Endre Baculovirus uttrykk vektorer å produsere utskilles anlegget proteiner i insekt celler

JoVE Journal
Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her presenterer vi protokollene for utnytte insekt celler og baculovirus protein uttrykk systemet å produsere store mengder anlegget utskilles proteiner for protein krystallisering. En baculovirus uttrykk vektor er endret med GP67 eller insekt hemolin signal peptid plante protein sekresjon uttrykk i insekt celler.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Det har vært en utfordring for forskere å uttrykke rekombinant sekretoriske eukaryote proteiner for strukturelle og biokjemiske studier. Baculovirus-mediert insekt cellen uttrykk systemet er en av å uttrykke rekombinant eukaryote sekretoriske proteiner med noen post-translasjonell modifikasjoner. Sekretoriske proteiner må rutes gjennom sekretoriske veier for protein glykosylering, disulfide obligasjoner dannelse og andre post-translasjonell endringer. For å forbedre eksisterende insekt celle uttrykket av sekretoriske anlegget proteiner, er en baculovirus uttrykk vektor endret av tillegg av enten et GP67 eller en hemolin signal peptid sekvens mellom selskapet og flere-kloning nettsteder. Denne nydesignede endret vektor-system produsert en høy avkastning av løselig rekombinant utskilles anlegget reseptor proteiner av Arabidopsis thaliana. To av uttrykt anlegget proteiner, ekstracellulære domener av Arabidopsis TDR og PRK3 plasma membran reseptorer, ble krystallisert for X-ray krystallografisk studier. Modifisert vektor systemet er et forbedret verktøy som kan potensielt brukes for uttrykket av rekombinant sekretoriske proteiner i dyreriket også.

Introduction

Det er viktig for et forskningslaboratorium skal produsere store mengder homogen rekombinante proteinene for biokjemisk og Biofysiske karakteristikk, spesielt for X-ray krystallografisk studier. Det er mange godt etablerte heterologous uttrykk systemer som Escherichia coli, gjær, insekt celler, pattedyrceller, anlegg celler, etc. blant dem, baculovirus-mediert insekt cellen uttrykk systemet er en av mest brukte teknikker til å produsere store mengder strukturelt foldet store rekombinant eukaryote proteiner for protein krystallisering1.

Uttrykket vektorer av baculovirus uttrykk er konstruert for å inneholde en sterk polyhedrin eller P10 arrangøren å produsere en høy avkastning rekombinant intracellulær proteiner2,3. For å gjøre en rekombinant baculovirus, er genet av interesse klonet i et insekt vektor som inneholder polyhedrin (polh) locus Autographa californica multi-nucleopolyhedroviral genomet. Den resulterende konstruere er deretter sekvensielt og åpen leses rammen (ORF) er kontrollert. Den riktige konstruere er så introdusert i vert insekt cellen gjennom prosessen med hva. Genet av interesse settes inn i viral genomet av homologe rekombinasjon. Denne hendelsen resulterer i produksjon av rekombinant viral genomet, som deretter gjentak å produsere rekombinant okuleres virus partikler1.

I insekt celler som vanligvis brukes i uttrykk systemet er Sf9 og høy fem (Hi5) celler. Sf9 celler er en klonal isolere av Sf21, utledet fra pupal ovarian cellene i Spodoptera frugiperda, Hi5 cellene er en klonal isolere stammer fra det foreldre Trichoplusia ni ovarian celle linje TN-3684,5. Co transfections, virus forsterkning og plakk analyser er gjennomført på Sf9 celler, mens Hi5 cellene er vanligvis valgt å produsere høyere mengder rekombinante proteinene6. Det er verdt å merke seg at Hi5 cellene ikke er egnet for generasjon og forsterkning av virus progenies hensyn til deres tendensen å produsere mutant virus. Tradisjonelt anses et temperaturområde på 25-30 ° C å være bra for dyrking av insekt celler. Det har imidlertid blitt rapportert at 27-28 ° C er den optimale temperaturen for insekt celle vekst og infeksjon7,8.

Innføring av et sterkt signal før genet er nødvendig for høy uttrykk for secreted proteiner. Signalet sekvensen ville effektivt guide oversatt rekombinant protein i det endoplasmatiske retikulum protein sekresjon og post-translasjonell modifikasjoner nødvendig for riktig sammenleggbar og stabilisering3. Signalet peptid sekvenser, har slik som baculovirus innhylle protein GP64/67, honeybee melittin og andre, blitt valgt å forenkle uttrykk for sekretoriske rekombinante proteinene i baculovirus-mediert uttrykk systemer3. Innføring av signal peptid av GP67 har vist seg å forbedre uttrykk avkastningen av en secreted rekombinant protein, i forhold til bruker den iboende signal peptid av målet genet9. Hemolin er et hemolymph protein av gigantiske silke møll Hyalophora cecropia, indusert på bakterier smitte10. På grunn av den relativt høye nivået av indusert uttrykk, kan signalet peptid sekvensen av genet brukes å megle sekresjon uttrykk for rekombinante proteinene i baculovirus-insekt cellen systemet.

A. thaliana Tracheary Element differensiering hemmende faktor reseptor (TDR) og Pollen reseptor Kinase 3 (PRK3) begge tilhører anlegget Leucine-rik gjenta reseptor-lignende Kinase (LRR-RLK) familie av proteiner11,12 . For å studere struktur og funksjon av denne familien av anlegget reseptor proteiner, samt å lette strukturelle og biokjemiske karakterisering av andre plante utskilles proteiner, har baculovirus-insekt cellen uttrykk systemet blitt endret til forbedre protein kvalitet og dekkevne. Ekstracellulære domenene TDR og PRK3 blitt er uttrykt bruke to endrede uttrykk vektorer i baculovirus-insekt cellen uttrykk systemet. Begge ekstracellulære domenene TDR og PRK3 proteiner har blitt krystallisert. Denne artikkelen viser uttrykk og rensing av store mengder rekombinant utskilles anlegget proteiner med to modifisert baculovirus uttrykk vektorer ved å innlemme en GP67 eller en hemolin signal sekvens mellom selskapet og flere kloning nettsteder.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Merk: Et insekt cellen/baculovirus system med endrede uttrykk vektorer for sekretoriske plante protein uttrykk og krystallisering brukes.

1. endring av en Baculovirus uttrykk vektor med GP67 Signal peptid plante Protein sekresjon uttrykk

  1. Syntetisere et DNA fragment som inneholder en 5' BglII kutte området13, GP67 sekresjon signal sekvensen og en multi-kloning området med NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI og XhoI (figur 1A).
    Merk: Siden både BglII og BamHI fordøyd DNA resulterte i samme lim endepunktene, lineær vektoren kan ligate til fordøyd DNA fragment mens både BglII og BamHI områder i glødet ligation sekvensen vil være mutert til en sekvens som ikke er cleavable av enten BglII eller BamHI14.
  2. Digest 4 µg av DNA med BglII og XhoI, og 4 µg av et uttrykk vektor DNA med BamHI og XhoI14. Bland 10 enheter av hver begrensning enzym med DNA i en 1 x konsentrasjonen reaksjon buffer (50 mM kalium acetate, 20 mM Tris-acetate, 10 mM magnesium acetat og 100 µg/mL BSA, pH 7.9 ved 25 ° C) og ruge blandingen på 37 ° C 4 h.
    1. Rens forbrukeravgift DNA fragmentet og lineær vektoren DNA av en DNA gel utvinning kit15.
  3. Mix 100 ng av lineær vektoren DNA med 400 ng av fordøyd DNA fragmentere i en 10-µL ligation reaksjonen blanding som inneholder 1 x T4 DNA ligase reaksjon buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP og 10 mM DTT, pH 7.5 ved 25 ° C) og 5 enheter av T4 DNA ligase. Inkuber reaksjonsblandingen ved 16 ° C i 16 h.
  4. 5 µL av hemorroider blandingen forvandle 100 µL DH5α kompetent celler etter en standard transformasjon protokoll og velg de resulterende koloniene på en ampicillin-LB agar plate16. Plukk opp 5-10 kolonier og vokse hver koloni i 2 mL av LB medium som inneholder 100 µg/mL ampicillin ved 220 rpm og 37 ° C i en risting inkubator 16 h.
  5. Ekstra hver plasmider DNA med en DNA miniprep kit17 og bekrefte kloner av DNA sekvensering med en primer AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-forsterke A. thaliana TDR genet fragmentere koding rester 30-642 fra en syntetisk TDR gene konstruere (videresende primer: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, omvendt primer: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Forsterke DNA 30 sirkelstrukturer i en DNA polymerase reaksjon buffer inneholder en 0,5 mM dNTP blanding, 0,2 µM primere, 0.1 µg av DNA, 0.4 mM MgCl2og 1 reaksjon enhet av DNA-utvalg.
    1. PCR syklus trinnene, satt de første rødsprit til 95 ° C for 30 s, og deretter 30 sykluser av rødsprit 95 ° c for 30 s, annealing ved 55 ° C for 30 s og utvidelse ved 72 ° C i 1 min, med filtypen endelige ved 72 ° C i 5 minutter.
  7. Fordøye både PCR fragmentet og endret vektoren med NotI og BamHI begrensning endonuclease enzymer. Ligate gene fragmentet med lineær vektoren. Mix 100 ng av lineær vektoren DNA med 400 ng av fordøyd DNA fragmentere i en 10-µL ligation reaksjonen blanding som inneholder T4 DNA ligase reaksjon buffer og 5 enheter av T4 DNA ligase. Inkuber reaksjonsblandingen ved 16 ° C i 16 h.
  8. 5 µL av hemorroider blandingen forvandle 100 µL DH5α kompetent celler etter en standard transformasjon protokoll og velg de resulterende koloniene på en ampicillin-LB agar plate16. Bekrefte riktig kloner av DNA sekvensering.

2. endring av en Baculovirus uttrykk vektor med insekt Hemolin Signal peptid plante Protein sekresjon uttrykk

  1. Syntetisere et DNA fragment som inneholder en 5' BglII kutte området13, insekt hemolin sekresjon signal sekvensen og en multi-kloning området med NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI og XhoI (figur 1B).
  2. Digest 4 µg av DNA med BglII og XhoI, og 4 µg av et uttrykk vektor DNA med BamHI og XhoI14. Bland 10 enheter av hver begrensning enzym med DNA i en 1 x konsentrasjonen reaksjon buffer (50 mM kalium acetate, 20 mM Tris-acetate, 10 mM magnesium acetat og 100 µg/mL BSA, pH 7.9 ved 25 ° C) og ruge blandingen på 37 ° C 4 h.
    1. Rens forbrukeravgift DNA fragmentet og lineær vektoren DNA av en DNA gel utvinning kit15.
  3. Mix 100 ng av lineær vektoren DNA med 400 ng av fordøyd DNA fragmentere i en 10-µL ligation reaksjonen blanding som inneholder 1 x T4 DNA ligase reaksjon buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP og 10 mM DTT, pH 7.5 ved 25 ° C) og 5 enheter av T4 DNA ligase. Inkuber reaksjonsblandingen ved 16 ° C i 16 h.
  4. 5 µL av hemorroider blandingen forvandle 100 µL DH5α kompetent celler og velg koloniene på en ampicillin-LB agar plate. Plukk opp 5-10 kolonier og vokse hver kolonien i en 2-mL LB medium som inneholder 100 µg/mL ampicillin ved 220 rpm og 37 ° C i en risting inkubator 16 h.
  5. Ekstra plasmider DNA med en DNA miniprep kit17 og bekrefte kloner av DNA sekvensering med en primer AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-forsterke A. thaliana Pollen reseptor Kinase 3 (PRK3) genet fragment koding rester 20-237 fra en syntetisk PRK3 gene konstruksjon (videresende primer: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, omvendt primer: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Forsterke DNA 30 sirkelstrukturer i en DNA polymerase reaksjon buffer inneholder en 0,5 mM dNTP blanding, 0,2 µM primere, 0.1 µg av DNA, 0.4 mM MgCl2og 1 reaksjon enhet av DNA-utvalg.
    1. PCR syklus trinnene, satt de første rødsprit til 95 ° C for 30 s, og deretter 30 sykluser av rødsprit 95 ° c for 30 s, annealing ved 55 ° C for 30 s og utvidelse ved 72 ° C for 30 s i hver syklus, og endelig utvidelse ved 72 ° C i 5 minutter.
  7. Fordøye både PCR fragmentet og endret vektoren med NotI og BamHI begrensning endonuclease enzymer. Ligate gene fragmentet med lineær vektoren. Mix 100 ng av lineær vektoren DNA med 400 ng av fordøyd DNA fragmentere i en 10-µL ligation reaksjonen blanding som inneholder T4 DNA ligase reaksjon buffer og 5 enheter av T4 DNA ligase. Inkuber reaksjonsblandingen ved 16 ° C i 16 h.
  8. 5 µL av hemorroider blandingen forvandle 100 µL DH5α kompetent celler etter en standard transformasjon protokoll og velg de resulterende koloniene på en ampicillin-LB agar plate16. Bekrefte riktig kloner av DNA sekvensering.

3. produksjon og forsterkning av Baculovirus konstruerer skjuler rekombinant Protein uttrykk kassetten

  1. Bruk 100 ng av konstruere plasmider transformere 40 µL DH10Bac kompetent celler følger protokollen av baculovirus uttrykk system1. Inkuber transformasjon platene på 37 ° C i 48 timer.
  2. Plukke opp to hvite koloniene fra hver transformasjon plate, vaksinere hver koloni i 2 mL LB mediet inneholder 50 µg/mL kanamycin, 7 µg/mL gentamicin og 10 µg/mL tetracycline. Følg protokollen av baculovirus uttrykk system1 Pakk ut og kontroller bacmid DNA. Aliquot hver DNA i to rør med 20 µL hver, og lagre rør på 20 ° C.
    Merk: De følgende trinnene krever en steril operasjon.
  3. Vokse en monolayer av Sf9 celler i kultur medier med 10% fosterets bovin serum (FBS) og 100 µg/mL (eller 100 I.U./mL) penicillin-streptomycin antibiotika ved 27 ° C til 80% samløpet i en 6-vel plate. Anslå andelen samløpet avhengig av dekket område på vev kultur plate.
  4. Klargjør følgende løsninger i to bakteriefri 1.5-mL sentrifuge rør.
    1. Rør 1: For hver transfection, fortynne 20 µL av bacmid DNA i 100 µL av unsupplemented Sf9 celle kultur medium uten antibiotika. Bland fortynning forsiktig ved å sveipe siden av røret.
    2. Rør 2: For hver transfection, fortynne 8 µL av lipid transfection reagensen inn 100 µL av unsupplemented Sf9 celle kultur medium uten antibiotika. Bland fortynning grundig ved pipettering opp og ned 6 x.
  5. Kombinerer de to løsningene, bland dem forsiktig av pipettering langsomt opp og ned 3 x og ruge dem i 20-40 min ved romtemperatur.
  6. Vask hver brønn av Sf9 monolayer celler 2 x med 3 mL unsupplemented Sf9 celle kultur medium uten antibiotika. For hver transfection, legge 0,8 mL unsupplemented Sf9 celle kultur medium uten antibiotika til hver tube med lipid-DNA blandingen. Bland innholdet i rør forsiktig ved pipettering langsomt opp og ned 3 x. Sug opp vask media fra platene og overlegg prøvene med transfection blanding.
  7. Etter tillegg av transfection blandingen, ruge transfekterte platen i 5 h på 27 ° C. Erstatte transfection media med komplett Sf9 celle kultur medium med 10% FBS og 100 µg/mL (eller 100 I.U./mL) penicillin-streptomycin antibiotika. Inkuber transfekterte platen ved 27 ° C i 4 d.
  8. Høste og forsterke den rekombinant baculovirus.
    1. Samle nedbryting av infiserte plate i et sterilt 15-mL konisk rør etter 4 d med inkubering. Spinne nedbryting 1010 x g i 5 min fjerne celle rusk. Forkaste pellet og Dekanter nedbryting slik rent og lagre den på 4 ° C i opptil 1 år.
      Merk: Dette er P0 viruset. Det kan være aliquoted og lagret på-80 ° C for en lengre periode.
    2. For å forsterke hver rekombinant virus, vokse en monolayer av Sf9 celler på en 150 mm plate til 80% samløpet. Sug opp media fra platen, legge til 2 mL P0 virus celler tilhenger til plate og ruge platen i 1 time i en 27 ° C inkubator. Rock platen hvert 15 min for å blande mediet med celler.
      1. Legge til 25 mL av komplett Grace mediet som inneholder 10% FBS og 100 µg/mL (eller 100 I.U./mL) penicillin-streptomycin antibiotika. Inkuber platen i 3 d i en 27 ° C inkubator å få P1 passasje viruset.
    3. Samle nedbryting av infiserte plate i et sterilt 50 mL konisk rør og spinn 1010 x g i 5 min fjerne celle rusk. Dekanter nedbryting slik rent og lagre den på 4 ° C i opptil 1 år.
      Merk: P1 viruset kan være aliquoted og lagret på-80 ° C for en lengre periode.
    4. For å forsterke viruset fra P1 til P2 passering, vokse en monolayer av Sf9 celler på en 150 mm plate til 90% samløpet, Sug opp media av platen, legge 2 mL P1 viruset til plate og ruge det 1t i en 27 ° C inkubator.
    5. Gjenta 3.8.2 og 3.8.3 å få P2 og P3 passeringer av virus. Ikke Oppbevar P3 viruset i mer enn 2 måneder.

4. protein uttrykk, rensing med NiNTA og krystallisering

  1. Kultur 1 L Hi5 insekt celler i kultur medier med 100 µg/mL (eller 100 I.U./mL) penicillin-streptomycin antibiotika til en tetthet 2 x 106 100 RPM i en 27 ° C inkubator shaker. Nedspinning cellene 570 x g i 5 min, Dekanter nedbryting, resuspend cellene i 20 mL av fersk produsert P3 viruset og holde det ved romtemperatur for 1 h. forsiktig risting spinn flasken til resuspend cellene 1 x hvert 15 min.
  2. Overføre cellene til 1 L kultur medier med 100 µg/mL (eller 100 I.U./mL) penicillin-streptomycin antibiotika, kultur cellene på 100 rpm i en 27 ° C inkubator shaker for 72 h. spinn ned cellene på 1,010 x g i 5 min og samle nedbryting.
  3. PH indikator strimler justere pH i nedbryting til 8.0 ved å legge til 0.1 M HCl eller 0.1 M NaOH og legge bindende buffer på en siste konsentrasjon, som inneholder 20 mM Tris buffer ved pH 8.0, 100 mM NaCl, og 5 mM imidazole. Legge til en viss NiNTA harpiks (10-40 mL) basert på estimerte avkastningen av uttrykte sin-merket rekombinant protein.
    1. Bland løsningen på en magnetic røre med lav hastighet ved 4 ° C i 1 h. vask harpiks og elute bundet protein følgende standard NiNTA rensing protokollen18.
  4. Underlagt renset protein ionebytte og gel filtrering Ture, samt andre protein rensing metoder, til en homogen prøve.
    Merk: For TDR ectodomain, 20 mM Tris, pH 8, 100 mM NaCl ble brukt som gel filtrering buffer. For PRK3 ectodomain, 20 mM bis-Tris, pH 6, 100 mM NaCl ble brukt som den foretrukne gel filtrering bufferen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Som vist i figur 1, ble to modifisert pFastBac1 baculovirus uttrykk vektorer brukt til å uttrykke secreted proteiner i GP67 eller hemolin signal sekvensen erstatte iboende signal sekvensen av målet genet. Viral GP67 og insekt hemolin genene har vist seg for å ha høy sekresjon uttrykk nivåer i cellene. Fusion proteiner med en av disse to signal sekvenser forventes å har forbedret sekresjon uttrykk nivåer. Identisk flere kloning områder (MCS) ble konstruert i disse to endrede vektorer. En NotI nettstedet ble bevisst plassert på de 5'-siden av MCS, fordi NotI har en åtte-nukleotid sekvens i stedet for den vanligste seks-nukleotid sekvensen i mange andre begrensning nettsteder. Slik er et NotI område mindre finnes i målet genene enn de fleste andre begrensning nettsteder, begrensning fordøyelsen og kloning av de fleste mål gener mer gjennomførbart i forhold til bruker websteder begrensning. Kloning målet genet mellom NotI og en nedstrøms begrensning vil introdusere bare tre aminosyre rester, GGR, foran målet genet.

PBac1-GP67 og pBac1-Hem har vært vellykket benyttet for å uttrykke de ekstracellulære domenene av A. thaliana reseptorer TDR og PRK3, henholdsvis (figur 2). Etter rekombinante proteinene ble renset ved NiNTA bruker en engineering C-terminalen 6-histidin kode, var gjennomsnittlig protein avkastningen konsistent over 20 mg/L av Hi5 celler. Renheten av hver protein er nær eller høyere enn 50%, undersøkt med SDS side og Coomassie flekker.

De rekombinante proteinene ekstracellulære domenene TDR og PRK3 var videre renset ved størrelse utelukkelse kromatografi (figur 2). Renset protein ble konsentrert til 5 mg/mL, og deretter utsatt for en krystallisering screening. Forholdene, som hadde foreløpige krystaller av hver protein, var optimalisert til protein krystaller med en størrelse større enn 20 µm ble observert (Figur 3). Crystal strukturer av begge proteiner har vært rapportert11,12.

Figure 1
Figur 1: kart av modifisert pFastBac1 vektorer. DNA-sekvenser i disse panelene ble satt inn nedstrøms til polyhedrin promoter av pFastBac1 vektoren, eie signal peptid sekvensen og flere kloning nettstedene (MCS) for målet gener. Både vektorer inneholder samme MCS. (A) dette panelet viser en rekke kloning nettstedene nedstrøms til arrangøren av polyhedrin i pBac1-GP67 vektoren. Oversatt GP67 signal peptid aminosyresekvens er farget i rødt. Hvert unike begrensning område i MCS understrekes, med navnet på webområdet merket ovenfor. (B) dette panelet viser en rekke kloning nettstedene nedstrøms til arrangøren av polyhedrin i pBac1-Hem vektoren. Oversatt hemolin signal peptid aminosyresekvens er farget i rødt. Hvert unike begrensning område i MCS understrekes, med navnet på webområdet merket ovenfor. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: Protein uttrykk med endrede pFastBac1 vektorer i baculovirus-insekt cellen systemet. (A) ectodomain av TDR ble uttrykt i Hi5 insekt celler, renset ved nikkel-tilhørighet og størrelse utelukkelse kromatografi (S), og løst på SDS side gel. Nikkel harpiks ble vasket en gang med en buffer som inneholder 5 mM imidazole (vask 1) og en gang med 20 mM imidazole (vask 2). (B) er dette en SDS side analyse viser uttrykk og nikkel affinitet rensing (NiNTA), samt størrelse utelukkelse kromatografi av PRK3 ectodomain. Molekylvekt (MW) markører med tilsvarende størrelser er merket. Den røde piler i hvert panel betegne uttrykkene og forventede størrelser av rekombinant TDR og PRK3 ectodomain proteiner. Flere bånd natur uttrykt proteiner er sannsyligvis for heterogene glykosylering. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: Protein krystaller ekstracellulære domenene Arabidopsis thaliana TDR og PRK3. (A) dette panelet viser protein krystallene ekstracellulære domenene av A. thaliana TDR. (B) dette panelet viser protein krystallene ekstracellulære domenene av A. thaliana PRK3. En skala bar vises under hvert bilde. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Gitt mangfoldet i størrelse og stabilitet av tusenvis av proteiner tilstede i biologiske systemer, er det ofte empirisk for en forskning laboratorium bestemme hvilket heterologous uttrykk system som skal velges for uttrykk for et bestemt protein. E. coli uttrykk systemet er ofte førstevalget for protein uttrykk på grunn av den korte livssyklusen for bakterier, lavpris kultur medier og relativt lett å skalere opp19. For uttrykk for store eukaryote proteiner med størrelse mer enn 60 kDa, men ved hjelp av E. coli resulterer systemet ofte i uløselig proteiner i inkludering kroppen eller aggregering20. For uttrykk for de vanskelige proteinene, og for andre secreted proteiner, kan baculovirus-insekt cellen uttrykk systemet være mer fordelaktig enn E coli. Spesielt når uttrykke utskilles eukaryote proteiner, kan modifisert baculovirus-insekt celle uttrykk systemet være et foretrukket valg.

Mange secreted eukaryote proteiner, inkludert anlegget utskilles proteiner, trenger komplekse glykosylering, disulfide dannelse og andre post-translasjonell endringer under protein folding og sekresjon21. E. coli systemer har ikke den cellulære maskineriet til å behandle de komplekse endringene som kreves for mange av de eukaryote proteiner22. Gjær har en relativt mer avanserte glykosylering system enn E. coli23. Men for uttrykket av secreted proteinene i høyere eukaryotic arter og planter presenterer baculovirus-insekt cellen systemet en betydelig fordel. Siden glykosylering påvirker proteinfolding og stabilitet24, mange av secreted rekombinante proteinene uttrykt i E. coli og gjær systemene har en lav avkastning og pleier å samle, antagelig på grunn av feil proteinfolding. Baculovirus-insekt systemet er blitt endret for å forbedre protein glykosylering, som gjør det til et ideelt system for uttrykket av utskilles eukaryote proteiner25. I denne studien signal både i GP67 og hemolin peptider har blitt brukt til å veilede sekresjon uttrykk for to plante reseptor proteiner for protein krystallisering. Med disse studiene i tankene, valg av enten signal peptid er et kritisk punkt, og den trenger mer systematisk sammenliknende studier med et sett av mål gener fra ulike organismer.

Ideen om å bruke både GP67 og hemolin signal peptider for å forbedre protein sekresjon uttrykk var drevet av høy uttrykk avkastningen av både gener. Men hvis protein sekresjon og posttranslational modifisering maskiner av uttrykket verten er overbelastet med uttrykt rekombinante proteiner, kan secreted rekombinante proteinene ikke ha tilstrekkelig modifikasjoner, spesielt glykosylering. Begge endret vektorer har brukt kunne uttrykke mange anlegg sekretoriske proteiner11,12,26, hvorav mange har tendens til samlet, som skyldes sannsynligvis feil eller utilstrekkelig glykosylering. Derfor for uttrykket av disse vanskelig proteiner, både sterke og svake signalet peptid sekvenser må testes og kvaliteten på uttrykt rekombinante proteinene skal sammenlignes. Husk at et svakt signal peptid sekvens vil redusere den totale avkastningen av proteinet; men kan det gi sekresjon maskiner av uttrykket verten nok kapasitet til å behandle protein sekresjon og modifikasjoner.

I tillegg til uttrykket av heterologous utskilles proteiner i insekt celler, har pattedyr celle- og plante celle uttrykk systemer blitt brukt med hell i overuttrykte rekombinant pattedyr og plante proteiner, henholdsvis27, 28,29. I forhold til de heterologous systemene, i nærheten av endogene uttrykket tilstand av pattedyr eller plante utskilles proteiner får den nesten innfødt endring machineries verten cellene til godt foldet proteiner. Innvendingen ved bruk av nær-innfødt uttrykk systemet er at uttrykt rekombinante proteinene kan forstyrre fysiologiske funksjon celler som potensielt kan ha innvirkning på den endelige avkastningen av proteiner.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Dette arbeidet ble støttet av de nye fakultetet oppstart midlene fra North Carolina State University for Guozhou Xu.

Materials

Name Company Catalog Number Comments
Incubator shaker VWR Model Excella E25 27 oC
Incubator VWR Model 2005 27 oC
Centrifuge BECKMAN Model J-6 with a swing bucket rotor
Herculase II Fusion DNA Polymerase Agilent 600677-51 For PCR amplification of DNA
Thermal Cycler BIO-RAD Model C1000 Touch For PCR amplification of DNA
Incubator shaker New Brunswick Scientific Model I 24 For growing baceria culture
Customer DNA synthesis GENSCRIPT
BamHI (HF) New England Biolabs R3136S Restriction Endonuclease
BglII New England Biolabs R0144S Restriction Endonuclease
NotI (HF) New England Biolabs R3189S Restriction Endonuclease
XhoI New England Biolabs R0146S Restriction Endonuclease
T4 DNA ligase New England Biolabs M0202T DNA ligation
QIAquick Gel Extraction Kit Qiagen 28704 DNA purification from Agorase gel
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid DNA purification from bacteria culture
Agarose Thermo Fisher Scientific 15510-019 For DNA gel electropherosis
MAX Efficiency DH5α competen cell Invitrogen 18-258-012 For transformation of DNA ligation mixture
Lennox L LB Broth Research Product International Corp. L24066-5000.0 For making bacteria culture
Ampicillin sodium salt Thermo Fisher Scientific 11593-019 Antibiotics
Kanamycin Sulfate Thermo Fisher Scientific 15160-054 Antibiotics
Tetracycline Thermo Fisher Scientific 64-75-5 Antibiotics
Gentamicin Thermo Fisher Scientific 15710-064 Antibiotics
MAX Efficiency DH10Bac competent cells Thermo Fisher Scientific 10361-012 For making bacmid DNA
S.O.C. Medium Thermo Fisher Scientific 15544-034 For DNA transformation
CellFECTIN II Reagent Thermo Fisher Scientific 10362-101 Insect cell transfection reagent
Bac-to-Bac Expression System Thermo Fisher Scientific 10359-016 Baculovirus-insect cells expression kit
Bluo-gal Thermo Fisher Scientific 15519-028 For isolation of recominant Bacmid DNA
IPTG Thermo Fisher Scientific 15529-019 For isolation of recominant Bacmid DNA
pFastBac1 Thermo Fisher Scientific 10360014 Baculorirus expression vector
Sf9 cells Thermo Fisher Scientific 11496015 Sf9 monolayer cells
Hi5 cells Thermo Fisher Scientific B85502 High Five insect cells
Grace’s insect medium, unsupplemented Thermo Fisher Scientific 11595030 Sf9 cell transfection minimum medium
Grace’s insect medium, supplemented Thermo Fisher Scientific 11605102 Sf9 monolayer cell culture complete medium
Sf-900 II SFM Thermo Fisher Scientific 10902104 Sf9 suspension cell culture medium without FBS
Express Five SFM Thermo Fisher Scientific 10486025 Hi5 cell culture medium
Penicillin-Streptomycin Thermo Fisher Scientific 15140122 100 ml (10,000 I.U./ml)
L-Glutamine (200 mM) Thermo Fisher Scientific 25030081 100 ml
FBS Certified Thermo Fisher Scientific 16000-044 500 ml
6-well plates Thermo Fisher Scientific 08-772-1B Flat-bottom
150 mm plates Thermo Fisher Scientific 353025 100/case
1.5 ml Microcentrifuge Tubes USA Scientific 1415-2500 500 tubes/bag
15 ml conical screw cap centrifuge tubes USA Scientific 1475-0511 25 tubes/bag
50 ml conical screw cap centrifuge tubes USA Scientific 1500-1211 25 tubes/bag
Ni-NTA Superflow Qiagen 30430 NiNTA resin
pH-indicator strips EMD Millipore Corporation 1.09535.0001 pH 0 - 14

DOWNLOAD MATERIALS LIST

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317 (2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796 (2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics