µL 100 unsupplemented Sf9 תא תרבות בינוני ללא אנטיביוטיקה. לערבב הדילול ביסודיות על ידי pipetting למעלה ולמטה עבור 6 x.
  5. לשלב את שני פתרונות, מערבבים בעדינות על-ידי pipetting לאט לאט מעלה ומטה עבור 3 x ולאחר תקופת דגירה אותם של 20-40 דקות בטמפרטורת החדר.
  6. תשטוף כל טוב של טפט Sf9 תאים 2 x 3 מ של unsupplemented Sf9 תא תרבות בינונית ללא אנטיביוטיקה. עבור כל תרביות תאים, להוסיף 0.8 מ של unsupplemented Sf9 תא תרבות בינונית ללא אנטיביוטיקה כל שפופרת המכילה את התערובת השומנים-DNA. לערבב בעדינות את התוכן של הצינורות על ידי pipetting לאט לאט מעלה ומטה עבור 3 x. האחות שטיפת המדיה מן הלוחות, כיסוי הדגימות עם התערובת תרביות תאים.
  7. לאחר התוספת של התערובת תרביות תאים, דגירה את הצלחת transfected עבור 5 שעות ב-27 º c להחליף את המדיה תרביות תאים המדיום מלאה של תרבות תא Sf9 המכיל 10% FBS ו µg 100/mL (או 100 I.U./mL) האנטיביוטיקה פניצילין-סטרפטומיצין. דגירה את הצלחת transfected ב 27 ° C עבור 4 d.
  8. הקציר ומגבירים את baculovirus רקומביננטי.
    1. לאסוף את תגובת שיקוע של צלחת נגוע צינור חרוטי 15-mL סטרילית לאחר 4 d של דגירה. לסובב את תגובת שיקוע ב x 1010 g עבור 5 דקות כדי להסיר את שאריות תאים. למחוק בגדר decant את תגובת שיקוע על צינור נקי, לאחסן אותו ב 4 ° C עד 1 שנה.
      הערה: זהו וירוס P0. זה יכול להיות aliquoted ומאוחסן ב-80 מעלות צלזיוס לתקופה ארוכה יותר של זמן.
    2. כדי להגביר את כל וירוס רקומביננטי, לגדול טפט של תאים Sf9 על צלחת 150-מ מ 80% הנהרות. האחות התקשורת מהצלחת, להוסיף 2 מ"ל של הנגיף P0 כנצרות תאים לצלחת, דגירה את הצלחת. בשביל 1 h בחממה 27 ° C. סלע את הצלחת כל 15 דקות לערבב את המדיום עם התאים.
      1. להוסיף 25 מ של המדיה של גרייס מלא המכיל 10% FBS ו µg 100/mL (או 100 I.U./mL) האנטיביוטיקה פניצילין-סטרפטומיצין. דגירה את הצלחת. בשביל בתלת-ממד בחממה 27 ° C כדי להשיג את הוירוס מעבר P1.
    3. לאסוף את תגובת שיקוע של צלחת נגוע סטרילי 50-mL צינור חרוטי ו ספין-x 1010 g עבור 5 דקות כדי להסיר את שאריות תאים. Decant את תגובת שיקוע על צינור נקי ואחסן אותו ב 4 ° C עד 1 שנה.
      הערה: הווירוס P1 ניתן aliquoted מאוחסנת ב- 80 ° C לתקופה ארוכה יותר של זמן.
    4. כדי להגביר את הווירוס מ- P1 ל- P2 המעבר, לגדול טפט של תאים Sf9 על צלחת 150-מ מ 90% הנהרות, תשאף התקשורת של הצלחת, להוסיף 2 מ"ל של הנגיף P1 לצלחת, תקופת דגירה זה של 1 ש ח בחודש חממה 27 ° C.
    5. חזור על שלבים 3.8.2 ו 3.8.3 כדי להשיג את הקטעים P2, P3 של וירוסים. אל תאחסן את הוירוס P3 ליותר מ- 2 חודשים.

4. חלבון ביטוי, טיהור עם נינטה, התגבשות

  1. תרבות 1 ליטר בתאי חרקים Hi5 האנטיביוטיקה פניצילין-סטרפטומיצין תרבות המדיה עם µg 100/mL (או 100 I.U./mL) על צפיפות של 2 x 106 -100 סל"ד ב שייקר אינקובטור 27 ° C. ספין למטה התאים ב x 570 גרם במשך 5 דקות, decant את תגובת שיקוע, resuspend התאים 20 מ"ל של הנגיף P3 טריים המיוצרים ולשמור אותו בטמפרטורת החדר עבור ה 1 לנער בעדינות את הבקבוק ספין כדי resuspend את התאים 1 x כל 15 דקות.
  2. להעביר את התאים 1 ליטר של תרבות התקשורת עם µg 100/mL (או 100 I.U./mL) סטרפטומיצין פניצילין אנטיביוטיקה, התרבות התאים ב 100 סל"ד ב שייקר אינקובטור 27 ° C עבור ה 72 ספין למטה התאים ב 1,010 x g למשך 5 דקות ולאסוף את תגובת שיקוע.
  3. מחוון ה-pH השתמש רצועות כדי להתאים את ה-pH של תגובת שיקוע כדי 8.0 על-ידי הוספת 0.1 M HCl או 0.1 M NaOH ולהוסיף איגוד מאגר-ריכוז סופי, המכיל מאגר טריס 20 מ מ ב- pH 8.0, 100 מ מ NaCl, ו- 5 מ מ imidazole. להוסיף כמות מסוימת של שרף נינטה (10-40 מ"ל) מבוסס על התשואה המשוערת של ביטוי שלו מתויג רקומביננטי החלבון.
    1. לערבב הפתרון על מהומה מגנטי עם מהירות נמוכה ב 4 ° C עבור 1 ח' שטיפת השרף, elute החלבון מאוגד בעקבות תקן נינטה טיהור פרוטוקול18.
  4. נושא החלבון מטוהרים יונים, ג'ל סינון כרומטוגרפיה, כמו גם שיטות טיהור אחרות חלבון, להניב מדגם הומוגני.
    הערה: עבור ectodomain TDR, 20 מ מ. טריס, pH 8, 100 מ מ NaCl שימשו בתור מאגר סינון ג'ל. עבור ectodomain PRK3, 20 מ מ bis-טריס, ה-pH 6, 100 מ מ NaCl שימשו המאגר סינון ג'ל המועדפת.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

כפי שמוצג באיור1, שני וקטורים הביטוי baculovirus pFastBac1 ששונה שימשו כדי לבטא את החלבונים מופרשים עם GP67 או את רצף אות hemolin להחליף את האות מהותי רצף הגן היעד. את GP67 ויראלי, הגנים hemolin חרקים הוכחו יש רמות הביטוי הפרשת גבוהה בתאים. פיוז'ן חלבונים עם אחת משתי אלה שני סיקוונסים אות צפויים שיפרנו בגדול רמות הביטוי של הפרשה. זהים שבאתרים מרובים שיבוט (MCS) היו הנדסה לאחור באלה שני וקטורים ששונה. אתר NotI הונח בכוונה ביותר 5'-צידי MCS, בגלל NotI יש רצף שמונה-נוקלאוטיד מאשר את רצף שש-נוקלאוטיד הנפוץ ביותר נוכח באתרים מגבלת רבים נוספים. ככזה, אתר NotI קיים פחות הגנים היעד מאשר רוב הגבלת אתרים אחרים, עיכול הגבלה וקפה השיבוט של רוב הגנים יעד ריאלי יותר לעומת שימוש באתרים מגבלת אחרים. שיבוט הגן יעד בין NotI את אתר ההגבלה במורד הזרם תציג רק שלושה חומצת אמינו משקעים, GGR, מקדים את הגן היעד.

PBac1-GP67 של pBac1-שולי כבר נעזרו בהצלחה לבטא את התחומים חוץ-תאי של קולטני לבנה א TDR ו- PRK3, בהתאמה (איור 2). לאחר חומרים היו מטוהרת על-ידי נינטה באמצעות תג 6-היסטידין C-טרמינל הנדסה, התשואה הממוצעת חלבון היה עקבי סביב 20 מ ג/ליטר של Hi5 תאים. הטוהר של כל חלבון הוא קרוב או גבוה יותר מ- 50%, בחן ועם מרחביות-דף Coomassie מכתים.

חומרים חוץ-תאית קבוצות המחשבים של TDR ו PRK3 היו עוד יותר טהור לפי גודל אי-הכללה של כרומטוגרפיה (איור 2). חלבון מטוהרים היה מרוכז עד 5 מ"ג/מ"ל, אז נתון התגבשות הקרנה. התנאים, אשר הניבו גבישים ראשוני של כל חלבון, אופטימציה עד חלבון קריסטלים עם גודל גדול יותר 20 מיקרומטר נצפו (איור 3). המבנים קריסטל של שני חלבונים כבר דווח על11,12.

Figure 1
איור 1: מפות של הווקטורים ששונה pFastBac1. רצפי דנ א המוצגים בלוחות אלה נוספו במורד הזרם של האמרגן polyhedrin של וקטור pFastBac1, להחזיק את רצף פפטיד אות ואת האתרים שיבוט מרובים (MCS) עבור היעד גנים. שני וקטורים להכיל את MCS אותו. (א) בלוח זה הופעות רצף של האתרים שיבוט במורד הזרם של האמרגן polyhedrin ב וקטור pBac1-GP67. מתורגם GP67 אות פפטיד חומצת אמינו הרצף הוא בצבע אדום. כל אתר ייחודי הגבלה ב MCS מסומנת בקו תחתון, עם השם של אתר שכותרתו לעיל. (B) לוח זה מציג רצף של האתרים שיבוט במורד הזרם של יזם polyhedrin הווקטור pBac1-שולי. הרצף חומצה אמינית אות hemolin מתורגמת פפטיד הוא בצבע אדום. כל אתר ייחודי הגבלה ב MCS מסומנת בקו תחתון, עם השם של אתר שכותרתו לעיל. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: ביטוי חלבון עם הווקטורים ששונה pFastBac1 במערכת baculovirus-חרק תא. (א) ectodomain של TDR מבוטא בתאי חרקים Hi5, מטוהרת על-ידי גזים אי-הכללה של ניקל-זיקה וגודל (S), ותוקנו על ג'ל מרחביות-דף. השרף ניקל נשטפה פעם מאגר המכיל 5 מ מ imidazole (שטיפת 1), ופעם שניה עם 20 מ מ imidazole (לשטוף 2). (B) זהו ניתוח מרחביות-דף מציג את הביטוי ואת טיהור זיקה ניקל (נינטה), כמו גם גודל אי-הכללה של ביולוגיה מולקולרית של ectodomain PRK3. מולקולרית משקל (MW) סמנים עם הגודל המתאים מסומנות. החיצים האדומים בלוח כל מציינות את הביטויים ואת הצפוי בגדלים רקומביננטי TDR PRK3 ectodomain חלבונים. הלהקה רב אופיים של ביטוי החלבונים הם ככל הנראה בגלל גליקוזילציה הטרוגנית. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: חלבון גבישים של התחומים חוץ-תאי של תודרנית לבנה TDR ו- PRK3. (א) לוח זה מראה הקריסטלים חלבון לתחומי לבנה א TDR חוץ-תאית. (ב) הלוח זה מראה את הקריסטלים חלבון קבוצות המחשבים חוץ-תאי של לבנה א PRK3. סרגל קנה מידה מוצג מתחת לכל תמונה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

לאור המגוון גודל ויציבות של אלפי חלבונים המצויים המערכות הביולוגיות, זה לעיתים קרובות אמפירי עבור מחקר מעבדה כדי להחליט באיזו מערכת ביטוי heterologous יש שייבחרו עבור הביטוי של חלבון ספציפי. מערכת ביטוי e. coli היא לעיתים קרובות הבחירה הראשונה עבור ביטוי חלבון עקב מחזור החיים הקצר של החיידקים, עלות נמוכה של תרבות התקשורת, וכן בקלות יחסית את קנה המידה19. עבור הביטוי של חלבונים האיקריוטים גדול עם גדלים יותר מ- kDa 60, עם זאת, משתמש של e. coli מערכת לעתים קרובות התוצאות חלבונים לא מסיסים הכללה או צבירת20. לביטוי החלבונים האלה קשה, חלבונים על ידי אחרות, מערכת ביטוי תא baculovirus-חרק עשוי להיות יתרון יותר מאשר קולי. במיוחד כאשר המבטאים חלבונים האיקריוטים המופרש, מערכת זו ביטוי שונה baculovirus-חרק תא יכול להיות הבחירה המועדפת.

חלבונים האיקריוטים על ידי רבים, כולל צמח מופרש חלבונים, צורך גליקוזילציה מורכבים, היווצרות דיסולפידי ובשינויי post-translational אחרים במהלך קיפול והפרשת חלבון21. E. coli מערכות אין את מכונות הסלולר כדי לעבד את השינויים המורכבים הדרושים עבור רבים של חלבונים האיקריוטים22. שמרים יש מערכת גליקוזילציה יחסית מתקדם יותר מ- e. coli23. עם זאת, עבור הביטוי של החלבונים המופרש המינים האיקריוטים העליונים, צמחים, מערכת baculovirus-חרק תא מציג יתרון משמעותי. מאז גליקוזילציה משפיע על קיפול חלבונים, יציבות24, רבים חומרים מופרשים לידי ביטוי מערכות e. coli ו שמרים יש תשואה נמוכה, נוטים לצבור, ככל הנראה בשל קיפול חלבונים שגוי. מערכת baculovirus-חרק שונתה כדי לשפר את החלבון גליקוזילציה, מה שהופך אותו מערכת אידיאלית עבור הביטוי של חלבונים האיקריוטים המופרש25. במחקר זה, גם את GP67 וגם את hemolin אות פפטידים שימשו בהצלחה להנחות את הביטוי הפרשת של שני חלבונים קולטן צמח על התגבשות חלבון. עם מחקרים אלה בראש, הבחירה של פפטיד אות גם הוא שלב קריטי, וצריך שיטתית יותר מחקרים השוואתיים עם קבוצת היעד גנים של אורגניזמים שונים.

הרעיון של שימוש פפטידים האות הן GP67 והן hemolin כדי לשפר את הביטוי הפרשת חלבון היה מונע על ידי הירידה בתשואות גבוהות ביטוי של שני גנים. עם זאת, אם הפרשת החלבון ואת השינוי posttranslational מכונות של המחשב המארח ביטוי עמוסים עם ביטוי החלבונים רקומביננטי, מופרשים חומרים לא ייתכן שינויים נאותים, במיוחד גליקוזילציה. שני וקטורים ששונה שימשו לבטא בהצלחה רבים צמח חלבונים הפרשה11,12,26, שרבים מהם נוטים הצבירה, אשר ככל הנראה בשל גליקוזילציה שגוי או לא מתאימות. לכן, עבור הביטוי של אלה חלבונים קשה, שני רצפים פפטיד אות חזק וחלש צריך להיבדק, האיכות של החלבונים רקומביננטי ביטוי צריך להשוות. יש לזכור כי רצף פפטיד האות חלש תפחית את התשואה הכוללת של החלבון; עם זאת, זה עשוי לתת המכונות הפרשת של המחשב המארח ביטוי מספיק קיבולת כדי לעבד את הפרשת חלבונים ושינויים.

בנוסף הביטוי של heterologous מופרשים חלבונים בתאי חרקים בתרבית של תאים ומערכות הביטוי צמח תא השתמשו בהצלחה ביטוי של יונקים רקומביננטי, פרוטאינים צמחיים, בהתאמה27, 28,29. לעומת המערכות heterologous, הביטוי אנדוגני ליד מצבו של מידע של יונקים או את החלבונים צמח מופרש יהיו machineries שינוי כמעט צברית את התאים מארח להניב חלבונים מקופלת היטב. אזהרה של שימוש במערכת קרובה לשפת אם הביטוי הוא ביטוי החלבונים רקומביננטי עלולים להפריע תפקוד התאים, אשר פוטנציאל עשויה להיות השפעה שלילית על התשואה ביטוי הסופי של החלבונים פיזיולוגיים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

עבודה זו נתמכה על ידי הקרנות הפעלה סגל החדשות של צפון קרוליינה סטייט עבור שו Guozhou.

Materials

Name Company Catalog Number Comments
Incubator shaker VWR Model Excella E25 27 oC
Incubator VWR Model 2005 27 oC
Centrifuge BECKMAN Model J-6 with a swing bucket rotor
Herculase II Fusion DNA Polymerase Agilent 600677-51 For PCR amplification of DNA
Thermal Cycler BIO-RAD Model C1000 Touch For PCR amplification of DNA
Incubator shaker New Brunswick Scientific Model I 24 For growing baceria culture
Customer DNA synthesis GENSCRIPT
BamHI (HF) New England Biolabs R3136S Restriction Endonuclease
BglII New England Biolabs R0144S Restriction Endonuclease
NotI (HF) New England Biolabs R3189S Restriction Endonuclease
XhoI New England Biolabs R0146S Restriction Endonuclease
T4 DNA ligase New England Biolabs M0202T DNA ligation
QIAquick Gel Extraction Kit Qiagen 28704 DNA purification from Agorase gel
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid DNA purification from bacteria culture
Agarose Thermo Fisher Scientific 15510-019 For DNA gel electropherosis
MAX Efficiency DH5α competen cell Invitrogen 18-258-012 For transformation of DNA ligation mixture
Lennox L LB Broth Research Product International Corp. L24066-5000.0 For making bacteria culture
Ampicillin sodium salt Thermo Fisher Scientific 11593-019 Antibiotics
Kanamycin Sulfate Thermo Fisher Scientific 15160-054 Antibiotics
Tetracycline Thermo Fisher Scientific 64-75-5 Antibiotics
Gentamicin Thermo Fisher Scientific 15710-064 Antibiotics
MAX Efficiency DH10Bac competent cells Thermo Fisher Scientific 10361-012 For making bacmid DNA
S.O.C. Medium Thermo Fisher Scientific 15544-034 For DNA transformation
CellFECTIN II Reagent Thermo Fisher Scientific 10362-101 Insect cell transfection reagent
Bac-to-Bac Expression System Thermo Fisher Scientific 10359-016 Baculovirus-insect cells expression kit
Bluo-gal Thermo Fisher Scientific 15519-028 For isolation of recominant Bacmid DNA
IPTG Thermo Fisher Scientific 15529-019 For isolation of recominant Bacmid DNA
pFastBac1 Thermo Fisher Scientific 10360014 Baculorirus expression vector
Sf9 cells Thermo Fisher Scientific 11496015 Sf9 monolayer cells
Hi5 cells Thermo Fisher Scientific B85502 High Five insect cells
Grace’s insect medium, unsupplemented Thermo Fisher Scientific 11595030 Sf9 cell transfection minimum medium
Grace’s insect medium, supplemented Thermo Fisher Scientific 11605102 Sf9 monolayer cell culture complete medium
Sf-900 II SFM Thermo Fisher Scientific 10902104 Sf9 suspension cell culture medium without FBS
Express Five SFM Thermo Fisher Scientific 10486025 Hi5 cell culture medium
Penicillin-Streptomycin Thermo Fisher Scientific 15140122 100 ml (10,000 I.U./ml)
L-Glutamine (200 mM) Thermo Fisher Scientific 25030081 100 ml
FBS Certified Thermo Fisher Scientific 16000-044 500 ml
6-well plates Thermo Fisher Scientific 08-772-1B Flat-bottom
150 mm plates Thermo Fisher Scientific 353025 100/case
1.5 ml Microcentrifuge Tubes USA Scientific 1415-2500 500 tubes/bag
15 ml conical screw cap centrifuge tubes USA Scientific 1475-0511 25 tubes/bag
50 ml conical screw cap centrifuge tubes USA Scientific 1500-1211 25 tubes/bag
Ni-NTA Superflow Qiagen 30430 NiNTA resin
pH-indicator strips EMD Millipore Corporation 1.09535.0001 pH 0 - 14

DOWNLOAD MATERIALS LIST

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317 (2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796 (2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics