Ændre Baculovirus udtryk vektorer til at producere udskilles vegetabilske proteiner i insekt celler

JoVE Journal
Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi præsenterer her, protokoller for at udnytte den insekt celle og baculovirus protein udtryk system til at producere store mængder af planten udskilles protein til protein krystallisering. Et baculovirus udtryk vektor er blevet ændret med enten GP67 eller insekt hemolin signal peptid for plante protein sekretion udtryk i insekt celler.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Det har været en udfordring for forskerne at udtrykke rekombinant sekretoriske eukaryote proteiner til strukturelle og biokemiske undersøgelser. Baculovirus-medieret insekt celle udtryk system er et af de systemer, der bruges til at udtrykke rekombinant eukaryote sekretoriske proteiner med nogle posttranslationelle modifikationer. De sekretoriske proteiner skal dirigeres gennem de sekretoriske veje for protein glykosylering, disulfid obligationer dannelse og andre posttranslationelle modifikationer. For at forbedre den eksisterende insekt celle udtryk af sekretoriske vegetabilske proteiner, er et baculovirus udtryk vektor ændret ved tilsætning af enten en GP67 eller en hemolin signal peptid sekvens mellem arrangøren og kloning af flere websteder. Denne nydesignede modificerede vektorsystem produceret med succes et højt udbytte af opløselige rekombinant udskilles plante receptorproteiner fra Arabidopsis thaliana. To af udtrykt vegetabilske proteiner, de ekstracellulære domæner i Arabidopsis TDR og PRK3 plasmamembran receptorer, var krystalliseret til X-ray krystallografiske undersøgelser. Den modificerede vektorsystem er et forbedret værktøj, der kan potentielt bruges til udtryk af rekombinant sekretoriske proteiner i dyreriget så godt.

Introduction

Det er bydende nødvendigt for et forskningslaboratorium at være i stand til at producere store mængder af homogene rekombinante proteiner til biokemiske og biofysiske beskrivelser, især for X-ray krystallografiske undersøgelser. Der er mange veletablerede Heterolog ekspression systemer såsom Escherichia coli, gær, insekt celler, pattedyrceller, planteceller, etc. blandt dem, baculovirus-medieret insekt celle udtryk system er en af mest almindeligt anvendte teknikker til at producere store mængder af strukturelt foldede store rekombinant eukaryote proteiner for protein krystallisering1.

Udtrykket vektorer af baculovirus udtryk system er udviklet til at indeholde en stærk polyhedrin eller P10 initiativtageren til at producere et højt udbytte af rekombinant intracellulære proteiner2,3. For at gøre en rekombinante baculovirus, klonet gen af interesse i et insekt vektor indeholdende polyhedrin (polh) locus af Autographa californica multi-nucleopolyhedroviral genom. Den resulterende konstruktion er derefter sekventeret og dets korrekte åben læsning ramme (ORF) er verificeret. Den rigtige konstruktion føres derefter ind i cellen vært insekt gennem processen med Transfektion. Gen af interesse er indsat i det virale genom af homologe rekombination. Denne begivenhed resulterer i produktionen af af rekombinante viral genomet, som derefter replikater at producere rekombinant okulerede virus partikler1.

De insekt celler, der er mest almindeligt anvendt i udtrykket systemet er Sf9 og høj fem (Hi5) celler. Sf9 celler er en klonal isolat af Sf21, stammer fra de puppe æggestokkene celler af Spodoptera frugiperda, og Hi5 celler er en klonal isolatet hidrører fra forældrenes Trichoplusia ni æggestokkene celle linje TN-3684,5. Co transfections, virus forstærkning og plaque assays er gennemført på Sf9 celler, mens Hi5 celler er typisk valgt at producere større mængder af rekombinante proteiner6. Det er værd at bemærke, at Hi5 cellerne ikke er egnet til generation og forstærkning af virus descendenter på grund af deres tendens til at producere mutant vira. Traditionelt, anses et temperaturområde på 25-30 ° C for at være god til dyrkning af insekt celler. Det er blevet rapporteret, at 27-28 ° C er den optimale temperatur for de insekt celle-vækst og infektion7,-8.

Indførelsen af et stærkt signal sekvensen forud genet er nødvendig for den høje udtryk for de udskilles proteiner. Signal sekvensen vil effektivt guide den oversatte rekombinante proteiner i det endoplasmatiske reticulum for protein sekretion og posttranslationelle ændringer nødvendige for ordentlig foldning og stabilisering3. Signal peptid sekvenser, er som baculovirus indhylle protein GP64/67, honningbien melittin og andre, blevet valgt til at lette udtrykket af sekretoriske rekombinante proteiner i baculovirus-medieret udtryk systemer3. Indførelsen af signal peptid af GP67 har vist sig at forbedre udtryk udbyttet af en udskilles rekombinante protein, i forhold til ved hjælp af den iboende signal peptid target gen9. Hemolin er en hemolymph protein af den gigantiske silke møl Hyalophora cecropia, fremkaldt af bakterier infektion10. På grund af det relativt høje niveau af inducerede udtryk, kan signal peptid sekvens af genet bruges til at mægle udtrykket sekretion af af rekombinante proteiner i baculovirus-insekt celle system.

A. thaliana Tracheary Element differentiering hæmmende faktor Receptor (TDR) og Pollen Receptor Kinase 3 (PRK3) begge tilhører familien plante leucin-rig Repeat Receptor-lignende Kinase (LRR-RLK) af proteiner11,12 . For at studere struktur og funktion af denne familie af plante receptorproteiner, samt at lette det strukturelle og biokemiske karakterisering af andre vegetabilske udskilles proteiner, er baculovirus-insekt celle udtryk system blevet ændret til forbedre protein kvalitet og produktion afkast. De ekstracellulære domæner af både TDR og PRK3 har med held været udtrykt ved hjælp af to modificerede udtryk vektorer i baculovirus-insekt celle udtryk system. Begge de ekstracellulære domæner i TDR og PRK3 proteiner har været krystalliseret. Denne artikel rapporterer den proteinekspression og -oprensning af store mængder af rekombinant udskilles vegetabilske proteiner med to modificerede baculovirus udtryk vektorer ved at indarbejde enten en GP67 eller en hemolin signal sekvensen mellem arrangøren og flere kloning websteder.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Bemærk: Bruges en insekt celle/baculovirus system med modificerede udtryk vektorer for sekretoriske plante protein udtryk og krystallisering.

1. ændring af en Baculovirus udtryk vektor med GP67 Signal peptid for plante Protein sekretion udtryk

  1. Syntetisere en DNA-fragment, indeholdende en 5' BglII skæring site13, GP67 sekretion signal sekvensen, og en multi-kloning site med NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI og XhoI (figur 1A).
    Bemærk: Da både BglII og BamHI fordøjet DNA resulterede i samme klæbende ender, lineariseret vektoren kan ligate til de nedbrudte DNA-fragment, mens både BglII og BamHI steder i udglødet ligatur sekvens vil blive omdannet til en sekvens, der ikke er cleavable af enten BglII eller BamHI14.
  2. Digest 4 µg DNA med BglII og XhoI, og 4 µg af et udtryk vektor DNA med BamHI og XhoI14. Bland 10 enheder af hver begrænsning enzym med DNA i en 1 x koncentration reaktion buffer (50 mM kalium acetat, 20 mM Tris-acetat, 10 mM magnesium acetat og 100 µg/mL BSA, pH 7,9 ved 25 ° C) og inkuberes blanding ved 37 ° C i 4 timer.
    1. Rense den skåret DNA-fragment og lineariseret vektoren DNA af et DNA gel udvinding kit15.
  3. Mix 100 ng lineariseret vektorens DNA med 400 ng af fordøjet DNA fragmenterer i en 10 µL ligatur reaktionsblandingen indeholdende 1 x T4 DNA ligase reaktion buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP og 10 mM DTT, pH 7,5 ved 25 ° C) og 5 enheder af T4 DNA Ligase. Inkuber reaktionsblanding ved 16 ° C i 16 h.
  4. Omdanne 100 µL af DH5α kompetente celler efter en standard transformation protokol 5 µL af ligatur blandingen og vælg de resulterende kolonier på en ampicillin-LB agar plade16. Afhente 5-10 kolonier og vokse hver koloni i 2 mL af LB medium indeholdende 100 µg/mL ampicillin på 220 rpm og 37 ° C i en rystende inkubator for 16 h.
  5. Udtrække hver plasmid DNA med et DNA miniprep kit17 og bekræfte kloner af DNA-sekventering med en primer AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-Forstærk A. thaliana TDR gen fragment kodning restkoncentrationer 30-642 fra en syntetisk TDR gen konstruere (videresende primer: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, omvendt primer: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Forstærke DNA for 30 cykler i et DNA polymerase reaktion buffer indeholdende en 0,5 mM dNTP mix, 0,2 µM primere, 0,1 µg af DNA-template, 0,4 mM MgCl2og 1 varslingsenhed af DNA polymerase.
    1. PCR cyklus trin, angive de første denaturering ved 95 ° C i 30 s, og derefter 30 cyklusser af denaturering ved 95 ° C til 30 s, udglødning ved 55 ° C i 30 s og udvidelse ved 72 ° C i 1 min, med en sidste udvidelse ved 72 ° C i 5 min.
  7. Fordøje både PCR fragment og den modificerede vektor med NotI og BamHI begrænsning liv1975 enzymer. Ligate gen fragment med lineariseret vektoren. Mix 100 ng lineariseret vektorens DNA med 400 ng af fordøjet DNA fragmenterer i en 10 µL ligatur reaktionsblanding, der indeholder T4 DNA ligase reaktion buffer og 5 enheder af T4 DNA ligase. Inkuber reaktionsblanding ved 16 ° C i 16 h.
  8. Omdanne 100 µL af DH5α kompetente celler efter en standard transformation protokol 5 µL af ligatur blandingen og vælg de resulterende kolonier på en ampicillin-LB agar plade16. Bekræfte de korrekte kloner af DNA-sekventering.

2. ændring af en Baculovirus udtryk vektor med insekt Hemolin Signal peptid for plante Protein sekretion udtryk

  1. Syntetisere en DNA-fragment, indeholdende en 5' BglII skæring site13, insekt hemolin sekretion signal sekvensen, og en multi-kloning site med NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI og XhoI (figur 1B).
  2. Digest 4 µg DNA med BglII og XhoI, og 4 µg af et udtryk vektor DNA med BamHI og XhoI14. Bland 10 enheder af hver begrænsning enzym med DNA i en 1 x koncentration reaktion buffer (50 mM kalium acetat, 20 mM Tris-acetat, 10 mM magnesium acetat og 100 µg/mL BSA, pH 7,9 ved 25 ° C) og inkuberes blanding ved 37 ° C i 4 timer.
    1. Rense den skåret DNA-fragment og lineariseret vektoren DNA af et DNA gel udvinding kit15.
  3. Mix 100 ng lineariseret vektorens DNA med 400 ng af fordøjet DNA fragmenterer i en 10 µL ligatur reaktionsblandingen indeholdende 1 x T4 DNA ligase reaktion buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP og 10 mM DTT, pH 7,5 ved 25 ° C) og 5 enheder af T4 DNA Ligase. Inkuber reaktionsblanding ved 16 ° C i 16 h.
  4. Omdanne 5 µL af ligatur blanding i 100 µL af DH5α kompetente celler og vælg kolonier på en ampicillin-LB-agar plade. Afhente 5-10 kolonier og vokse hver koloni i en 2-mL LB medium indeholdende 100 µg/mL ampicillin på 220 rpm og 37 ° C i en rystende inkubator for 16 h.
  5. Uddrag plasmid DNA med et DNA miniprep kit17 og bekræfte kloner af DNA-sekventering med en primer AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-Forstærk A. thaliana Pollen Receptor Kinase 3 (PRK3) genet fragment kodning restkoncentrationer 20-237 fra en syntetisk PRK3 gen konstruktion (videresende primer: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, omvendt primer: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Forstærke DNA for 30 cykler i et DNA polymerase reaktion buffer indeholdende en 0,5 mM dNTP mix, 0,2 µM primere, 0,1 µg af DNA-template, 0,4 mM MgCl2og 1 varslingsenhed af DNA polymerase.
    1. PCR cyklus trin, angive de første denaturering ved 95 ° C i 30 s, og derefter 30 cyklusser af denaturering ved 95 ° C til 30 s, udglødning ved 55 ° C i 30 s og udvidelse ved 72 ° C i 30 s inden for hver cyklus, og den sidste udvidelse ved 72 ° C i 5 min.
  7. Fordøje både PCR fragment og den modificerede vektor med NotI og BamHI begrænsning liv1975 enzymer. Ligate gen fragment med lineariseret vektoren. Mix 100 ng lineariseret vektorens DNA med 400 ng af fordøjet DNA fragmenterer i en 10 µL ligatur reaktionsblanding, der indeholder T4 DNA ligase reaktion buffer og 5 enheder af T4 DNA ligase. Inkuber reaktionsblanding ved 16 ° C i 16 h.
  8. Omdanne 100 µL af DH5α kompetente celler efter en standard transformation protokol 5 µL af ligatur blandingen og vælg de resulterende kolonier på en ampicillin-LB agar plade16. Bekræfte de korrekte kloner af DNA-sekventering.

3. produktions- og forstærkning af Baculovirus konstruerer husly rekombinante Protein udtryk kassette

  1. Brug 100 ng af construct plasmid at omdanne 40 µL af DH10Bac kompetente celler efter protokollen af baculovirus udtryk system1. Inkuber transformation plader ved 37 ° C i 48 timer.
  2. Afhente to hvide kolonier fra hver transformation plade, podes hver koloni til 2 mL af LB medium indeholdende 50 µg/mL kanamycin, 7 µg/mL gentamicin og 10 µg/mL tetracyclin. Følg baculovirus udtryk system1 til at udtrække og kontrollere bacmid DNA-protokollen. Alikvot hver DNA i to rør med 20 µL hver, og gemme rør ved-20 ° C.
    Bemærk: Følgende trin kræver en aseptisk operation.
  3. Vokse en éncellelag af Sf9 celler i kultur medier med 10% føtal bovint serum (FBS) og 100 µg/mL (eller 100 I.U./mL) penicillin-streptomycin antibiotika på 27 ° C til 80% sammenløbet i en 6-godt plade. Anslå procentdelen af sammenløbet baseret på andelen af dækkede område på vævskultur plade.
  4. Forbered de følgende løsninger i to sterile 1,5 mL centrifugeglas.
    1. Rør 1: For hver Transfektion fortyndes 20 µL af bacmid DNA i 100 µL af unsupplemented Sf9 cellekulturmedium uden antibiotika. Bland fortyndingen forsigtigt ved at bladre til side af røret.
    2. Rør 2: For hver Transfektion fortyndes 8 µL af lipid Transfektion reagens i 100 µL af unsupplemented Sf9 cellekulturmedium uden antibiotika. Bland fortyndingen grundigt af pipettering op og ned til 6 x.
  5. Kombinere de to løsninger, bland dem forsigtigt af pipettering langsomt op og ned til 3 x, og Inkuber dem i 20-40 min ved stuetemperatur.
  6. Vask hver brønd i Sf9 éncellelag celler 2 x med 3 mL af unsupplemented Sf9 cellekulturmedium uden antibiotika. For hver Transfektion 0,8 mL unsupplemented Sf9 cellekulturmedium uden antibiotika tilsættes til hver tube, som indeholder den lipid-DNA. Bland indholdet af rør forsigtigt af pipettering langsomt op og ned til 3 x. Opsug vask medier fra pladerne og overlay prøver med Transfektion blanding.
  7. Efter Transfektion blandingen Derudover inkuberes transfected pladen i 5 timer ved 27 ° C. Erstatte Transfektion media med den komplette Sf9 cellekulturmedium indeholdende 10% FBS og 100 µg/mL (eller 100 I.U./mL) penicillin-streptomycin antibiotika. Inkubér transfected pladen på 27 ° C i 4 d.
  8. Høst og forstærke den rekombinante baculovirus.
    1. Indsamle supernatanten af det inficerede plade i en steril 15 mL konisk tube efter 4 d inkubation. Spin supernatanten ved 1010 x g i 5 min at fjerne celle debris. Kassér pelleten og dekanteres til en ren rør og gemme det ved 4 ° C i op til 1 år.
      Bemærk: Dette er P0 virus. Det kan være aliquoted og opbevares ved-80 ° C i en længere periode.
    2. For at forstærke hver rekombinant virus, vokse en éncellelag af Sf9 celler på en 150 mm plade til 80% sammenløbet. Opsug medier fra pladen, tilsættes 2 mL af virussen P0 til celler tilhænger til pladen og inkuberes plade for 1 h i en 27 ° C inkubator. Rock plade hver 15 min til at blande mediet med celler.
      1. Der tilsættes 25 mL af komplet nåde medier indeholdende 10% FBS og 100 µg/mL (eller 100 I.U./mL) penicillin-streptomycin antibiotika. Inkuber plade for 3 d i en 27 ° C inkubator at opnå P1 passage virus.
    3. Indsamle supernatanten af det inficerede plade i en steril 50 mL konisk rør og spin på 1010 x g for 5 min at fjerne celle debris. Dekanteres til en ren rør og gemme det ved 4 ° C i op til 1 år.
      Bemærk: P1 virus kan være aliquoted og opbevares ved-80 ° C i en længere periode.
    4. For at forstærke virus fra P1 P2 passage, vokser en éncellelag af Sf9 celler på en 150 mm plade til 90% sammenløb, Aspirér medier af pladen, tilsættes 2 mL af virussen P1 til pladen og Inkuber i 1 time i en 27 ° C inkubator.
    5. Gentag trin 3.8.2 og 3.8.3 at opnå P2 og P3 passager i virus. Opbevar ikke virussen P3 i mere end 2 måneder.

4. protein udtryk, rensning med NiNTA og krystallisering

  1. Kultur 1 L Hi5 insekt celler i kultur medier med 100 µg/mL (eller 100 I.U./mL) penicillin-streptomycin antibiotika til en tæthed af 2 x 106 på 100 rpm i en 27 ° C inkubator shaker. Spin ned celler ved 570 x g i 5 min, den dekanteres, resuspend celler i 20 mL af frisk fremstillet P3 virus og opbevare det ved stuetemperatur for 1 h. Ryst forsigtigt spin flasken til resuspend celler 1 x hver 15 min.
  2. Overfør celler til 1 L kultur medier med 100 µg/mL (eller 100 I.U./mL) penicillin-streptomycin antibiotika, kultur, cellerne i 100 rpm i en 27 ° C inkubator shaker til 72 h. Spin ned celler ved 1.010 x g i 5 min og indsamle supernatanten.
  3. Brug pH indikator strips til at justere pH-værdien af supernatanten til 8,0 ved tilsætning af enten 0.1 M HCl eller 0,1 M NaOH og tilføje binding buffer i en endelig koncentration, som indeholder 20 mM Tris buffer til pH 8,0, 100 mM NaCl, og 5 mM imidazol. Tilføje en vis mængde af NiNTA harpiks (10-40 mL), baseret på forventede udbytte af udtrykt hans-mærkede rekombinante proteiner.
    1. Bland løsning på en magnetisk opsigt med lav hastighed ved 4 ° C i 1 h. vask harpiks og elueres bundet protein efter standard NiNTA rensning protokol18.
  4. Ionbytning er underlagt den oprenset protein og gel filtrering kromatografi, samt andre protein oprensning metoder, til at give en homogen prøve.
    Bemærk: For TDR ectodomain, 20 mM Tris, pH 8, 100 mM NaCl blev brugt som gel filtrering buffer. For PRK3 ectodomain, 20 mM bis-Tris, pH 6, 100 mM NaCl blev brugt som foretrukne gel filtrering buffer.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Som vist i figur 1, blev to modificerede pFastBac1 baculovirus udtryk vektorer brugt til at udtrykke de udskilles proteiner med enten GP67 eller hemolin signal sekvensen at erstatte iboende signal sekvensen af target-genet. Den virale GP67 og insekt hemolin gener er blevet påvist for at have høj sekretion udtryk niveauer i cellerne. Fusion proteiner med enten af disse to signal sekvenser forventes at have væsentligt forbedret sekretion udtryk niveauer. Identiske flere kloning websteder (MCS) blev udviklet i disse to modificerede vektorer. Et individuelt websted blev bevidst placeret på den mest 5'-side af MCS, fordi NotI har en otte-nucleotidsekvensen snarere end den mest almindelige seks-nucleotidsekvensen findes i mange andre websteder, begrænsning. Som sådan er en NotI site mindre til stede i target gener end de fleste andre begrænsning sites, at gøre begrænsning fordøjelse og kloning af de fleste mål gener mere realistisk i forhold til ved hjælp af andre begrænsning websteder. Kloning target gen mellem NotI og en downstream begrænsning site vil indføre kun tre aminosyrerester, GGR, forud for mål-genet.

PBac1-GP67 og pBac1-Hem har været med succes udnyttet til at udtrykke de ekstracellulære domæner af A. thaliana receptorer TDR og PRK3, henholdsvis (figur 2). Efter de rekombinante proteiner blev renset af NiNTA ved hjælp af en ingeniør C-terminale 6-histidin tag, var det gennemsnitlige protein udbytte konsekvent omkring 20 mg/L af Hi5 celler. Renheden af hvert protein er tæt på eller højere end 50%, undersøgt med SDS-PAGE og Coomassie farvning.

De rekombinante proteiner af de ekstracellulære domæner i TDR og PRK3 blev yderligere renset ved størrelse udstødelse kromatografi (figur 2). Den renset protein var koncentreret på 5 mg/mL og derefter udsat for krystallisering screening. De betingelser, der gav indledende krystaller af hvert protein, blev optimeret indtil protein krystaller med en størrelse større end 20 µm blev observeret (figur 3). Krystal strukturer af både proteiner har været rapporteret11,12.

Figure 1
Figur 1: kort over modificerede pFastBac1 vektorer. De DNA-sekvenser, der er vist i disse paneler blev indsat neden for polyhedrin promotor af vektoren, pFastBac1, at besidde signal peptid sekvens og de flere kloning websteder (MCS) for target gener. Begge vektorer indeholder den samme MCS. (A) dette panel viser en sekvens af kloning websteder nedstrøms for polyhedrin på pBac1 GP67 vektor. Den oversatte GP67 signal peptid aminosyresekvens er farvet i rødt. Hver entydig begrænsning site i MCS er understreget, med navnet på webstedet mærket ovenfor. (B) dette panel viser en sekvens af kloning websteder neden for polyhedrin i pBac1-Hem vektor. Oversat hemolin signal peptid aminosyresekvens er farvet i rødt. Hver entydig begrænsning site i MCS er understreget, med navnet på webstedet mærket ovenfor. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: Protein udtryk med de modificerede pFastBac1 vektorer i baculovirus-insekt celle systemet. (A) ectodomain af TDR blev udtrykt i insekt celler, Hi5, renset af nikkel-affinitet og størrelse udstødelse kromatografi (S), og løst på SDS-PAGE gel. Nikkel harpiks blev vasket én gang med en buffer, som indeholder 5 mM imidazol (vask 1), og anden gang med 20 mM imidazol (vask 2). (B) Dette er en SDS-PAGE analyse viser udtryk og nikkel affinitet rensning (NiNTA), samt størrelse udstødelse kromatografi af PRK3 ectodomain. Molekylær vægt (MW) markører med de tilsvarende størrelser er mærket. De røde pile i hvert panel betegne udtrykkene og den forventede størrelser af rekombinant TDR og PRK3 ectodomain proteiner. Multi-band naturer af de udtrykte proteiner er sandsynligvis heterogen glykosylering. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: Protein krystaller af de ekstracellulære domæner i Arabidopsis thaliana TDR og PRK3. (A) dette panel viser protein krystaller af de ekstracellulære domæner af A. thaliana TDR. (B) dette panel viser protein krystaller af de ekstracellulære domæner af A. thaliana PRK3. En skalalinjen er vist under hvert billede. Venligst klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Betragtning af mangfoldigheden i størrelse og stabilitet af tusindvis af proteiner til stede i de biologiske systemer, det er ofte empirisk til et forskningsprojekt laboratorium for at afgøre, hvilke heterolog ekspressionssystem har at blive valgt til udtryk af et specifikt protein. E. coli udtryk system er ofte det første valg for protein udtryk på grund af den korte livscyklus for bakterier, lave omkostninger dyrkningsmedier og relativt let at skalere op19. For at udtrykke stor eukaryote proteiner med størrelser i mere end 60 kDa, men ved hjælp af E. coli resulterer system ofte i uopløselige proteiner i inklusion krop eller sammenlægning20. Udtryk for disse vanskelige proteiner, og andre udskilles proteiner, kan baculovirus-insekt celle udtryk system være mere fordelagtig end E coli. Især når at udtrykke udskilles eukaryote proteiner, kunne denne modificerede baculovirus-insekt celle ekspressionssystem foretrukne valg.

Mange udskilles eukaryote proteiner, herunder vegetabilske udskilles proteiner, behov for komplekse glykosylering, disulfid dannelse og andre posttranslationelle modifikationer under protein foldning og sekretion21. E. coli systemer har ikke den cellulære maskiner til at behandle komplekse ændringer kræves til mange af de eukaryote proteiner22. Gær har en forholdsvis mere avancerede glykosylering system end E. coli23. Men for at udtrykke de udskilles proteiner i højere eukaryote arter og planter, baculovirus-insekt celle systemet præsenterer en betydelig fordel. Da glykosylering indflydelse, proteinfoldning og stabilitet24, mange af de udskilles rekombinante proteiner udtrykt i E. coli og gær-systemer har et lavt udbytte og har tendens til at samle, formentlig på grund af forkert proteinfoldning. Baculovirus-insekt system er blevet ændret for at forbedre protein glykosylering, hvilket gør det et ideelt system til udtryk for udskilles eukaryote proteiner25. I denne undersøgelse signal både GP67 og hemolin peptider held har været anvendt til at guide sekretion udtrykket for to plante receptorproteiner for protein krystallisering. Med disse undersøgelser i tankerne selv, valget af enten signal peptid er et afgørende skridt, og det har brug for mere systematiske sammenlignende undersøgelser med et sæt af mål gener fra forskellige organismer.

Tanken om at bruge både GP67 og hemolin signal peptider til at forbedre protein sekretion udtryk var drevet af høje udtryk udbytter af begge gener. Men hvis protein sekretion og posttranslationelle modifikation maskiner af udtryk værten er overbelastet med de udtrykte rekombinante proteiner, udskilles rekombinante proteiner har ikke tilstrækkelige ændringer, især glykosylering. Begge modificerede vektorer har været brugt med held udtrykke talrige plante sekretoriske proteiner11,12,26, hvoraf mange har tendens til at aggregat, som er sandsynligvis på grund af forkert eller utilstrækkelig glykosylering. Derfor, for udtryk for disse vanskelige proteiner, både stærke og svage signal peptid sekvenser skal afprøves og kvaliteten af de udtrykte rekombinante proteiner skal sammenlignes. Husk at et svagt signal peptid sekvens vil sænke den samlede udbytte af protein; dog kan det give sekretion maskiner af udtryk vært nok kapacitet til at behandle protein sekretion og ændringer.

Ud over udtryk for heterolog udskilles proteiner i insekt celler, har pattedyr celle og plante celle udtryk systemer været anvendt med succes i overekspression af rekombinant pattedyr og vegetabilske proteiner, henholdsvis27, 28,29. I forhold til de heterolog systemer, i nærheden af endogene udtrykket tilstand af enten pattedyr eller udskilles planteproteiner får næsten naturlig ændring machineries i værtsceller at give godt foldede proteiner. Advarsel for at bruge ordningen nær indfødte udtryk er at de udtrykt rekombinante proteiner kan forstyrre den fysiologiske funktion af de celler, som potentielt kan have negative virkninger for det endelige udtryk udbytte af proteiner.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Dette arbejde blev støttet af de nye Fakultet start midler fra North Carolina State University for Guozhou Xu.

Materials

Name Company Catalog Number Comments
Incubator shaker VWR Model Excella E25 27 oC
Incubator VWR Model 2005 27 oC
Centrifuge BECKMAN Model J-6 with a swing bucket rotor
Herculase II Fusion DNA Polymerase Agilent 600677-51 For PCR amplification of DNA
Thermal Cycler BIO-RAD Model C1000 Touch For PCR amplification of DNA
Incubator shaker New Brunswick Scientific Model I 24 For growing baceria culture
Customer DNA synthesis GENSCRIPT
BamHI (HF) New England Biolabs R3136S Restriction Endonuclease
BglII New England Biolabs R0144S Restriction Endonuclease
NotI (HF) New England Biolabs R3189S Restriction Endonuclease
XhoI New England Biolabs R0146S Restriction Endonuclease
T4 DNA ligase New England Biolabs M0202T DNA ligation
QIAquick Gel Extraction Kit Qiagen 28704 DNA purification from Agorase gel
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid DNA purification from bacteria culture
Agarose Thermo Fisher Scientific 15510-019 For DNA gel electropherosis
MAX Efficiency DH5α competen cell Invitrogen 18-258-012 For transformation of DNA ligation mixture
Lennox L LB Broth Research Product International Corp. L24066-5000.0 For making bacteria culture
Ampicillin sodium salt Thermo Fisher Scientific 11593-019 Antibiotics
Kanamycin Sulfate Thermo Fisher Scientific 15160-054 Antibiotics
Tetracycline Thermo Fisher Scientific 64-75-5 Antibiotics
Gentamicin Thermo Fisher Scientific 15710-064 Antibiotics
MAX Efficiency DH10Bac competent cells Thermo Fisher Scientific 10361-012 For making bacmid DNA
S.O.C. Medium Thermo Fisher Scientific 15544-034 For DNA transformation
CellFECTIN II Reagent Thermo Fisher Scientific 10362-101 Insect cell transfection reagent
Bac-to-Bac Expression System Thermo Fisher Scientific 10359-016 Baculovirus-insect cells expression kit
Bluo-gal Thermo Fisher Scientific 15519-028 For isolation of recominant Bacmid DNA
IPTG Thermo Fisher Scientific 15529-019 For isolation of recominant Bacmid DNA
pFastBac1 Thermo Fisher Scientific 10360014 Baculorirus expression vector
Sf9 cells Thermo Fisher Scientific 11496015 Sf9 monolayer cells
Hi5 cells Thermo Fisher Scientific B85502 High Five insect cells
Grace’s insect medium, unsupplemented Thermo Fisher Scientific 11595030 Sf9 cell transfection minimum medium
Grace’s insect medium, supplemented Thermo Fisher Scientific 11605102 Sf9 monolayer cell culture complete medium
Sf-900 II SFM Thermo Fisher Scientific 10902104 Sf9 suspension cell culture medium without FBS
Express Five SFM Thermo Fisher Scientific 10486025 Hi5 cell culture medium
Penicillin-Streptomycin Thermo Fisher Scientific 15140122 100 ml (10,000 I.U./ml)
L-Glutamine (200 mM) Thermo Fisher Scientific 25030081 100 ml
FBS Certified Thermo Fisher Scientific 16000-044 500 ml
6-well plates Thermo Fisher Scientific 08-772-1B Flat-bottom
150 mm plates Thermo Fisher Scientific 353025 100/case
1.5 ml Microcentrifuge Tubes USA Scientific 1415-2500 500 tubes/bag
15 ml conical screw cap centrifuge tubes USA Scientific 1475-0511 25 tubes/bag
50 ml conical screw cap centrifuge tubes USA Scientific 1500-1211 25 tubes/bag
Ni-NTA Superflow Qiagen 30430 NiNTA resin
pH-indicator strips EMD Millipore Corporation 1.09535.0001 pH 0 - 14

DOWNLOAD MATERIALS LIST

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317 (2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796 (2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics