संशोधित Baculovirus अभिव्यक्ति वैक्टर कीट कोशिकाओं में स्रावित संयंत्र प्रोटीन का उत्पादन करने के लिए

JoVE Journal
Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

यहां, हम कीट सेल और baculovirus प्रोटीन अभिव्यक्ति प्रणाली का उपयोग करने के लिए प्रोटीन क्रिस्टलीकरण के लिए संयंत्र स्रावित प्रोटीन की बड़ी मात्रा में उत्पादन के लिए प्रोटोकॉल प्रस्तुत करते हैं । एक baculovirus अभिव्यक्ति वेक्टर कीट कोशिकाओं में संयंत्र प्रोटीन स्राव अभिव्यक्ति के लिए या तो GP67 या कीट hemolin संकेत पेप्टाइड के साथ संशोधित किया गया है ।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

संरचनात्मक और जैव रासायनिक अध्ययनों के लिए रिकॉमबिनेंट स्रावी eukaryotic प्रोटीन्स को व्यक्त करना वैज्ञानिकों के लिए एक चुनौती रहा है । baculovirus-मध्यस्थता कीट कोशिका अभिव्यक्ति प्रणाली कुछ के बाद अनुवाद संशोधनों के साथ रिकॉमबिनेंट eukaryotic स्रावी प्रोटीन व्यक्त करने के लिए इस्तेमाल किया प्रणालियों में से एक है. स्रावी प्रोटीन प्रोटीन glycosylation, डाइसल्फ़ाइड बांड गठन, और अंय के बाद अनुवाद संशोधनों के लिए स्रावी मार्ग के माध्यम से कराई जा करने की आवश्यकता है । स्रावी संयंत्र प्रोटीन के मौजूदा कीट कोशिका अभिव्यक्ति में सुधार करने के लिए, एक baculovirus अभिव्यक्ति वेक्टर या तो एक GP67 या एक hemolin संकेत पेप्टाइड अनुक्रम के बीच प्रवर्तक और एकाधिक-क्लोनिंग साइटों के अलावा द्वारा संशोधित किया गया है । इस नए डिजाइन संशोधित वेक्टर प्रणाली सफलतापूर्वक Arabidopsis थालियानाके घुलनशील रिकॉमबिनेंट स्रावित संयंत्र रिसेप्टर प्रोटीन की एक उच्च उपज का उत्पादन किया । व्यक्त संयंत्र प्रोटीन के दो, Arabidopsis TDR और PRK3 प्लाज्मा झिल्ली रिसेप्टर्स के extracellular डोमेन, एक्स-रे crystallographic अध्ययन के लिए सघन थे । संशोधित वेक्टर प्रणाली एक बेहतर उपकरण है कि संभवतः के रूप में अच्छी तरह से जानवरों के सांराज्य में रिकॉमबिनेंट स्रावी प्रोटीन की अभिव्यक्ति के लिए इस्तेमाल किया जा सकता है ।

Introduction

यह एक अनुसंधान प्रयोगशाला के लिए आवश्यक है जैव रासायनिक और भौतिक characterizations के लिए सजातीय रिकॉमबिनेंट प्रोटीन की बड़ी मात्रा में उत्पादन करने में सक्षम हो, विशेष रूप से एक्स-रे crystallographic अध्ययन के लिए । वहां रहे है कई अच्छी तरह से स्थापित heterologous अभिव्यक्ति प्रणालियों जैसे ई कोलाई, खमीर, कीट कोशिकाओं, स्तनधारी कोशिकाओं, पौधों की कोशिकाओं, आदि के बीच में, baculovirus-मध्यस्थता कीट कोशिका अभिव्यक्ति प्रणाली में से एक है सबसे सामांयतः प्रोटीन क्रिस्टलीकरण1के लिए संरचनात्मक रूप से जोड़ बड़े आकार के रिकॉमबिनेंट eukaryotic प्रोटीन की बड़ी मात्रा का उत्पादन करने के लिए तकनीक का इस्तेमाल किया ।

अभिव्यक्ति वैक्टर baculovirus अभिव्यक्ति प्रणाली के एक मजबूत polyhedrin या P10 प्रवर्तक को शामिल करने के लिए इंजीनियर है रिकॉमबिनेंट intracellular प्रोटीन की एक उच्च उपज का उत्पादन2,3। एक रिकॉमबिनेंट baculovirus बनाने के लिए, ब्याज की जीन एक कीट सदिश में क्लोन है polyhedrin (polh) लोकस Autographa बहु californica जीनोम की । जिसके परिणामस्वरूप निर्माण तो अनुक्रम है और उसके सही खुला पढ़ने के फ्रेम (ओआरएफ) सत्यापित है । सही निर्माण तो अभिकर्मक की प्रक्रिया के माध्यम से मेजबान कीट सेल में शुरू की है । ब्याज का जीन वायरल जीनोम में मुताबिक़ पुनर्संयोजन द्वारा डाला जाता है. रिकॉमबिनेंट वायरल जीनोम के उत्पादन में यह घटना परिणाम है, जो फिर रिकॉमबिनेंट नवोदित वायरस कणों1उत्पादन की प्रतिकृति ।

अभिव्यक्ति प्रणाली में सबसे अधिक प्रयोग किया जाता है कि कीट कोशिकाओं Sf9 और उच्च पांच (Hi5) कोशिकाओं रहे हैं । Sf9 कोशिकाओं Sf21 की एक क्लोनी अलग कर रहे हैं, धब् frugiperdaके pupal डिम्बग्रंथि कोशिकाओं से व्युत्पंन, और Hi5 कोशिकाओं एक क्लोनी पैतृक Trichoplusia नी डिम्बग्रंथि कोशिका रेखा तमिलनाडु से अलग व्युत्पंन हैं-३६८4,5। transfections, वायरस प्रवर्धन, और पट्टिका परख Sf9 कोशिकाओं पर आयोजित की जाती हैं, जबकि Hi5 कोशिकाओं को आम तौर पर रिकॉमबिनेंट प्रोटीन की अधिक मात्रा6का उत्पादन करने के लिए चुना जाता है । यह ध्यान देने योग्य बात है कि Hi5 कोशिकाओं पीढ़ी और उनके उत्परिवर्ती वायरस का उत्पादन करने की प्रवृत्ति के कारण वायरस के जिन्न के प्रवर्धन के लिए उपयुक्त नहीं हैं लायक है । परंपरागत रूप से, 25-30 डिग्री सेल्सियस की एक तापमान रेंज कीट कोशिकाओं की खेती के लिए अच्छा माना जाता है । हालांकि, यह बताया गया है कि 27-28 ° c कीट कोशिका वृद्धि और7,8संक्रमण के लिए इष्टतम तापमान है ।

एक मजबूत संकेत अनुक्रम की शुरूआत जीन पूर्ववर्ती स्रावित प्रोटीन की उच्च अभिव्यक्ति के लिए आवश्यक है । संकेत अनुक्रम कुशलता endoplasmic जालिका में प्रोटीन स्राव और बाद अनुवाद के लिए आवश्यक संशोधन रिकॉमबिनेंट प्रोटीन मार्गदर्शन करेंगे उचित तह और स्थिरीकरण के लिए3। सिग्नल पेप्टाइड अनुक्रम, जैसे कि baculovirus ढंक प्रोटीन GP64/67, मधुप melittin, और अन्य, रिकॉमबिनेंट-मध्यस्थता अभिव्यक्ति सिस्टम3में स्रावी baculovirus प्रोटीन की अभिव्यक्ति की सुविधा के लिए चुना गया है । GP67 के संकेत पेप्टाइड का परिचय एक गुप्त रिकॉमबिनेंट प्रोटीन की अभिव्यक्ति उपज में सुधार करने के लिए दिखाया गया है, लक्ष्य जीन9के आंतरिक संकेत पेप्टाइड का उपयोग करने की तुलना में. Hemolin विशाल रेशम कीट Hyalophora cecropia, जीवाणु संक्रमण10पर प्रेरित की एक hemolymph प्रोटीन है । प्रेरित अभिव्यक्ति के अपेक्षाकृत उच्च स्तर के कारण, जीन के संकेत पेप्टाइड अनुक्रम baculovirus-कीट कोशिका प्रणाली में रिकॉमबिनेंट प्रोटीन के स्राव अभिव्यक्ति मध्यस्थता करने के लिए इस्तेमाल किया जा सकता है ।

A. थालियाना Tracheary तत्व विभेद निरोधात्मक कारक रिसेप्टर (TDR) और पराग रिसेप्टर कळेनासे 3 (PRK3) दोनों संयंत्र Leucine-रिच दोहराने रिसेप्टर की तरह कळेनासे (LRR-RLK) परिवार के प्रोटीन11,12 के हैं . आदेश में संरचना और संयंत्र रिसेप्टर प्रोटीन के इस परिवार के समारोह का अध्ययन करने के लिए, के रूप में अच्छी तरह के रूप में अंय संयंत्र के संरचनात्मक और जैव रासायनिक लक्षण वर्णन की सुविधा के लिए प्रोटीन स्रावित, baculovirus-कीट कोशिका अभिव्यक्ति प्रणाली को संशोधित किया गया है प्रोटीन की गुणवत्ता में सुधार और उत्पादन उपज । दोनों TDR और PRK3 के extracellular डोमेन सफलतापूर्वक baculovirus-कीट कोशिका अभिव्यक्ति प्रणाली में दो संशोधित अभिव्यक्ति वैक्टर का उपयोग कर व्यक्त किया गया है । TDR और PRK3 प्रोटीन के दोनों extracellular डोमेन सघन किए गए हैं. इस लेख में एक GP67 या प्रमोटर और कई क्लोनिंग के बीच एक hemolin संकेत अनुक्रम को शामिल करके दो संशोधित baculovirus अभिव्यक्ति वैक्टर के साथ रिकॉमबिनेंट स्रावित संयंत्र प्रोटीन की बड़ी मात्रा के अभिव्यक्ति और शुद्धि की रिपोर्ट साइटों.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

नोट: स्रावी संयंत्र प्रोटीन अभिव्यक्ति और क्रिस्टलीकरण के लिए संशोधित अभिव्यक्ति वैक्टर के साथ एक कीट सेल/baculovirus प्रणाली का प्रयोग किया जाता है ।

1. एक Baculovirus अभिव्यक्ति वेक्टर संयंत्र प्रोटीन स्राव अभिव्यक्ति के लिए GP67 संकेत पेप्टाइड के साथ संशोधन

  1. एक डीएनए टुकड़ा एक 5 ' BglII काटने साइट13, GP67 स्राव संकेत अनुक्रम, और नोति, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI, और XhoI (आंकड़ा 1a) के साथ एक बहु-क्लोनिंग साइट युक्त संश्लेषण ।
    नोट: के बाद से दोनों BglII और BamHI पचा डीएनए के परिणामस्वरूप एक ही चिपकने वाला समाप्त होता है, रैखिक वेक्टर पचा डीएनए को ligate कर सकते हैं, जबकि BamHI annealed अनुक्रम में दोनों BglII और बंधाव साइटों एक अनुक्रम है कि द्वारा सट नहीं है रूपांतरित हो जाएगा या तो BglII या BamHI14.
  2. BglII और XhoI के साथ डीएनए के 4 µ जी, और BamHI और XhoI14के साथ एक अभिव्यक्ति वेक्टर डीएनए के 4 µ जी डाइजेस्ट । एक 1x एकाग्रता प्रतिक्रिया बफर में डीएनए के साथ प्रत्येक प्रतिबंध एंजाइम के 10 इकाइयों मिश्रण (५० mm पोटेशियम एसीटेट, 20 मिमी Tris-एसीटेट, 10 मिमी मैग्नीशियम एसीटेट, और १०० µ जी/एमएल BSA, 25 डिग्री सेल्सियस पर पीएच ७.९) और 4 एच के लिए ३७ ° c पर मिश्रण गर्मी ।
    1. एक डीएनए जेल निष्कर्षण किट15द्वारा आबकारी डीएनए टुकड़ा और रैखिक वेक्टर डीएनए शुद्ध ।
  3. मिक्स १०० एक 10-µ एल बंधाव प्रतिक्रिया में पचा डीएनए टुकड़ा के एनजी के साथ रैखिक वेक्टर डीएनए के एनजी 1x टी-4 डीएनए ligase प्रतिक्रिया बफर युक्त मिश्रण (५० mM Tris-HCl, 10 मिमी MgCl2, 1 मिमी एटीपी, और 10 मिमी डीटीटी, 25 डिग्री सेल्सियस पर पीएच ७.५) और टी-4 डीएनए की 5 इकाइयों ligase । 16 एच के लिए 16 डिग्री सेल्सियस पर प्रतिक्रिया मिश्रण मशीन
  4. एक मानक परिवर्तन प्रोटोकॉल के बाद DH5α सक्षम कोशिकाओं के १०० µ एल में बंधाव मिश्रण के 5 µ एल रूपांतरण और एक एम्पीसिलीन पौंड आगर16प्लेट पर परिणामी कालोनियों का चयन करें । 5-10 कालोनियों उठाओ और 16 घंटे के लिए एक मिलाना मशीन में २२० rpm और ३७ डिग्री सेल्सियस पर १०० µ g/एमएल एम्पीसिलीन युक्त पौंड मध्यम के 2 मिलीलीटर में प्रत्येक कॉलोनी बढ़ने
  5. एक डीएनए miniprep किट17 के साथ प्रत्येक प्लाज्मिड डीएनए निकालें और एक प्राइमरी AGTATTTTACTGTTTTCGTAACAG के साथ डीएनए अनुक्रमण द्वारा क्लोन की पुष्टि करें ।
  6. पीसीआर-बढ़ाना a . थालियाना TDR जीन टुकड़ा एंकोडिंग अवशेषों 30-642 से एक सिंथेटिक TDR जीन का निर्माण (फॉरवर्ड प्राइमर: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, रिवर्स प्राइमर: जीसी GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC) । एक डीएनए पोलीमरेज़ प्रतिक्रिया बफर में 30 चक्र के लिए डीएनए बढ़ाना एक ०.५ मिमी dNTP मिश्रण, ०.२ µ एम प्राइमरों, ०.१ µ जी के टेंपलेट डीएनए, ०.४ mM MgCl2, और 1 डीएनए पोलीमरेज़ की प्रतिक्रिया इकाई ।
    1. पीसीआर चक्र कदम के लिए, 30 एस के लिए ९५ ° c पर प्रारंभिक विकार सेट, और उसके बाद 30 एस के लिए ९५ डिग्री सेल्सियस पर विकार के ३० चक्र, 30 एस के लिए ५५ डिग्री सेल्सियस पर एनीलिंग, और विस्तार के लिए ७२ ° c पर 1 मिनट, एक अंतिम विस्तार के साथ ७२ ° c के लिए 5 min.
  7. दोनों पीसीआर टुकड़ा और नोति और BamHI प्रतिबंध endonuclease एंजाइमों के साथ संशोधित वेक्टर डाइजेस्ट । Ligate के साथ जीन टुकड़ा रैखिक सदिश । मिश्रण १०० के साथ रैखिक वेक्टर डीएनए के एनजी एक 10-µ एल बंधाव प्रतिक्रिया में पचा डीएनए टुकड़ा के एनजी-टी-4 डीएनए ligase प्रतिक्रिया बफर और टी-4 डीएनए ligase की 5 इकाइयों युक्त. 16 एच के लिए 16 डिग्री सेल्सियस पर प्रतिक्रिया मिश्रण मशीन
  8. एक मानक परिवर्तन प्रोटोकॉल के बाद DH5α सक्षम कोशिकाओं के १०० µ एल में बंधाव मिश्रण के 5 µ एल रूपांतरण और एक एम्पीसिलीन पौंड आगर16प्लेट पर परिणामी कालोनियों का चयन करें । डीएनए अनुक्रमण द्वारा सही क्लोन की पुष्टि करें ।

2. एक Baculovirus अभिव्यक्ति वेक्टर संयंत्र प्रोटीन स्राव अभिव्यक्ति के लिए कीट Hemolin संकेत पेप्टाइड के साथ संशोधन

  1. एक डीएनए टुकड़ा एक 5 ' BglII काटने साइट13, कीट hemolin स्राव संकेत अनुक्रम, और नोति, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI, और XhoI (आंकड़ा 1b) के साथ एक बहु क्लोनिंग साइट युक्त संश्लेषण ।
  2. BglII और XhoI के साथ डीएनए के 4 µ जी, और BamHI और XhoI14के साथ एक अभिव्यक्ति वेक्टर डीएनए के 4 µ जी डाइजेस्ट । एक 1x एकाग्रता प्रतिक्रिया बफर में डीएनए के साथ प्रत्येक प्रतिबंध एंजाइम के 10 इकाइयों मिश्रण (५० mm पोटेशियम एसीटेट, 20 मिमी Tris-एसीटेट, 10 मिमी मैग्नीशियम एसीटेट, और १०० µ जी/एमएल BSA, 25 डिग्री सेल्सियस पर पीएच ७.९) और 4 एच के लिए ३७ ° c पर मिश्रण गर्मी ।
    1. एक डीएनए जेल निष्कर्षण किट15द्वारा आबकारी डीएनए टुकड़ा और रैखिक वेक्टर डीएनए शुद्ध ।
  3. मिक्स १०० एक 10-µ एल बंधाव प्रतिक्रिया में पचा डीएनए टुकड़ा के एनजी के साथ रैखिक वेक्टर डीएनए के एनजी 1x टी-4 डीएनए ligase प्रतिक्रिया बफर युक्त मिश्रण (५० mM Tris-HCl, 10 मिमी MgCl2, 1 मिमी एटीपी, और 10 मिमी डीटीटी, 25 डिग्री सेल्सियस पर पीएच ७.५) और टी-4 डीएनए की 5 इकाइयों ligase । 16 एच के लिए 16 डिग्री सेल्सियस पर प्रतिक्रिया मिश्रण मशीन
  4. DH5α सक्षम कोशिकाओं के १०० µ एल में बंधाव मिश्रण के 5 µ एल रूपांतरण और एक एम्पीसिलीन पौंड आगर प्लेट पर कालोनियों का चयन करें । 5-10 कालोनियों उठाओ और 16 एच के लिए एक मिलाना मशीन में २२० rpm और ३७ ° c में एक 2 मिलीलीटर पौंड १०० µ जी/एम्पीसिलीन के एमएल युक्त माध्यम में प्रत्येक कॉलोनी हो जाना ।
  5. एक डीएनए miniprep किट17 के साथ प्लाज्मिड डीएनए निकालें और एक प्राइमरी AGTATTTTACTGTTTTCGTAACAG के साथ डीएनए अनुक्रमण द्वारा क्लोन की पुष्टि करें ।
  6. पीसीआर-बढ़ाना a. थालियाना पराग रिसेप्टर कळेनासे 3 (PRK3) जीन टुकड़ा एन्कोडिंग अवशेषों 20-237 से एक सिंथेटिक PRK3 जीन का निर्माण (फॉरवर्ड प्राइमरी: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, रिवर्स प्राइमर: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC) । एक डीएनए पोलीमरेज़ प्रतिक्रिया बफर में 30 चक्र के लिए डीएनए बढ़ाना एक ०.५ मिमी dNTP मिश्रण, ०.२ µ एम प्राइमरों, ०.१ µ जी के टेंपलेट डीएनए, ०.४ mM MgCl2, और 1 डीएनए पोलीमरेज़ की प्रतिक्रिया इकाई ।
    1. पीसीआर साइकिल स्टेप्स के लिए 30 एस के लिए ९५ ° c पर प्रारंभिक विकार सेट करें, और उसके बाद 30 एस के लिए ९५ ° c पर विकार के ३० चक्र, 30 एस के लिए ५५ ° c पर एनीलिंग, और प्रत्येक चक्र के भीतर 30 एस के लिए ७२ ° c पर विस्तार, और 5 मिनट के लिए ७२ ° c पर अंतिम विस्तार ।
  7. दोनों पीसीआर टुकड़ा और नोति और BamHI प्रतिबंध endonuclease एंजाइमों के साथ संशोधित वेक्टर डाइजेस्ट । Ligate के साथ जीन टुकड़ा रैखिक सदिश । मिश्रण १०० के साथ रैखिक वेक्टर डीएनए के एनजी एक 10-µ एल बंधाव प्रतिक्रिया में पचा डीएनए टुकड़ा के एनजी-टी-4 डीएनए ligase प्रतिक्रिया बफर और टी-4 डीएनए ligase की 5 इकाइयों युक्त. 16 एच के लिए 16 डिग्री सेल्सियस पर प्रतिक्रिया मिश्रण मशीन
  8. एक मानक परिवर्तन प्रोटोकॉल के बाद DH5α सक्षम कोशिकाओं के १०० µ एल में बंधाव मिश्रण के 5 µ एल रूपांतरण और एक एम्पीसिलीन पौंड आगर16प्लेट पर परिणामी कालोनियों का चयन करें । डीएनए अनुक्रमण द्वारा सही क्लोन की पुष्टि करें ।

3. उत्पादन और Baculovirus का प्रवर्धन रिकॉमबिनेंट प्रोटीन अभिव्यक्ति कैसेट बंदरगाह का निर्माण

  1. का प्रयोग करें १०० निर्माण प्लाज्मिड के एनजी baculovirus अभिव्यक्ति प्रणाली1के प्रोटोकॉल निंनलिखित DH10Bac सक्षम कोशिकाओं के ४० µ एल को बदलने के लिए । ४८ एच के लिए ३७ ° c पर परिवर्तन प्लेटें मशीन ।
  2. प्रत्येक परिवर्तन प्लेट से दो सफेद कालोनियों उठाओ, पौंड मध्यम के 2 मिलीलीटर में प्रत्येक कॉलोनी inoculate ५० µ जी/एमएल कनमीसिन, 7 µ जी/एमएल gentamicin, और 10 µ जी/ निकालने और bacmid डीएनए को सत्यापित करने के लिए baculovirus अभिव्यक्ति सिस्टम1 के प्रोटोकॉल का पालन करें । 20 µ एल प्रत्येक के साथ दो ट्यूबों में प्रत्येक डीएनए Aliquot, और-20 डिग्री सेल्सियस पर ट्यूबों की दुकान ।
    नोट: निंन चरणों का पालन एक अपूतित कार्रवाई की आवश्यकता है ।
  3. संस्कृति मीडिया में Sf9 कोशिकाओं के एक monolayer 10% भ्रूण गोजातीय सीरम (FBS) और १०० µ g/एमएल (या १०० I.U./mL) के साथ बढ़ती 27 ° c में पेनिसिलिन-streptomycin एंटीबायोटिक दवाओं के लिए एक 6-वेल प्लेट में ८०% संगम. टिशू कल्चर प्लेट पर कवर्ड एरिया के प्रतिशत के आधार पर संगम के प्रतिशत का अनुमान लगाएं ।
  4. दो बाँझ १.५-एमएल केंद्रापसारक ट्यूबों में निम्नलिखित समाधान तैयार करें ।
    1. ट्यूब 1: प्रत्येक अभिकर्मक के लिए, bacmid डीएनए के 20 µ एल को पतला एंटीबायोटिक दवाओं के बिना पूरक Sf9 सेल संस्कृति माध्यम के १०० µ एल में । कमजोर पड़ने धीरे ट्यूब की ओर झाड़ द्वारा मिश्रण ।
    2. ट्यूब 2: प्रत्येक अभिकर्मक के लिए, 8 µ l लिपिड अभिकर्मक रिएजेंट की १०० µ l में एंटीबायोटिक दवाओं के बिना पूरक Sf9 सेल संस्कृति माध्यम का पतला । 6x के लिए ऊपर और नीचे pipetting द्वारा अच्छी तरह से कमजोर पड़ने मिश्रण ।
  5. दो समाधान का मिश्रण है, उंहें धीरे से pipetting के ऊपर और नीचे 3x के लिए नीचे से मिला है, और उंहें कमरे के तापमान पर 20-40 मिनट के लिए मशीन ।
  6. एंटीबायोटिक दवाओं के बिना पूरक Sf9 सेल संस्कृति माध्यम के 3 मिलीलीटर के साथ 2x Sf9 monolayer कोशिकाओं की एक अच्छी तरह से धो लें । प्रत्येक अभिकर्मक के लिए, लिपिड डीएनए मिश्रण युक्त प्रत्येक ट्यूब के लिए एंटीबायोटिक दवाओं के बिना पूरक Sf9 सेल संस्कृति मध्यम के ०.८ मिलीलीटर जोड़ें । pipetting धीरे से ऊपर और नीचे 3x के लिए ट्यूबों के धीरे सामग्री मिश्रण । प्लेटों से धो मीडिया महाप्राण और अभिकर्मक मिश्रण के साथ नमूने ओवरले ।
  7. अभिकर्मक मिश्रण के अलावा के बाद, मशीन transfected प्लेट 27 डिग्री सेल्सियस पर 5 घंटे के लिए । अभिकर्मक मीडिया को पूर्ण Sf9 कक्ष culture माध्यम से प्रतिस्थापित करें जिसमें 10% FBS और १०० µ g/mL (या १०० I.U./mL) पेनिसिलिन-streptomycin एंटीबायोटिक दवाओं को शामिल करते हैं । 4 डी के लिए 27 डिग्री सेल्सियस पर transfected प्लेट की मशीन
  8. फसल और रिकॉमबिनेंट baculovirus बढ़ाना ।
    1. एक बाँझ 15 मिलीलीटर शंकु ट्यूब में संक्रमित थाली के supernatant के 4 डी के बाद ले लीजिए । सेल मलबे को दूर करने के लिए 5 मिनट के लिए १०१० x g पर supernatant स्पिन । गोली त्यागें और एक साफ ट्यूब के लिए supernatant खिचड़ी भाषा और 1 साल के लिए 4 डिग्री सेल्सियस पर यह स्टोर ।
      नोट: यह P0 वायरस है । यह aliquoted और समय की एक लंबी अवधि के लिए-८० डिग्री सेल्सियस पर संग्रहीत किया जा सकता है ।
    2. प्रत्येक रिकॉमबिनेंट वायरस को बढ़ाना, १५०-mm प्लेट पर Sf9 कोशिकाओं का एक monolayer को ८०% संगम पर उगाना । थाली से मीडिया महाप्राण, प्लेट के लिए अनुयाई कोशिकाओं को P0 वायरस के 2 मिलीलीटर जोड़ने और एक 27 डिग्री सेल्सियस मशीन में 1 ज के लिए थाली मशीन । प्लेट हर 15 मिनट रॉक कोशिकाओं के साथ मध्यम मिश्रण करने के लिए ।
      1. पूर्ण अनुग्रह के 10% FBS और १०० µ जी/एमएल (या १०० I.U./mL) पेनिसिलिन-streptomycin एंटीबायोटिक दवाओं युक्त मीडिया के 25 मिलीलीटर जोड़ें । P1 बीतने वायरस प्राप्त करने के लिए एक 27 डिग्री सेल्सियस मशीन में 3 डी के लिए थाली मशीन ।
    3. संक्रमित प्लेट के supernatant को बाँझ ५०-एमएल शंकु ट्यूब में जमा करें और सेल के मलबे को हटाने के लिए 5 मिनट के लिए १०१० x g पर स्पिन करें । supernatant एक साफ ट्यूब के लिए खिचड़ी भाषा और 1 साल के लिए 4 डिग्री सेल्सियस पर यह स्टोर ।
      नोट: P1 वायरस aliquoted जा सकता है और समय की एक लंबी अवधि के लिए-८० डिग्री सेल्सियस पर संग्रहीत ।
    4. p1 से P2 पारित होने के लिए वायरस बढ़ाना, ९०% संगम करने के लिए एक १५० मिमी प्लेट पर Sf9 कोशिकाओं की एक monolayer हो जाना, थाली के मीडिया महाप्राण, प्लेट के लिए P1 वायरस के 2 मिलीलीटर जोड़ने, और यह एक 27 डिग्री सेल्सियस में 1 ज के लिए मशीन ।
    5. दोहराएं चरणों 3.8.2 और 3.8.3 को P2 और पी ए पी और वायरस के मार्ग प्राप्त करने के लिए । अधिक से अधिक 2 महीने के लिए पी 3 वायरस स्टोर मत करो ।

4. प्रोटीन अभिव्यक्ति, नि्ता के साथ शुद्धि, और क्रिस्टलीकरण

  1. संस्कृति मीडिया में १०० µ g/mL (या १०० I.U./mL) के साथ Hi5 कीट कोशिकाओं की 1 L 2 x 106 के एक घनत्व को पेनिसिलिन-streptomycin एंटीबायोटिक दवाओं में एक 27 ° c मशीन शेखर में १०० rpm । 5 मिनट के लिए ५७० x g पर कोशिकाओं को नीचे स्पिन, supernatant, खिचड़ी भाषा के ताजा उत्पादित पी 3 वायरस के 20 मिलीलीटर में कोशिकाओं resuspend, और यह कमरे के तापमान पर रखने के लिए 1 h. धीरे स्पिन की बोतल को resuspend करने के लिए सेल 1x हर 15 मिनट ।
  2. १०० µ g/एमएल (या १०० I.U./mL) के साथ संस्कृति मीडिया के 1 एल के लिए कोशिकाओं को स्थानांतरित पेनिसिलिन-streptomycin एंटीबायोटिक दवाओं, संस्कृति ७२ एच के लिए एक 27 डिग्री सेल्सियस मशीन शेखर में १०० rpm पर कोशिकाओं नीचे स्पिन के लिए १,०१० एक्स जी पर कोशिकाओं 5 मिनट के लिए और supernatant इकट्ठा ।
  3. का प्रयोग करें पीएच संकेतक स्ट्रिप्स supernatant के पीएच को समायोजित करने के लिए ८.० या तो ०.१ मीटर एचसीएल या ०.१ m NaOH जोड़कर और एक अंतिम एकाग्रता में बाध्यकारी बफर जोड़ें, 20 मिमी Tris बफर पर पीएच ८.०, १०० मिमी NaCl, और 5 मिमी imidazole. व्यक्त अपने-टैग रिकॉमबिनेंट प्रोटीन की अनुमानित उपज के आधार पर नि्ता राल (10-40 एमएल) की एक निश्चित राशि जोड़ें ।
    1. 1 घंटे के लिए 4 डिग्री सेल्सियस पर कम गति के साथ एक चुंबकीय हलचल पर समाधान मिश्रण राल धो और मानक नि्ता शुद्धि प्रोटोकॉल18के बाद बंधे प्रोटीन elute ।
  4. आयन एक्सचेंज और जेल निस्पंदन क्रोमैटोग्राफी के लिए शुद्ध प्रोटीन विषय, साथ ही अन्य प्रोटीन शोधन विधियों, एक सजातीय नमूना उपज के लिए ।
    नोट: के लिए TDR ectodomain, 20 मिमी Tris, पीएच 8, १०० mm NaCl जेल छानने का काम बफर के रूप में इस्तेमाल किया गया । PRK3 ectodomain के लिए, 20 मिमी बीआईएस-Tris, पीएच 6, १०० मिमी NaCl पसंदीदा जेल छानने का काम बफर के रूप में इस्तेमाल किया गया ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

जैसा चित्र 1में दिखाया गया है, दो संशोधित pFastBac1 baculovirus अभिव्यक्ति वैक्टर या तो GP67 या hemolin संकेत अनुक्रम के साथ स्रावित प्रोटीन व्यक्त करने के लिए लक्ष्य जीन के आंतरिक संकेत अनुक्रम की जगह इस्तेमाल किया गया । वायरल GP67 और कीट hemolin जीन कोशिकाओं में उच्च स्राव अभिव्यक्ति स्तर है करने के लिए प्रदर्शन किया गया है । या तो इन दो संकेत दृश्यों के साथ फ्यूजन प्रोटीन बहुत स्राव अभिव्यक्ति स्तर में सुधार की उम्मीद कर रहे हैं. समान एकाधिक क्लोनिंग साइटें (MCS) इन दो संशोधित वैक्टर में इंजीनियर थे । एक नोति साइट जानबूझकर MCS के सबसे 5 '-पक्ष पर रखा गया था, क्योंकि नोति कई अंय प्रतिबंध साइटों में मौजूद सबसे आम छह न्यूक्लियोटाइड अनुक्रम के बजाय एक आठ न्यूक्लियोटाइड अनुक्रम है । जैसे, एक नोति साइट सबसे अंय प्रतिबंध साइटों की तुलना में लक्ष्य जीन में कम मौजूद है, प्रतिबंध पाचन बनाने और सबसे अधिक लक्ष्य जीन की क्लोनिंग अंय प्रतिबंध साइटों का उपयोग करने की तुलना में अधिक संभव है । नोति और एक बहाव प्रतिबंध साइट के बीच लक्ष्य जीन क्लोनिंग केवल तीन एमिनो एसिड अवशेषों, GGR, लक्ष्य जीन पूर्ववर्ती परिचय होगा ।

pBac1-GP67 और pBac1-हेम सफलतापूर्वक ए थालियाना रिसेप्टर्स TDR और PRK3, क्रमशः (चित्रा 2) के extracellular डोमेन व्यक्त करने के लिए उपयोग किया गया है. के बाद रिकॉमबिनेंट प्रोटीन एक इंजीनियरिंग सी-टर्मिनल 6-histidine टैग का उपयोग कर नि्ता द्वारा शुद्ध थे, औसत प्रोटीन उपज के आसपास संगत था 20 मिलीग्राम/Hi5 कोशिकाओं के एल । प्रत्येक प्रोटीन की शुद्धता के करीब है या अधिक से अधिक ५०%, एसडीएस के साथ जांच-पृष्ठ और Coomassie धुंधला ।

TDR और PRK3 के extracellular डोमेन के रिकॉमबिनेंट प्रोटीन आगे आकार अपवर्जन क्रोमैटोग्राफी (चित्रा 2) द्वारा शुद्ध थे । शुद्ध प्रोटीन 5 मिलीग्राम/एमएल के लिए ध्यान केंद्रित किया गया था और फिर एक क्रिस्टलीकरण स्क्रीनिंग के अधीन । शर्तों, जो प्रत्येक प्रोटीन के प्रारंभिक क्रिस्टल उपज, जब तक एक आकार से बड़ा 20 µm देखा गया था के साथ प्रोटीन क्रिस्टल अनुकूलित थे (चित्रा 3) । दोनों प्रोटीन के क्रिस्टल संरचनाओं11,12बताया गया है ।

Figure 1
चित्रा 1: संशोधित pFastBac1 वैक्टर के नक्शे । डीएनए इन पैनलों में दिखाया अनुक्रम pFastBac1 वेक्टर के polyhedrin प्रमोटर के बहाव डाला गया, संकेत पेप्टाइड अनुक्रम और कई क्लोनिंग साइटों के अधिकारी (MCS) लक्ष्य जीन के लिए । दोनों वैक्टर एक ही MCS होते हैं । () इस पैनल pBac1-GP67 वेक्टर में polyhedrin प्रमोटर की क्लोनिंग साइटों बहाव के एक अनुक्रम से पता चलता है । अनुवादित GP67 संकेत पेप्टाइड अमीनो एसिड अनुक्रम लाल रंग में है । MCS में प्रत्येक अद्वितीय प्रतिबंध साइट के ऊपर लेबल साइट के नाम के साथ, रेखांकित है । () इस पैनल pBac1-हेम वेक्टर में polyhedrin प्रमोटर की क्लोनिंग साइटों बहाव के एक अनुक्रम से पता चलता है । अनुवादित hemolin संकेत पेप्टाइड अमीनो एसिड अनुक्रम लाल रंग में है । MCS में प्रत्येक अद्वितीय प्रतिबंध साइट के ऊपर लेबल साइट के नाम के साथ, रेखांकित है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: baculovirus-कीट कोशिका प्रणाली में संशोधित pFastBac1 वैक्टर के साथ प्रोटीन अभिव्यक्ति । () TDR के ectodomain Hi5 कीट कोशिकाओं में व्यक्त किया गया था, निकल-संबध और आकार अपवर्जन क्रोमैटोग्राफी (ओं) से शुद्ध, और एसडीएस-पृष्ठ जेल पर हल । निकल राल एक बार 5 मिमी imidazole (धो 1), और 20 मिमी imidazole (धो 2) के साथ एक दूसरी बार युक्त बफर के साथ धोया गया था । () यह अभिव्यक्ति और निकल संबध शुद्धि (नि्ता), साथ ही PRK3 ectodomain के आकार अपवर्जन क्रोमैटोग्राफी दिखा रहा है एक एसडीएस-पृष्ठ विश्लेषण है । आणविक वजन (मेगावाट) इसी आकार के साथ मार्करों लेबल हैं । प्रत्येक पैनल में लाल तीर रिकॉमबिनेंट TDR और PRK3 ectodomain प्रोटीन के भाव और अपेक्षित आकारों को निरूपित करते हैं । व्यक्त प्रोटीन की मल्टी बैंड प्रकृति विषम glycosylation के कारण होने की संभावना है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3: Arabidopsis थालियाना TDR और PRK3 के extracellular डोमेन के प्रोटीन क्रिस्टल । () यह पैनल ए. थालियाना TDR के extracellular डोमेन के प्रोटीन क्रिस्टल को दिखाता है । (ख) यह पैनल ए. थालियाना PRK3 के extracellular डोमेन के प्रोटीन क्रिस्टल को दिखाता है । एक स्केल बार प्रत्येक चित्र के नीचे दिखाया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

जैविक प्रणालियों में मौजूद हजारों प्रोटीनों के आकार और स्थायित्व में विविधता को देखते हुए यह एक शोध प्रयोगशाला के लिए अक्सर अनुभवजंय है कि एक विशिष्ट प्रोटीन की अभिव्यक्ति के लिए heterologous अभिव्यक्ति प्रणाली को किस रूप में चुना जाना है । ई. कोलाई अभिव्यक्ति प्रणाली अक्सर प्रोटीन बैक्टीरिया, संस्कृति मीडिया की कम लागत के जीवन चक्र के कारण अभिव्यक्ति के लिए पहली पसंद है, और रिश्तेदार आसानी19पैमाने पर । ६० केडीए से अधिक आकार के साथ बड़े eukaryotic प्रोटीन की अभिव्यक्ति के लिए, तथापि, ई. कोलाई प्रणाली का उपयोग अक्सर समावेशी शरीर या एकत्रीकरण20में अघुलनशील प्रोटीन में परिणाम. उन मुश्किल प्रोटीन की अभिव्यक्ति के लिए, और अंय गुप्त प्रोटीन के लिए, baculovirus-कीट कोशिका अभिव्यक्ति प्रणाली ई कोलाईसे अधिक लाभप्रद हो सकता है । विशेष रूप से जब स्रावित eukaryotic प्रोटीन व्यक्त, इस संशोधित baculovirus-कीट कोशिका अभिव्यक्ति प्रणाली एक पसंदीदा विकल्प हो सकता है ।

पादप स्रावित प्रोटीन सहित कई गुप्त eukaryotic प्रोटीन, जटिल glycosylation की आवश्यकता, डाइसल्फ़ाइड गठन, और अन्य के बाद अनुवादात्मक संशोधनों प्रोटीन तह और स्राव21. ई. कोलाई सिस्टम eukaryotic प्रोटीन के कई के लिए आवश्यक जटिल संशोधनों को संसाधित करने के लिए सेलुलर मशीनरी नहीं है22. खमीर एक अपेक्षाकृत अधिक ई. कोलाई23से अधिक उंनत glycosylation प्रणाली है । तथापि, उच्च eukaryotic प्रजातियों और पौधों में गुप्त प्रोटीन की अभिव्यक्ति के लिए, baculovirus-कीट कोशिका प्रणाली एक महत्वपूर्ण लाभ प्रस्तुत करता है । चूंकि glycosylation प्रोटीन तह और24स्थिरता को प्रभावित करता है, गुप्त रिकॉमबिनेंट ई. कोलाई और खमीर प्रणालियों में व्यक्त प्रोटीन के कई एक कम उपज है और समग्र करने के लिए करते हैं, संभवतः गलत प्रोटीन तह के कारण । baculovirus-कीट प्रणाली को प्रोटीन glycosylation में सुधार करने के लिए संशोधित किया गया है, जो यह गुप्त eukaryotic प्रोटीन25की अभिव्यक्ति के लिए एक आदर्श प्रणाली बनाता है । इस अध्ययन में, दोनों GP67 और hemolin संकेत पेप्टाइड्स सफलतापूर्वक प्रोटीन क्रिस्टलीकरण के लिए दो संयंत्र रिसेप्टर प्रोटीन की स्राव अभिव्यक्ति मार्गदर्शन करने के लिए इस्तेमाल किया गया है. मन में इन अध्ययनों के साथ हालांकि, या तो संकेत पेप्टाइड का चुनाव एक महत्वपूर्ण कदम है, और यह विभिंन जीवों से लक्ष्य जीन का एक सेट के साथ और अधिक व्यवस्थित तुलनात्मक अध्ययन की जरूरत है ।

प्रोटीन स्राव अभिव्यक्ति बढ़ाने के लिए दोनों GP67 और hemolin सिग्नल पेप्टाइड्स का उपयोग करने का विचार दोनों जीनों की उच्च अभिव्यक्ति पैदावार से प्रेरित था. हालांकि, यदि प्रोटीन स्राव और अभिव्यक्ति मेजबान के posttranslational संशोधन मशीनरी व्यक्त रिकॉमबिनेंट प्रोटीन के साथ अतिभारित हैं, स्रावित रिकॉमबिनेंट प्रोटीन पर्याप्त संशोधनों, विशेष रूप से glycosylation नहीं हो सकता है । दोनों को संशोधित वैक्टर सफलतापूर्वक कई संयंत्र स्रावी प्रोटीन11,12,26व्यक्त करने के लिए इस्तेमाल किया गया है, जिनमें से अनेक कुल करने के लिए करते हैं, जो शायद गलत या अपर्याप्त glycosylation के कारण है । इसलिए, उन मुश्किल प्रोटीन की अभिव्यक्ति के लिए, दोनों मजबूत और कमजोर संकेत पेप्टाइड अनुक्रम परीक्षण किया जा करने के लिए है और व्यक्त रिकॉमबिनेंट प्रोटीन की गुणवत्ता की तुलना की जरूरत है । ध्यान रखें कि एक कमजोर संकेत पेप्टाइड अनुक्रम प्रोटीन की समग्र उपज को कम करेगा; हालांकि, यह अभिव्यक्ति मेजबान प्रोटीन स्राव और संशोधनों को संसाधित करने के लिए पर्याप्त क्षमता की स्रावी मशीनरी दे सकता है ।

कीट कोशिकाओं में heterologous स्रावित प्रोटीन की अभिव्यक्ति के अलावा, स्तनधारी सेल और संयंत्र सेल अभिव्यक्ति प्रणालियों सफलतापूर्वक रिकॉमबिनेंट स्तनधारी और संयंत्र प्रोटीन के व्यक्ती में इस्तेमाल किया गया है, क्रमशः27, 28,29. heterologous प्रणालियों की तुलना में, या तो स्तनधारी या संयंत्र स्रावित प्रोटीन के निकट अंतर्जात अभिव्यक्ति की हालत मेजबान कोशिकाओं में लगभग देशी संशोधन मशीनरी के लिए अच्छी तरह से जोड़ प्रोटीन होगा । निकट देशी अभिव्यक्ति प्रणाली का उपयोग करने की चेतावनी है कि व्यक्त रिकॉमबिनेंट प्रोटीन कोशिकाओं के शारीरिक समारोह है, जो संभवतः प्रोटीन की अंतिम अभिव्यक्ति की उपज पर प्रतिकूल प्रभाव पड़ सकता है के साथ हस्तक्षेप कर सकते हैं ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

यह काम Guozhou Xu के लिए उत्तरी केरोलिना राज्य विश्वविद्यालय से नए संकाय स्टार्टअप कोष द्वारा समर्थित किया गया था ।

Materials

Name Company Catalog Number Comments
Incubator shaker VWR Model Excella E25 27 oC
Incubator VWR Model 2005 27 oC
Centrifuge BECKMAN Model J-6 with a swing bucket rotor
Herculase II Fusion DNA Polymerase Agilent 600677-51 For PCR amplification of DNA
Thermal Cycler BIO-RAD Model C1000 Touch For PCR amplification of DNA
Incubator shaker New Brunswick Scientific Model I 24 For growing baceria culture
Customer DNA synthesis GENSCRIPT
BamHI (HF) New England Biolabs R3136S Restriction Endonuclease
BglII New England Biolabs R0144S Restriction Endonuclease
NotI (HF) New England Biolabs R3189S Restriction Endonuclease
XhoI New England Biolabs R0146S Restriction Endonuclease
T4 DNA ligase New England Biolabs M0202T DNA ligation
QIAquick Gel Extraction Kit Qiagen 28704 DNA purification from Agorase gel
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid DNA purification from bacteria culture
Agarose Thermo Fisher Scientific 15510-019 For DNA gel electropherosis
MAX Efficiency DH5α competen cell Invitrogen 18-258-012 For transformation of DNA ligation mixture
Lennox L LB Broth Research Product International Corp. L24066-5000.0 For making bacteria culture
Ampicillin sodium salt Thermo Fisher Scientific 11593-019 Antibiotics
Kanamycin Sulfate Thermo Fisher Scientific 15160-054 Antibiotics
Tetracycline Thermo Fisher Scientific 64-75-5 Antibiotics
Gentamicin Thermo Fisher Scientific 15710-064 Antibiotics
MAX Efficiency DH10Bac competent cells Thermo Fisher Scientific 10361-012 For making bacmid DNA
S.O.C. Medium Thermo Fisher Scientific 15544-034 For DNA transformation
CellFECTIN II Reagent Thermo Fisher Scientific 10362-101 Insect cell transfection reagent
Bac-to-Bac Expression System Thermo Fisher Scientific 10359-016 Baculovirus-insect cells expression kit
Bluo-gal Thermo Fisher Scientific 15519-028 For isolation of recominant Bacmid DNA
IPTG Thermo Fisher Scientific 15529-019 For isolation of recominant Bacmid DNA
pFastBac1 Thermo Fisher Scientific 10360014 Baculorirus expression vector
Sf9 cells Thermo Fisher Scientific 11496015 Sf9 monolayer cells
Hi5 cells Thermo Fisher Scientific B85502 High Five insect cells
Grace’s insect medium, unsupplemented Thermo Fisher Scientific 11595030 Sf9 cell transfection minimum medium
Grace’s insect medium, supplemented Thermo Fisher Scientific 11605102 Sf9 monolayer cell culture complete medium
Sf-900 II SFM Thermo Fisher Scientific 10902104 Sf9 suspension cell culture medium without FBS
Express Five SFM Thermo Fisher Scientific 10486025 Hi5 cell culture medium
Penicillin-Streptomycin Thermo Fisher Scientific 15140122 100 ml (10,000 I.U./ml)
L-Glutamine (200 mM) Thermo Fisher Scientific 25030081 100 ml
FBS Certified Thermo Fisher Scientific 16000-044 500 ml
6-well plates Thermo Fisher Scientific 08-772-1B Flat-bottom
150 mm plates Thermo Fisher Scientific 353025 100/case
1.5 ml Microcentrifuge Tubes USA Scientific 1415-2500 500 tubes/bag
15 ml conical screw cap centrifuge tubes USA Scientific 1475-0511 25 tubes/bag
50 ml conical screw cap centrifuge tubes USA Scientific 1500-1211 25 tubes/bag
Ni-NTA Superflow Qiagen 30430 NiNTA resin
pH-indicator strips EMD Millipore Corporation 1.09535.0001 pH 0 - 14

DOWNLOAD MATERIALS LIST

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317 (2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796 (2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics