Wijzigen Baculovirus expressievectoren voor de productie van plantaardige eiwitten in Insect cellen uitgescheiden

JoVE Journal
Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier presenteren we de protocollen voor het gebruik van het insect cel en baculovirus eiwit expressie systeem voor de productie van grote hoeveelheden uitgescheiden eiwithoudende gewassen voor eiwit kristallisatie. Een vector baculovirus expressie is gewijzigd met GP67 of insect hemolin signaal peptide voor plant secretie eiwituitdrukking in insect cellen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Het is een uitdaging voor de wetenschappers uitspreken recombinant secretoire eukaryotische eiwit voor structurele en biochemische studies geweest. Het insect cel baculovirus-gemedieerde expressie systeem is een van de systemen die worden gebruikt om uit te drukken van recombinante eukaryotische secretoire eiwitten met sommige posttranslationele modificaties. De secretoire eiwitten moeten worden gerouteerd via de secretoire trajecten voor eiwit glycosylatie, disulfide bindingen vorming en andere posttranslationele modificaties. Ter verbetering van de bestaande insect cel uitdrukking van secretoire plantaardige eiwitten, wordt een baculovirus expressie vector gewijzigd door de toevoeging van hetzij een GP67 of een hemolin signaal peptide sequentie tussen de promotor en klonen van meerdere sites. Dit nieuw ontworpen gemodificeerde vector-systeem met succes geproduceerd van een hoog rendement van oplosbare recombinante secreted receptor eiwithoudende gewassen van Arabidopsis thaliana. Twee van de geuite plantaardige eiwitten, de extracellulaire domeinen van Arabidopsis TDR en PRK3 plasmamembraan receptoren, werden kristalliseerde voor X-ray kristallografische studies. Het systeem gemodificeerde vector is een verbeterd gereedschap die potentieel kan worden gebruikt voor de expressie van recombinante secretoire eiwitten in het dierenrijk alsmede.

Introduction

Het is noodzakelijk voor een onderzoekslaboratorium te zijn geschikt voor het produceren van grote hoeveelheden van homogene recombinante eiwitten voor biochemische en biofysische karakteristieken, vooral voor X-ray kristallografische studies. Er zijn vele gevestigde heterologe expressiesystemen zoals Escherichia coli, gist, insect cellen, cellen van zoogdieren, plantencellen, etc. onder hen, het insect cel baculovirus-gemedieerde expressie systeem is een van de meest gebruikte technieken voor de productie van grote hoeveelheden van structureel gevouwen grote recombinante eukaryotische eiwitten voor eiwit kristallisatie1.

De expressievectoren van de baculovirus expressie systemen zijn ontworpen om te bevatten een sterke polyhedrin of P10 promotor voor de productie van een hoog rendement van recombinante intracellulaire eiwitten2,3. Het gen van belang is om een recombinant baculovirus, gekloond in een insect vector met de locus polyhedrin (polh) van het genoom van de multi-nucleopolyhedroviral Autographa californica . De resulterende construct is vervolgens sequenced en de juiste open leesraam (ORF) is geverifieerd. De juiste constructie wordt vervolgens ingevoerd in de gastheercel insecten door het proces van transfectie. Het gen van belang is ingevoegd in het virale genoom homologe recombinatie. Dit evenement resulteert in de productie van de recombinante virale genoom, die vervolgens wordt gerepliceerd naar het produceren van recombinant bloesem virus deeltjes1.

Het insect cellen die het meest worden gebruikt in de expressie systemen zijn Sf9 en hoge vijf (Hi5) cellen. Sf9 cellen zijn een klonale isolaat van Sf21, afgeleid van de pop ovariale cellen van Spodoptera frugiperda, en Hi5 cellen zijn een klonale isolaat afgeleid van de ouderlijke Trichoplusia ni ovariële cel lijn TN-3684,5. Co transfections, virus versterking en plaque tests worden uitgevoerd op Sf9 cellen, terwijl Hi5 cellen zijn meestal geselecteerd voor de productie van grotere hoeveelheden van recombinante eiwitten6. Het is vermeldenswaard dat de Hi5 cellen niet geschikt voor het genereren en versterking van virus nakomelingschap vanwege hun neiging zijn tot mutant virussen. Traditioneel, een temperatuurbereik van 25-30 ° C wordt beschouwd als goed voor de teelt van insect cellen. Er is echter gemeld dat 27-28 ° C de optimale temperatuur voor het insect cel groei en infectie7,8 is.

De invoering van een krachtig signaal reeks voorafgaand aan het gen is nodig voor de hoge expressie van de secreted eiwitten. De volgorde van het signaal zou efficiënt begeleiden de vertaalde recombinante eiwitten in het endoplasmatisch reticulum voor eiwit secretie en posttranslationele modificaties noodzakelijk voor goede vouwen en stabilisatie3. Signaal peptide reeksen, hebben zoals de baculovirus omhullen eiwit GP64/67, honingbij melittin, en anderen, uitgekozen om de uitdrukking van secretoire recombinant eiwit in de uitdrukking baculovirus-gemedieerde systemen3. De invoering van de signaal-peptide van GP67 is aangetoond dat het verbeteren van het rendement van de expressie van een secreted recombinant eiwit, in vergelijking met het gebruik van de intrinsieke signaal peptide van de doelgroep gene9. Hemolin is een Hemolymfe proteïne van de gigantische zijde vlinder Hyalophora cecropia, geïnduceerde op bacteriën infectie10. Vanwege de relatief hoge niveau van geïnduceerde expressie, kan het signaal peptide sequentie van het gen worden gebruikt om te bemiddelen de expressie van de secretie van de recombinante eiwitten in het baculovirus-insect cell systeem.

De A. thaliana Tracheary Element differentiatie remmende Factor Receptor (TDR) en stuifmeel Receptor Kinase 3 (PRK3) beide tot de familie van de herhaling Receptor-achtig Kinase (LRR-RLK) plant Leucine-rijke eiwitten11,12 behoren . Om de structuur en functie van deze familie van receptor eiwithoudende gewassen, alsmede over het vergemakkelijken van de structurele en Biochemische karakterisering van andere plantaardige uitgescheiden eiwitten te bestuderen, is het baculovirus-insect cel expressie systeem gewijzigd om te verbeteren eiwit kwaliteit en productie opbrengst. De extracellulaire domeinen van zowel de TDR en de PRK3 is met succes geuit met behulp van twee gewijzigde expressievectoren in het baculovirus-insect cel expressie systeem. Zowel de extracellulaire domeinen van TDR en PRK3 eiwitten hebben is uitgekristalliseerd. Dit artikel rapporteert de uitdrukking en de zuivering van grote hoeveelheden van recombinante secreted plantaardige eiwitten met twee gewijzigde baculovirus expressievectoren door het opnemen van een GP67 of een hemolin signaal reeks tussen de promotor en meerdere klonen sites.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Opmerking: Een insect cel/baculovirus systeem met gemodificeerde expressievectoren voor secretoire plantaardige eiwit expressie en kristallisatie wordt gebruikt.

1. wijziging van een Vector Baculovirus expressie met de GP67 signaal Peptide voor Plant eiwituitdrukking secretie

  1. Synthetiseren van een fragment van DNA een 5' BglII snijden site13, de volgorde van GP67 secretie signaal en een multi-klonen site met kennisgevingen, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI en XhoI (figuur 1A).
    Opmerking: Aangezien zowel de BglII als de BamHI verteerd DNA resulteerde in de dezelfde zelfklevende uiteinden, de gelineariseerde vector naar het verteerd DNA-fragment kunt afbinden, terwijl zowel de BglII als de BamHI sites in de reeks van de ontharde afbinding zal worden gemuteerd in een reeks die niet cleavable door BglII of BamHI14.
  2. Digest 4 µg van het DNA met BglII en XhoI, en 4 µg voor een expressie vector DNA met BamHI en XhoI14. Meng 10 eenheden van elke restrictie-enzym met het DNA in een 1 x concentratie-reactie-buffer (Kaliumacetaat 50 mM, 20 mM Tris-acetaat, 10 mM magnesium acetaat en 100 µg/mL BSA, pH 7,9 bij 25 ° C) en laat het mengsel bij 37 ° C gedurende 4 uur inwerken.
    1. Het zuiveren van de verwijderde fragment van DNA en de gelineariseerde vector DNA door een DNA gel extractie kit15.
  3. Mix 100 ng van de gelineariseerde vector DNA met 400 ng van het verteerd DNA fragment in een 10-µL afbinding reactiemengsel met 1 x T4 DNA ligase reactie buffer (50 mM Tris-HCl, 10 mM MgCl2, ATP van 1 mM en 10 mM DTT, pH 7.5 bij 25 ° C) en 5 eenheden van T4 DNA Ligase. Incubeer het reactiemengsel bij 16 ° C voor 16 h.
  4. 5 µL van het mengsel afbinding omvormen 100 µL van bevoegde cellen DH5α volgens een standaard transformatie-protocol en selecteer de resulterende kolonies op een ampicilline-LB agar plaat16. Pick up 5-10 kolonies en groeien elke kolonie in 2 mL zuiver LB opslagmedium met 100 µg/mL ampicilline bij 220 rpm en 37 ° C in een schudden incubator voor 16 h.
  5. Pak elk plasmide DNA met een DNA miniprep kit17 en het klonen bevestigen door DNA sequentiebepaling van een primer AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-versterken het A. thaliana TDR gen fragment coderen residuen 30-642 van een synthetische TDR-gen construeren (toekomen primer: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, omgekeerde primer: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Het versterken van het DNA voor 30 cycli in een polymerase van DNA reactie buffer met een 0.5 mM dNTP mix, 0,2 µM inleidingen, 0,1 µg sjabloon DNA, 0,4 mM MgCl2en 1 reactie-eenheid van de polymerase van DNA.
    1. Voor de PCR cyclus stappen, stelt u de initiële denaturatie bij 95 ° C gedurende 30 s en vervolgens 30 cycli van denaturatie bij 95 ° C gedurende 30 s, gloeien bij 55 ° C gedurende 30 s, en extensie bij 72 ° C gedurende 1 minuut, met een definitieve extensie bij 72 ° C gedurende 5 minuten.
  7. Zowel het PCR fragment en de gemodificeerde vector met kennisgevingen en BamHI beperking endonuclease enzymen verteren. Het gen-fragment met de gelineariseerde vector afbinden. Mix 100 ng van de gelineariseerde vector DNA met 400 ng van het verteerd DNA fragment in een 10-µL afbinding reactiemengsel met T4 DNA ligase reactie buffer en 5 eenheden van T4 DNA ligase. Incubeer het reactiemengsel bij 16 ° C voor 16 h.
  8. 5 µL van het mengsel afbinding omvormen 100 µL van bevoegde cellen DH5α volgens een standaard transformatie-protocol en selecteer de resulterende kolonies op een ampicilline-LB agar plaat16. Bevestig de juiste klonen door DNA sequencing.

2. wijziging van een Vector Baculovirus expressie met de insecten Hemolin signaal Peptide voor Plant eiwituitdrukking secretie

  1. Synthetiseren van een fragment van DNA een 5' BglII snijden site13, de volgorde van insecten hemolin secretie signaal en een multi-klonen site met kennisgevingen, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI en XhoI (figuur 1B).
  2. Digest 4 µg van het DNA met BglII en XhoI, en 4 µg voor een expressie vector DNA met BamHI en XhoI14. Meng 10 eenheden van elke restrictie-enzym met het DNA in een 1 x concentratie-reactie-buffer (Kaliumacetaat 50 mM, 20 mM Tris-acetaat, 10 mM magnesium acetaat en 100 µg/mL BSA, pH 7,9 bij 25 ° C) en laat het mengsel bij 37 ° C gedurende 4 uur inwerken.
    1. Het zuiveren van de verwijderde fragment van DNA en de gelineariseerde vector DNA door een DNA gel extractie kit15.
  3. Mix 100 ng van de gelineariseerde vector DNA met 400 ng van het verteerd DNA fragment in een 10-µL afbinding reactiemengsel met 1 x T4 DNA ligase reactie buffer (50 mM Tris-HCl, 10 mM MgCl2, ATP van 1 mM en 10 mM DTT, pH 7.5 bij 25 ° C) en 5 eenheden van T4 DNA Ligase. Incubeer het reactiemengsel bij 16 ° C voor 16 h.
  4. 5 µL van het mengsel afbinding omvormen 100 µL DH5α bevoegde cellen en selecteer de kolonies op een ampicilline-LB agarplaat. Pick up 5-10 kolonies en groeien elke kolonie in een 2-mL LB medium waarin 100 µg/mL ampicilline bij 220 rpm en 37 ° C in een schudden incubator voor 16 h.
  5. Plasmide DNA met een DNA miniprep kit17 pak en het klonen bevestigen door DNA sequentiebepaling van een primer AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-versterken A. thaliana stuifmeel Receptor Kinase 3 (PRK3) gen fragment codering residuen 20-237 van een synthetische PRK3 gene construct (toekomen primer: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, omgekeerde primer: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Het versterken van het DNA voor 30 cycli in een polymerase van DNA reactie buffer met een 0.5 mM dNTP mix, 0,2 µM inleidingen, 0,1 µg sjabloon DNA, 0,4 mM MgCl2en 1 reactie-eenheid van de polymerase van DNA.
    1. Voor de PCR cyclus stappen, stelt u de initiële denaturatie bij 95 ° C gedurende 30 s en vervolgens 30 cycli van denaturatie bij 95 ° C gedurende 30 s, gloeien bij 55 ° C gedurende 30 s, en uitbreiding bij 72 ° C gedurende 30 s binnen elke cyclus, en de laatste uitbreiding bij 72 ° C gedurende 5 minuten.
  7. Zowel het PCR fragment en de gemodificeerde vector met kennisgevingen en BamHI beperking endonuclease enzymen verteren. Het gen-fragment met de gelineariseerde vector afbinden. Mix 100 ng van de gelineariseerde vector DNA met 400 ng van het verteerd DNA fragment in een 10-µL afbinding reactiemengsel met T4 DNA ligase reactie buffer en 5 eenheden van T4 DNA ligase. Incubeer het reactiemengsel bij 16 ° C voor 16 h.
  8. 5 µL van het mengsel afbinding omvormen 100 µL van bevoegde cellen DH5α volgens een standaard transformatie-protocol en selecteer de resulterende kolonies op een ampicilline-LB agar plaat16. Bevestig de juiste klonen door DNA sequencing.

3. productie en versterking van Baculovirus construeert herbergen de Recombinant eiwit expressie Cassette

  1. Gebruik 100 ng van de plasmide construct te transformeren 40 µL van bevoegde cellen DH10Bac volgens het protocol van de baculovirus expressie systeem1. Incubeer de platen van de transformatie bij 37 ° C gedurende 48 uur.
  2. Pick-up met twee witte kolonies van elke plaat transformatie, Inoculeer elke kolonie in 2 mL van LB medium met 50 µg Mo/mL kanamycine, 7 µg/mL gentamicine en 10 µg Fe/mL tetracycline. Volg het protocol van de baculovirus expressie systeem1 uitpakken en controleren van de bacmid van DNA. Aliquot elke DNA in twee buizen met 20 µL per stuk, en op te slaan van de buizen bij-20 ° C.
    Opmerking: De volgende stappen moet een aseptische bewerking.
  3. Groeien een monolayer van Sf9 cellen in de voedingsbodems met 10% foetale runderserum (FBS) en 100 µg/mL (of 100 I.U./mL) penicilline-streptomycine antibiotica bij 27 ° C tot 80% samenkomst in een 6-well-plate. Schatting van het percentage voor confluence gebaseerd op het percentage van de overdekte ruimte op de plaat weefselkweek.
  4. Voorbereiding van de volgende oplossingen in twee steriele 1.5-mL centrifuge buizen.
    1. Buis 1: Voor elke transfectie, Verdun 20 µL van bacmid DNA in 100 µL unsupplemented Sf9 cel kweekmedium zonder antibiotica. Meng voorzichtig de verdunning door flicking de kant van de buis.
    2. Buis 2: Voor elke transfectie, Verdun 8 µL van lipide transfectiereagens in 100 µL unsupplemented Sf9 cel kweekmedium zonder antibiotica. Meng de verdunning door pipetteren op en neer voor 6 x.
  5. Combineren van de twee oplossingen, meng ze zachtjes door pipetteren langzaam op en neer voor 3 x en laat ze 20-40 min bij kamertemperatuur inwerken.
  6. Wassen elk putje van de Sf9 enkelgelaagde cellen 2 x met 3 mL unsupplemented Sf9 cel kweekmedium zonder antibiotica. Voeg voor elke transfectie, 0.8 mL unsupplemented Sf9 cel kweekmedium zonder antibiotica aan elke buis met het mengsel van lipide-DNA. Meng de inhoud van de buizen voorzichtig door pipetteren langzaam op en neer voor 3 x. De media van het wassen van de platen gecombineerd en overlay van de monsters met de transfectie mengsel.
  7. Na de toevoeging van de transfectie mengsel, Incubeer de transfected plaat voor 5 uur bij 27 ° C. De transfectie media vervangen het volledige Sf9 cel kweekmedium dat 10% FBS en 100 µg/mL (of 100 I.U./mL) penicilline-streptomycine antibiotica. Incubeer de transfected plaat bij 27 ° C gedurende 4 d.
  8. Oogst en de recombinante baculovirus versterken.
    1. Verzamelen het supernatant van de besmette plaat in een steriele 15 mL conische buis na 4 d van incubatie. Draai het supernatant bij 1010 x g gedurende 5 min voor het verwijderen van het puin van de cel. Negeren van de pellet en decanteren van de bovendrijvende substantie aan een schone buis en sla het bij 4 ° C voor maximaal 1 jaar.
      Opmerking: Dit is het virus P0. Het kan worden aliquoted en opgeslagen bij-80 ° C voor een langere periode van tijd.
    2. Om te vullen elk recombinante virus, groeien een monolayer van Sf9 cellen op een 150-mm plaat tot 80% samenkomst. Gecombineerd van de media van de plaat, voeg toe 2 mL van het virus P0 aan de aanhanger van de cellen aan de plaat en de plaat gedurende 1 uur in een incubator 27 ° C incuberen. Rock de plaat elke 15 min mixen van het medium met de cellen.
      1. Voeg 25 mL volledige Grace media met 10% FBS en 100 µg/mL (of 100 I.U./mL) penicilline-streptomycine antibiotica. Incubeer de plaat voor 3 d in een 27 ° C incubator te verkrijgen van de P1 passage virus.
    3. Het verzamelen van het supernatans van de besmette plaat in een steriele 50 mL conische buis en de spin bij 1010 x g gedurende 5 min voor het verwijderen van het puin van de cel. Giet het supernatant aan een schone buis en sla het bij 4 ° C voor maximaal 1 jaar.
      Opmerking: De P1-virus kan worden aliquoted en opgeslagen bij-80 ° C voor een langere periode van tijd.
    4. Om te versterken het virus van P1 naar P2 passage, groeien een monolayer van Sf9 cellen op een 150-mm plaat tot 90% samenkomst, gecombineerd van de media van de plaat, voeg toe 2 mL van het virus van de P1 aan de plaat en het Incubeer gedurende 1 uur in een 27 ° C incubator.
    5. Herhaal stap 3.8.2 en 3.8.3 te verkrijgen van de P2 en P3 passages van de virussen. Bewaar de P3-virus niet voor meer dan 2 maanden.

4. eiwit expressie, zuivering met NiNTA en kristallisatie

  1. Cultuur 1 L van Hi5 insect cellen in de voedingsbodems met 100 µg/mL (of 100 I.U./mL) penicilline-streptomycine antibiotica met een dichtheid van 2 x 10,6 op 100 rpm in een 27 ° C incubator shaker. Spin down de cellen bij 570 x g gedurende 5 min, giet het supernatant resuspendeer de cellen in 20 mL van het vers geproduceerde P3-virus en houd het bij kamertemperatuur voor 1 h. voorzichtig schudden de spin fles resuspendeer de cellen 1 x elke 15 min.
  2. De cellen omzetten in 1 L van voedingsbodems met 100 µg/mL (of 100 I.U./mL) penicilline-streptomycine antibiotica, cultuur van de cellen op 100 rpm in een shaker 27 ° C incubator voor 72 h. Spin down de cellen bij 1,010 x g gedurende 5 min en het supernatant verzamelen.
  3. PH-indicator voor stroken aan de pH van het supernatans dat tot 8,0 aanpassen door het toevoegen van 0,1 M HCl of 0,1 M NaOH en bindende buffer op een eindconcentratie, met 20 mM Tris buffer met een pH van 8.0, 100 mM NaCl, en 5 mM imidazol toevoegen. Voeg een bepaalde hoeveelheid NiNTA hars (10-40 mL) op basis van de geschatte opbrengst van het uitgedrukt zijn-gelabeld recombinant eiwit.
    1. Meng de oplossing op een magnetische roer met lage snelheid bij 4 ° C gedurende 1 h. Wash de hars en elueer de afhankelijke eiwitten na de standaard NiNTA zuivering protocol18.
  4. De gezuiverde proteïne onverminderd ionenwisseling en gel filtratie chromatografie, evenals andere eiwit zuivering methoden, om de opbrengst van een homogeen monster.
    Opmerking: Voor de TDR-ectodomain, 20 mM Tris, pH 8, 100 mM NaCl werden gebruikt als gel filtratie buffer. Voor de PRK3 ectodomain, 20 mM BIB-Tris, pH 6, 100 mM NaCl werden gebruikt als de voorkeurs gel filtratie buffer.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Zoals aangegeven in Figuur 1, werden twee gewijzigde pFastBac1 baculovirus expressievectoren gebruikt om uit te drukken de secreted eiwitten met de GP67 of de hemolin signaal volgorde ter vervanging van de intrinsieke signaal sequentie van de target-gen. De virale GP67 en de insecten hemolin genen hebben aangetoond dat hoge secretie expressie niveaus in de cellen. Fusion eiwitten met een van deze twee reeksen van het signaal wordt verwacht dat de secretie expressie niveaus sterk verbeterd. Identieke die meerdere klonen sites (MCS) zijn ontworpen in deze twee gewijzigde vectoren. Een site van de kennisgevingen was opzettelijk heeft geplaatst op de meest 5'-kant van de MCS, omdat kennisgevingen een acht-nucleotide sequentie in plaats van de meest voorkomende zes-nucleotide sequentie in vele andere beperkingsplaatsen aanwezig heeft. Als zodanig is een kennisgevingen site minder aanwezig in de doelgenen dan de meeste andere sites van beperking, waardoor beperkingsspijsvertering en het klonen van de meeste doelgenen meer haalbaar in vergelijking met het gebruik van andere beperkingsplaatsen. Het doel-gen tussen de kennisgevingen en een stroomafwaartse beperkingsplaats klonen zal slechts drie aminozuurresidu's, GGR, voorafgaand aan het target-gen introduceren.

De pBac1-GP67 en pBac1-Hem hebben met succes gebruikt om uit te drukken de extracellulaire domeinen van de A. thaliana receptoren TDR en PRK3, respectievelijk (Figuur 2). Nadat de recombinante eiwitten werden gezuiverd door NiNTA met behulp van een engineering C-terminal 6-histidine tag, wordt de gemiddelde eiwit opbrengst strookte rond 20 mg/L Hi5 cellen. De zuiverheid van elke proteïne is dicht bij of hoger dan 50%, onderzocht met SDS-pagina en Coomassie kleuring.

De recombinante eiwitten van de extracellulaire domeinen van TDR en PRK3 werden verder gezuiverd door grootte uitsluiting chromatografie (Figuur 2). De gezuiverde proteïne was geconcentreerd op 5 mg/mL en vervolgens onderworpen aan een screening kristallisatie. De voorwaarden die voorontwerp kristallen van elke proteïne leverde, werden geoptimaliseerd totdat eiwit kristallen met een maat groter dan 20 µm werden waargenomen (Figuur 3). De kristalstructuren van beide eiwitten zijn gerapporteerde11,12.

Figure 1
Figuur 1: kaarten van de vectoren van de gewijzigde pFastBac1. De DNA-sequenties weergegeven in deze panelen werden ingevoegd stroomafwaarts van de promotor van de polyhedrin van het pFastBac1 vector, te beschikken over de volgorde van de peptide signaal en de meerdere klonen sites (MCS) voor doelgenen. Beide vectoren bevatten de dezelfde MCS. (A) dit paneel toont een reeks van de klonen sites stroomafwaarts van de promotor van de polyhedrin in de pBac1-GP67-vector. De vertaalde GP67 signaal peptide aminozuur volgorde is gekleurd in rood. Elke unieke beperkingsplaats in de MCS is onderstreept, met de naam van de site met het label boven. (B) dit paneel toont een reeks van de klonen sites stroomafwaarts van de promotor van de polyhedrin in de pBac1-zoom vector. De vertaalde hemolin signaal peptide aminozuur volgorde is gekleurd in rood. Elke unieke beperkingsplaats in de MCS is onderstreept, met de naam van de site met het label boven. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: eiwit expressie met de gewijzigde pFastBac1 vectoren in de baculovirus-insect cell systeem. (A) de ectodomain van TDR was uitgedrukt in insect cellen Hi5, gezuiverd door nikkel-affiniteit en grootte uitsluiting chromatografie (S), en opgelost op SDS-pagina gel. De nikkel-hars was een keer gewassen met een buffer met 5 mM imidazool (wash 1), en een tweede keer met 20 mM imidazool (wash 2). (B) Dit is een analyse van de SDS-pagina weergegeven: de expressie en nikkel affiniteit reiniging (NiNTA), evenals de grootte uitsluiting chromatografie van de PRK3 ectodomain. Molecuulgewicht (MW) markeringen met de bijbehorende maten worden aangeduid. De rode pijlen in elk deelvenster duiden de expressies en de verwachte omvang van de recombinant TDR PRK3 ectodomain eiwitten. De multi-band aarden van de geuite eiwitten zijn waarschijnlijk te wijten aan heterogene glycosylatie. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: Eiwit kristallen van de extracellulaire domeinen van Arabidopsis thaliana TDR en PRK3. (A) dit paneel toont de kristallen van de eiwitten van de extracellulaire domeinen van A. thaliana TDR. (B) dit paneel toont de kristallen van de eiwitten van de extracellulaire domeinen van A. thaliana PRK3. Een schaal bar is elke afbeelding hieronder. Klik hier voor een grotere versie van dit cijfer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Gezien de diversiteit in grootte en stabiliteit van de duizenden eiwitten aanwezig in de biologische systemen, is het vaak empirische voor een onderzoek laboratorium om te beslissen welk heterologe expressie systeem moet worden gekozen voor de uitdrukking van een specifieke proteïne. Het systeem van E. coli expressie is vaak de eerste keuze voor eiwit expressie als gevolg van de korte levenscyclus van de bacteriën, lage kosten van de voedingsbodems, en het relatieve gemak aan schaal omhoog19. Voor de expressie van grote eukaryotische eiwitten met de maten van meer dan 60 kDa, echter met behulp van de E. coli resulteert systeem vaak in onoplosbare eiwitten in het lichaam van de opname of aggregatie20. Voor de uitdrukking van die moeilijke proteïnen, en voor andere secreted eiwitten, is het systeem van de expressie baculovirus-insect cel mogelijk voordeliger dan de E-coli. Vooral wanneer uiten secreted eukaryotische eiwitten, zou dit gewijzigde baculovirus-insect cel expressie systeem een voorkeur.

Vele secreted eukaryotische eiwitten, met inbegrip van plantaardige uitgescheiden eiwitten, nodig complexe glycosylatie bisulfide vorming en andere posttranslationele modificaties tijdens eiwit vouwen en secretie21. E. coli systemen hebben niet de cellulaire machines voor het verwerken van de complexe wijzigingen die nodig zijn voor veel van de eukaryote eiwitten22. Gist is een relatief meer geavanceerde glycosylatie systeem dan E. coli23. Voor de expressie van de secreted eiwitten in hogere eukaryotische soorten en planten kampt de baculovirus-insect cell systeem echter een aanzienlijk voordeel. Aangezien glycosylatie vouwing van eiwitten beïnvloedt en stabiliteit24, veel van de secreted recombinante eiwitten uitgedrukt in de E. coli en gist systemen hebben een lage rendement en de neiging om statistische, vermoedelijk als gevolg van onjuiste eiwitvouwing. Het systeem baculovirus-insect is gewijzigd ter verbetering van eiwit glycosylatie, waardoor het een ideaal systeem voor de expressie van secreted eukaryotische eiwitten25. In deze studie signaal zowel de GP67 als de hemolin peptiden zijn met succes gebruikt om het begeleiden van de expressie van de secretie van twee eiwithoudende gewassen receptor voor eiwit kristallisatie. Met deze studies in gedachten is de keuze van beide signaal peptide echter een kritieke stap, en het moet meer systematische, vergelijkende studies met een reeks doelgenen van verschillende organismen.

Het idee van het gebruik van zowel GP67 als hemolin signaal peptiden ter verbetering van de secretie eiwituitdrukking werd gedreven door de hoge expressie opbrengsten van beide genen. Als de afscheiding van eiwitten en posttranslationele wijziging machines van de expressie host zijn overladen met de geuite recombinante eiwitten, kunnen de secreted recombinante eiwitten echter niet hebben voldoende wijzigingen, met name glycosylatie. Beide gemodificeerde vectoren zijn gebruikt om uit te drukken met succes talrijke plant secretoire eiwitten11,12,26, velen van die neiging om aggregaat, die waarschijnlijk als gevolg van de onjuiste of ontoereikende glycosylatie. Daarom, voor de uitdrukking van die moeilijke proteïnen, beide sterke en zwakke signaal peptide reeksen moeten worden getest en de kwaliteit van de geuite recombinante eiwitten moet worden vergeleken. Houd er rekening mee dat een zwak signaal peptide reeks de totale opbrengst van het eiwit verlaagt; maar kan het geven de machinerie van de secretie van de expressie host voldoende capaciteit om het eiwit secretie en wijzigingen te verwerken.

Naast de uitdrukking van heterologe secreted eiwitten in insect cellen, de zoogdiercellen en de plant cel expressiesystemen hebben met succes gebruikt in de overexpressie van recombinant zoogdieren en plantaardige eiwitten, respectievelijk27, 28,29. In vergelijking met het heterologe systemen, de in de omgeving van endogene expressie voorwaarde van de zoogdieren of de plant uitgescheiden eiwitten krijgen de machineries bijna inheemse wijziging in de cellen van de gastheer goed gevouwen eiwitten opleveren. De waarschuwing van het gebruik van het systeem in de buurt van-native expressie is dat de geuite recombinante eiwitten kunnen interfereren met de fysiologische functie van de cellen, die potentieel schadelijke effecten op de opbrengst van de definitieve uitdrukking van de eiwitten wellicht.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Dit werk werd gesteund door de nieuwe faculteit opstarten fondsen van de North Carolina State University voor Guozhou Xu.

Materials

Name Company Catalog Number Comments
Incubator shaker VWR Model Excella E25 27 oC
Incubator VWR Model 2005 27 oC
Centrifuge BECKMAN Model J-6 with a swing bucket rotor
Herculase II Fusion DNA Polymerase Agilent 600677-51 For PCR amplification of DNA
Thermal Cycler BIO-RAD Model C1000 Touch For PCR amplification of DNA
Incubator shaker New Brunswick Scientific Model I 24 For growing baceria culture
Customer DNA synthesis GENSCRIPT
BamHI (HF) New England Biolabs R3136S Restriction Endonuclease
BglII New England Biolabs R0144S Restriction Endonuclease
NotI (HF) New England Biolabs R3189S Restriction Endonuclease
XhoI New England Biolabs R0146S Restriction Endonuclease
T4 DNA ligase New England Biolabs M0202T DNA ligation
QIAquick Gel Extraction Kit Qiagen 28704 DNA purification from Agorase gel
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid DNA purification from bacteria culture
Agarose Thermo Fisher Scientific 15510-019 For DNA gel electropherosis
MAX Efficiency DH5α competen cell Invitrogen 18-258-012 For transformation of DNA ligation mixture
Lennox L LB Broth Research Product International Corp. L24066-5000.0 For making bacteria culture
Ampicillin sodium salt Thermo Fisher Scientific 11593-019 Antibiotics
Kanamycin Sulfate Thermo Fisher Scientific 15160-054 Antibiotics
Tetracycline Thermo Fisher Scientific 64-75-5 Antibiotics
Gentamicin Thermo Fisher Scientific 15710-064 Antibiotics
MAX Efficiency DH10Bac competent cells Thermo Fisher Scientific 10361-012 For making bacmid DNA
S.O.C. Medium Thermo Fisher Scientific 15544-034 For DNA transformation
CellFECTIN II Reagent Thermo Fisher Scientific 10362-101 Insect cell transfection reagent
Bac-to-Bac Expression System Thermo Fisher Scientific 10359-016 Baculovirus-insect cells expression kit
Bluo-gal Thermo Fisher Scientific 15519-028 For isolation of recominant Bacmid DNA
IPTG Thermo Fisher Scientific 15529-019 For isolation of recominant Bacmid DNA
pFastBac1 Thermo Fisher Scientific 10360014 Baculorirus expression vector
Sf9 cells Thermo Fisher Scientific 11496015 Sf9 monolayer cells
Hi5 cells Thermo Fisher Scientific B85502 High Five insect cells
Grace’s insect medium, unsupplemented Thermo Fisher Scientific 11595030 Sf9 cell transfection minimum medium
Grace’s insect medium, supplemented Thermo Fisher Scientific 11605102 Sf9 monolayer cell culture complete medium
Sf-900 II SFM Thermo Fisher Scientific 10902104 Sf9 suspension cell culture medium without FBS
Express Five SFM Thermo Fisher Scientific 10486025 Hi5 cell culture medium
Penicillin-Streptomycin Thermo Fisher Scientific 15140122 100 ml (10,000 I.U./ml)
L-Glutamine (200 mM) Thermo Fisher Scientific 25030081 100 ml
FBS Certified Thermo Fisher Scientific 16000-044 500 ml
6-well plates Thermo Fisher Scientific 08-772-1B Flat-bottom
150 mm plates Thermo Fisher Scientific 353025 100/case
1.5 ml Microcentrifuge Tubes USA Scientific 1415-2500 500 tubes/bag
15 ml conical screw cap centrifuge tubes USA Scientific 1475-0511 25 tubes/bag
50 ml conical screw cap centrifuge tubes USA Scientific 1500-1211 25 tubes/bag
Ni-NTA Superflow Qiagen 30430 NiNTA resin
pH-indicator strips EMD Millipore Corporation 1.09535.0001 pH 0 - 14

DOWNLOAD MATERIALS LIST

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317 (2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796 (2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics