Kristalstructuur van de N-terminale domein van Ryanodine Receptor vanaf Plutella xylostella

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

In dit artikel beschrijven we de protocollen van eiwit expressie, zuivering, kristallisatie en structuur vastberadenheid van het domein van de N-terminal van de ryanodine receptor van de koolmot (Plutella xylostella).

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ontwikkeling van krachtige en efficiënte insecticiden gericht op insecten ryanodine receptoren (RyRs) is van groot belang op het gebied van landbouw ongediertebestrijding. Tot op heden verschillende diamide insecticiden gericht op pest die ryrs hebben op de markt zijn gebracht, die genereren jaarlijkse inkomsten van 2 miljard VS‑dollar. Maar begrip van het werkingsmechanisme van RyR-targeting insecticiden is beperkt door het gebrek aan structurele informatie met betrekking tot insect RyR. Dit beperkt op zijn beurt inzicht in de ontwikkeling van insecticide resistentie in ongedierte. De koolmot (DBM) is een vernietigende plaag vernietigen kruisbloemige gewassen wereldwijd, die is ook gemeld om te laten zien van de weerstand tegen diamide insecticiden. Het is daarom van groot praktisch belang om roman insecticiden gericht op de DBM RyR, vooral gericht op een regio verschilt van de traditionele diamide bindende site. Hier presenteren we een protocol structureel karakteriseren het N-terminaal gebied van RyR van DBM. De kristalstructuur x-ray werd opgelost door moleculaire vervanging bij een resolutie van 2,84 Å, die toont een bèta-klaverblad opvouwbare motief en een begeleidende alpha-helix. Dit protocol kan worden aangepast voor de expressie, zuivering en structurele karakterisering van andere domeinen of eiwitten in het algemeen.

Introduction

Ryanodine receptoren (RyRs) zijn specifieke ionenkanalen, die de permeatie van Ca2 + ionen in de membranen van sarcoplasmic reticulum (SR) in spiercellen bemiddelen. Daarom spelen ze een belangrijke rol in de excitatie-contractie koppeling proces. In zijn functionele vorm, assembleert RyR als een homo-tetrameer met een molecuulmassa van > 2 MDa, met elke subeenheid bestaande uit ~ 5000 aminozuurresidu's. Bij zoogdieren, er zijn drie isoforms: skeletspieren type RyR1 -, RyR2 - type van de hartspier en RyR3-overal uitgedrukt in verschillende weefsels en1.

Bij insecten is er slechts één soort RyR, die wordt uitgedrukt in spier- en zenuwstelsel weefsel2. Insect RyR is meer vergelijkbaar met zoogdieren RyR2 met de identiteit van een reeks van ongeveer 47%3. Diamide insecticiden gericht op RyR van Lepidoptera en kevers zijn ontwikkeld en verkocht door grote bedrijven zoals Bayer (flubendiamide), DuPont (chlorantraniliprole) en Syngenta (cyantraniliprole). Sinds de relatief recente lancering, diamide insecticiden uitgegroeid tot een van de snelst groeiende klasse van insecticiden. Op dit moment hebben de verkoop van deze drie insecticiden jaarlijks 2 miljard Amerikaanse dollars met een groeitempo op jaarbasis van meer dan 50% overschreden sinds 2009 (Agranova).

Recente studies hebben melding gemaakt van resistentie bij insecten na een paar generaties van gebruik van deze insecticiden4,5,6,7,8. De weerstand mutaties in de transmembrane domein van RyRs vanaf Plutella xylostella (G4946E, I4790M), de koolmot (DBM) en de overeenkomende posities in tomaat trechtervallen, Tuta absoluta (G4903E, I4746M) blijkt dat de regio zou kunnen zijn die betrokken zijn bij diamide insecticide bindend, aangezien deze regio is bekend om zijn cruciaal voor het gating van het kanaal4,8,9. Ondanks uitgebreid onderzoek op dit gebied blijven de exacte moleculaire mechanismen van diamide insecticiden elusive. Bovendien is het onduidelijk of de weerstand mutaties van invloed zijn op de interacties met diamides direct of allosterically.

Eerdere studies hebben melding gemaakt van de structuur van verschillende RyR domeinen van soorten zoogdieren en de structuur van full-length zoogdieren RyR1 en RyR2 door middel van röntgendiffractie en cryo-elektronenmicroscopie, respectievelijk10,11, 12,13,14,15,16,17,18,19,20,21 . Maar tot nu toe geen structuur van insect RyR heeft gemeld, dat verbiedt ons begrip van de moleculaire fijne kneepjes van de receptor functie en de moleculaire mechanismen van insecticide actie en ontwikkeling van insecticide-resistentie.

In dit manuscript presenteren wij een veralgemeende protocol voor de structurele karakterisering van N-terminale β-klaverblad domein van ryanodine receptor van de koolmot, een vernietigende plaag kruisbloemige gewassen wereldwijd22infecteren. De constructie is ontworpen volgens de gepubliceerde konijn RyR1 NTD crystal structuren23,24en de cryo-EM structurele modellen16,17,18,19, 20 , 21. Dit is de eerste met een hoge resolutie structuur gerapporteerd voor insect RyR, die onthult het mechanisme voor het kanaal gating en een belangrijke sjabloon voorziet in de ontwikkeling van soortspecifieke insecticiden gebruik structuur gebaseerde drug design. Voor de opheldering van de structuur werkzaam wij middel van röntgendiffractie, die wordt beschouwd als de 'gouden standaard' voor eiwit structuurbepaling bij in de buurt van atomaire resolutie. Hoewel de kristallisatie proces onvoorspelbaar en arbeidsintensief is, helpt dit stapsgewijze protocol onderzoekers express, zuiveren en karakteriseren van andere domeinen van insect RyR of elke andere eiwitten in het algemeen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. gen klonen, eiwit expressie en zuivering

  1. PCR vergroot DNA overeenkomt met proteïne van belang (residuen 1-205 van DBM RyR, Genbank acc. Neen. AFW97408) en kloon in huisdier-28a-HMT vector door afbinding-onafhankelijke klonen (LIC)25. Deze vector bevat een tag histidine, MBP tag en een TEV protease breukzijde op de N-terminus15.
    1. NEDWEB / inleidingen voor versterking van doel gen met LIC-compatibele 5' extensies te ontwerpen:
      Voorwaartse LIC primer:
      5' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3'
      Omgekeerde LIC primer:
      5' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3'
    2. Combineren van de reactie onderdelen (50 μl): 1 μL van DNA sjablonen (100 ng/μl), 1 μL van voorwaartse primer (10 μM), 1 μL van omgekeerde primer (10 μM), 0,5 μL van de polymerase van DNA (NEB), 5 μl van 10 x reactie buffer, 1 μL van dNTP (25 mM) , 40.5 μL van RNase gratis ddH2O.
      1. Plaats het reactiemengsel in een PCR-machine en voer het volgende programma.
      2. Incubeer bij 95 ° C gedurende 3 minuten en voer 30 cycli van (95 ° C gedurende 30 s, 58 ° C gedurende 15 s, 72 ° C gedurende 1 min). Incubeer bij 72 ° C gedurende 5 minuten en houd vervolgens bij 4 ° C.
      3. De hele reactie mix (50 μl) worden uitgevoerd op een 2% agarose gel en haal met een Gel extractie Kit. Volg protocol van de fabrikant.
    3. Afbinding-onafhankelijke klonen (LIC)
      1. Uitvoeren van SspI spijsvertering (60 l): 20 μL van vector DNA (50 ng/l), 6 μL van 10 x 30 μL van ddH2O. Incubate bij 37 ° C gedurende 3 h. lopen de hele reactie reactie buffer en 4 μL van SspI mix op 1% agarose gel en uitpakken met een Gel extractie Kit. Volg protocol van de fabrikant.
      2. Uitvoeren van de Polymerase van DNA van T4 behandeling van de vector en invoegen van DNA. Combineren van het volgende: 5 μL van vector- of invoegen DNA (50 ng/l), 2 μL van 10 x T4 Polymerase van DNA Buffer, 1 μL van dGTP (25 mM) voor vector- of 1 μL van dCTP (25 mM) voor invoegen DNA, 1 μL van DTT (100 mM), 0.4 μL van T4 Polymerase van DNA (LIC-gekwalificeerd) , en 9.6 μL van ddH2O. Incubate reacties bij kamertemperatuur voor 40 min. inactivering van warmte enzym bij 75 ° C gedurende 20 min.
        Opmerking: De LIC vector en steek DNA moeten worden behandeld in aparte reacties.
      3. De LIC gloeien reactie uit te voeren. Combineren van het volgende: 2 μL van T4-behandelde invoegen DNA, 2 μL van T4-behandelde LIC vector DNA. Incubeer reactie bij kamertemperatuur gedurende 10 minuten.
  2. Transformeren van BL21 (DE3) E. coli cellen met deze recombinante plasmide.
    1. Ontdooi bevoegde cellen (50 μl in micro-centrifuge buis) op het ijs.
    2. Voeg ongeveer 1 l (50 ng) van plasmide in de buis. Meng de cellen en het DNA door zachtjes flicking de buis 2 tot 3 keer. Plaats de buis op ijs gedurende 20 minuten.
    3. Warmte schok bij 42 ° C voor 40 s. plaats de buis op ijs weer voor 2 min. Add 1 mL kamertemperatuur LB media aan de buis.
    4. Plaats de buis van het mengsel in de 250 rpm shaker bij 37 ° C gedurende 45 minuten verspreid 150-200 µL van het mengsel op de platen van de selectie. De plaat omkeren en na een nacht bebroeden bij 37 ° C.
  3. Kies een één kolonie en cultuur de cellen in 100 mL 2YT medium met 50 µg Mo/mL kanamycine bij 37 ° C's nachts. Volgende ochtend beënten 1 L 2YT medium met 50 µg Mo/mL kanamycine met 10 mL overnachting cultuur en incubeer in 37 ° C shaker incubator bij 250 omwentelingen per minuut, totdat de OD600 ~ 0.6 bereikt. Daarna de cultuur met IPTG om een eindconcentratie van 0,4 mM induceren en groeien voor een andere 5 h bij 30 ° C.
  4. Oogsten van de cellen door centrifugeren bij 8.000 x g gedurende 10 minuten bij 4 ° C, de cellen verzamelen en resuspendeer de cellen van elke 10 g in 40 mL lysis-buffermengsel (10 mM HEPES pH 7.4, 250 mM KCl, 10 mM β-mercaptoethanol, 25 μg/mL lysozym, 25 μg/mL DNase 1 mM PMSF).
    1. Verstoren met het ultrasoonapparaat bij 65% amplitude gedurende 8 minuten met 1 s op en 1 s af. Verwijderen van het puin van de cel door centrifugeren bij 40.000 x g gedurende 30 minuten bij 4 ° C. De bovendrijvende vloeistof filteren door het passeren van 0,22 μm filter en het laden in de lus van de steekproef.
  5. Zuiveren van de fusieproteïne, klieven van de tag en opnieuw zuiveren het doel-eiwit.
    1. Zuiveren van de fusieproteïne met Ni-NTA kolom (bindende buffer: 10 mM HEPES pH 7.4, 250 mM KCl; elutie buffer: 10 mM HEPES pH 7.4, 250 mM KCl, 500 mM imidazol) en te zuiveren door een zuiveringsinstallatie, met een lineair verloop van 20 – 250 mM imidazool.
    2. Klieven van de proteïne geëlueerd doel met TEV protease (1:50 verhouding) overnachting bij 4 ° C.
    3. Het reactiemengsel decollete zuiveren met behulp van amylose hars kolom (bindende buffer: 10 mM HEPES pH 7.4, 250 mM KCl; elutie buffer: 10 mM HEPES pH 7.4, 250 mM KCl, 10 mM maltose) en Ni-NTA kolom om de label en de TEV protease te verwijderen. De doel-proteïne zal worden in de Fractie doorstroming van deze twee kolommen.
    4. Dialyze van het monster tegen dialyse buffer (10 mM Tris-HCl pH 8,8, van 50 mM KCl, 10 mM β-mercaptoethanol om de zoutconcentratie. Zuiveren van het monster op een wisselingskolom anion (bindende buffer: 10 mM Tris-HCl pH 8,8, 10 mM β-mercaptoethanol; elutie buffer: 10 mM Tris-HCl pH 8,8, 1 M KCl, 10 mM β-mercaptoethanol) door een lineair verloop van 20-500 mM KCl in de buffer elutie.
    5. Als laatste stap in het zuiveringsproces, concentreer je het eiwit met centrifugaal concentrator (10 kDa MWCO) en injecteren in een Superdex 200 26/600 gel-filtratie kolom om te controleren de homogeniteit.
  6. Het onderzoeken van de zuiverheid van het eiwit door het runnen van het op een 15% SDS pagina.
    Opmerking: Alle kolommen worden uitgevoerd op een eiwit zuivering systeem met een debiet van de binding van 2 mL/min, en een stroomsnelheid van de elutie van 4 mL/min met uitzondering van de gel-filtratie op 1 mL/min.

2. eiwitten voorbereiding en kristallisatie

  1. Het concentreren van het monster, gezuiverde eiwit tot 10 mg/mL met behulp van centrifugaal concentrator (10 kDa MWCO) en buffer uitwisseling aan kristallisatie buffer voordat u ze opslaat bij-80 ° C.
  2. Kristallisatie screening uitvoeren (1:1 verhouding, 200 nL van eiwit en 200 nL voor reservoir buffer) door de vergadering drop damp diffusie methode op 295 K met verschillende kristallisatie kits met behulp van een geautomatiseerde vloeistof handling robot systeem in een 96-Wells-indeling.
    Opmerking: We gebruikten kits van moleculaire afmetingen en Hampton onderzoek en de Gryphon geautomatiseerd liquid handling systeem.
  3. Verzegel de kristallisatie van de 96-wells-plaat ter voorkoming van verdamping en de evenwichtsinstelling van de daling van de eiwitten met het reservoir buffer inschakelen. Dan houden de platen in de incubator kristal bij 18 ° C.
  4. Controleer de 96-wells-platen die periodiek met behulp van een lichte Microscoop kristal vorming en groei te volgen.
  5. Gebruiken om te onderscheiden van eiwit kristallen van zoutkristallen, een eiwit kleurstof. Voeg 1 µL van kleurstof aan de daling van de doelgroep. Wacht ongeveer 1 h en observeren onder Microscoop. De eiwit-kristallen zal draaien blauw.
  6. De positieve kristallisatie voorwaarden (1,5 M ammoniumsulfaat, 0,1 M Tris pH 8,0) gebruiken voor het verder optimaliseren van de kristallen met behulp van hangende damp-diffusie methode drop in 24-Wells-platen.
    1. Optimaliseren pH van 7.0 tot 8,5 met 0,5 pH eenheidsinterval elke stap. Optimaliseren van concentratie van ammoniumsulfaat van 1,2 M tot 1,7 M met 0,1 M interval elke stap. (In ons geval was de beste conditie produceren grote plaat-vormige kristallen 0,1 M HEPES pH 7.0 en 1.6 M ammoniumsulfaat)

3. Crystal montage, X-Ray gegevensverzameling en structuurbepaling

  1. Mount kristallen in een cryoloop en flash-cool in vloeibare stikstof met reservoir oplossing met 20% glycerol als cryo-protectant. Plaats de kristallen in unipuck voor de opslag en het vervoer.
  2. Eiwit kristallen met behulp van een Rigaku in-house X-ray diffractor vooraf te controleren. Kies de beste degenen met de hoogste resoluties voor gegevensverzameling bij synchrotron faciliteiten (onze dataset werd bijeengezocht uit BL17U1 op Shanghai Synchrotron Radiation Facility).
    1. Gebruik de beamline besturingssoftware BluIce26 te monteren en de kristallen door automatische of handmatige centreren functie centreren. Posities van de test om te bepalen van de data collectie strategie, inclusief starten van hoek, belichtingstijd, detector afstand, framebreedte en getallen uitvoeren
    2. Dataset dienovereenkomstig verzamelen (we verzameld 180 frames met de breedte van het frame van de 1°, 1 s blootstellingstijd en de afstand van de detector van 350 mm).
  3. Index, integreren en schaal van de dataset met behulp van HKL2000 suite27. Eerst verricht de piek zoekfunctie om te vinden de diffractie vlekken, en vervolgens het indexeren van de vlekken en selecteert u de juiste ruimte-groep. Na de integratie van de piek, schalen van de dataset met het juiste fout model en sla het uitvoerbestand voor de .sca.
  4. De fase-probleem oplossen door moleculaire vervanging Phaser28 met PHENIX29.
    1. Bereken de mogelijke exemplaaraantal van eiwitmolecules in de asymmetrische eenheid door Xtriage30.
    2. Kijk voor de juiste structuur templates met hoge sequentie identiteit en structurele gelijkenis als het doel eiwit met behulp van de bekende structuren van literatuur of de modellen die zijn gegenereerd door structuur voorspelling server zoals Phyre231 (we gebruikten konijn RyR1 NTD als een zoek model, VOB-ID 2XOA).
    3. Uitvoeren van Phaser met behulp van de diffractie-gegevensbestand, het sjabloonbestand voor de structuur en het eiwit sequentie-bestand om de oplossing te vinden.
  5. Voer AutoBuild32 in PHENIX29 voor het genereren van het eerste model met behulp van de output file van Phaser en het bestand van de reeks van de doel-eiwit.
  6. Handmatig de structuur te bouwen in de dichtheid van de gewijzigde experimentele elektron met behulp van Coot33 en verfijnen met behulp van phenix.refine34 in iteratieve cycli.
  7. Het uiteindelijke model met behulp van de validatiemiddelen in PHENIX18te valideren.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Zuivering

Het domein van de N-terminal van DBM RyR werd uitgedrukt als een fusieproteïne met een hexahistidine-label, een MBP-tag en de breukzijde van een TEV protease. We hebben gevolgd een strategie van de zuivering van de vijf stappen om te verkrijgen van een zeer zuivere eiwit, geschikt voor kristallisatie doel. Aanvankelijk was de fusieproteïne gezuiverd van de oplosbare fractie van cel lysate door Ni-NTA kolom (HisTrap HP). Vervolgens de fusieproteïne werd onderworpen aan TEV protease splijten en de hexahistidine-MBP deel daarvan werd verwijderd door amylose hars kolom, gevolgd door Ni-NTA kolom. Verder is het eiwit werd gezuiverd door anion wisselingskolom (Q Sepharose HP) en ten slotte door gel-filtratie kolom (Superdex 200 26/600). Het uiteindelijke rendement van gezuiverde eiwit van 1 L bacteriële cultuur met behulp van 2YT media was ~ 4 mg. De gezuiverde proteïne toonde een enkele band op SDS-pagina op ~ 21 kDa (Figuur 1). Het elutievolume uit gel-filtratie kolom bevestigd de gezuiverde RyR NTD om een monomeer (Figuur 1).

Kristallisatie

Eerste kristallisatie screening in 96-wells-platen leverde kristallen in verschillende omstandigheden. Deze voorwaarden werden geselecteerd voor de optimalisering van het kristal in 24 goed platen. De meest optimale conditie waar hoge kwaliteit plaat-vorm kristallen werden gevormd was 0,1 M HEPES pH 7.0 en 1.6 M ammoniumsulfaat (Figuur 2).

Structuurbepaling

Kristallen verkregen eiwitkristallen was aan 2,84 Å op beamline BL17U1 in Shanghai Synchrotron Radiation Facility. Het kristal werd geïndexeerd in ruimtegroep P61 met eenheidscel parameters een = 170.13, b = 170.13, c = 51.763 Å, α = β = 90.00 °, γ = 120 °. Voor de structuurbepaling, moleculaire vervanging werkte met konijn RyR1 NTD als model zoeken in PHENIX. Verdere verfijning van de structuur werd gedaan in PHENIX een definitieve Rwerken en Rgratis 21.63 en 24.52%, respectievelijk. De gegevens verzamelen en verfijning statistieken zijn vermeld in tabel 1. De opgeloste structuur van DBM RyR NTD die betrekking hebben op de residuen 1-205 (VOB-ID 5Y9V) is afgebeeld in Figuur 3.

Figure 1
Figuur 1: SDS-pagina en gel filtratie chromatografische vertegenwoordigen zuivering van DBM RyR NTD35. SDS-pagina (15%) in de inzet toont gezuiverde DBM RyR NTD als een enkele band nadat de vijf stap zuivering strategie. De linker rijstrook toont standaard eiwit marker (PM). Het gel filtratie chromatogram verkregen met behulp van een Superdex 200 26/600-kolom toont de elutie piek bij 240 mL, die correspondeert met de monomere vorm van het eiwit. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2. Kristallisatie van DBM RyR NTD35Kristallen van DBM RyR NTD geproduceerd door damp-diffusie methode als onder een lichte microscoop zichtbaar. De kristallisatie voorwaarde was 0,1 M HEPES pH 7.0 en 1.6 M ammoniumsulfaat. Schaal bar = 200 µm. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: Structuur van de DBM RyR NTD (VOB ID 5Y9V)35Opgelost structuur van het eiwit van twee weergaven getoond. Secundaire structuur elementen worden aangeduid. Β strengen staan in paars. Α-helix en een 310 -helix worden in blauw weergegeven. Lussen worden weergegeven in wit. NT en Ct vertegenwoordigen de N-terminal en de C-terminal van het eiwit, respectievelijk. Klik hier voor een grotere versie van dit cijfer.

Tabel 1: gegevens verzamelen en verfijning statistieken voor de DBM RyR NTD crystal35. Klik hier om te downloaden van deze tabel.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In dit artikel beschrijven we de procedure om te recombinantly express, zuiveren, kristalliseren en bepalen de structuur van de DBM RyR NTD. Voor de kristallisatie is een cruciale eis te verkrijgen van eiwitten met hoge oplosbaarheid, zuiverheid en homogeniteit. In ons protocol, we gekozen voor het huisdier-28a-HMT vector gebruiken omdat het bevat een hexahistidine tag en MBP tag, die beide kunnen worden gebruikt voor de zuivering te verkrijgen van een hogere zuiverheid van de vouw. Bovendien, de MBP Label aids in de oplosbaarheid van het target-eiwit. We gezuiverd het eiwit door vijf opeenvolgende stappen die eiwit dat zeer zuiver en geschikt voor kristallisatie was opgeleverd. Kristallisatie screening werd uitgevoerd met behulp van geautomatiseerde liquid handling systeem. Vergeleken met traditionele screening door de daling van de handmatige instelling, geautomatiseerd systeem maakt gebruik van zeer kleine hoeveelheden van het monster, bespaart tijd en energie. Het verbetert ook reproduceerbaarheid te wijten aan de nauwkeurigheid van vloeibare behandeling. Kristallen waren eiwitkristallen intern voor screening en bij synchrotron voor gegevensverzameling aangezien het voorziet x-ray met hogere intensiteit en minder divergentie, waardoor gegevens van hoge kwaliteit oplevert. Moleculaire vervanging was onze eerste keuze, net als soortgelijke structurele sjablonen beschikbaar in de-database. De alternatieve manier is het gebruik van experimentele geleidelijke invoering, met inbegrip van SAD, MIR, MAD, enz.

Terwijl het oplossen van de structuur van de DBM RyR NTD, de coëfficiënten van de Matthews verkregen Xtriage30 voorgesteld dat de asymmetrische eenheid (ASU) waarschijnlijk vier monomeren met 46% oplosmiddel inhoud bevatte, die heeft een waarschijnlijkheid van 49%. We kunnen echter niet de juiste oplossing met vier moleculen vinden in ASU. Latere loopt op zoek naar twee, drie, vijf, zes moleculen is ook mislukt. Uiteindelijk vonden we de juiste oplossing met slechts één molecuul in ASU, die alleen kans op 4% en meer dan 86% oplosmiddelen heeft. Het hoge watergehalte werd bevestigd nadat we de structuur opgelost. De extreem hoge gehalte aan oplosmiddelen bestaat dus, afhankelijk van de intrinsieke weg in welke eiwitten verpakkingen.

Hoewel röntgendiffractie een gouden standaard in eiwit structuurbepaling is, zijn eiwitten met grote wanorde of flexibele regio's en sommige grote eiwitcomplexen met zwakke affiniteit uitdagend te kristalliseren. Proteïne engineering methoden, met inbegrip van de lus-afkappen, oppervlakte entropie vermindering en cross-linking, de kans op het verkrijgen van betere eiwit kristallen kunnen verbeteren. Naast de onthulling van high-resolution eiwit structuren, kan röntgendiffractie ook worden gebruikt om te studeren van de eiwit-bestrijdingsmiddelen interacties, die ons op bestrijdingsmiddelen structuur gebaseerde ontwerp helpen zou. Qi et al. vond dat verschillende families van diamides naar verschillende sites die in soorten36 verschillenkunnen binden. Met behulp van onze strategie, kan men bepalen de RyR structuren uit meerdere soorten en identificeren van de unieke elementen die verantwoordelijk is voor de waargenomen species-specificity. Globaal, dit protocol kan worden aangepast voor bepaling van expressie, zuivering, kristallisatie en structuur van proteïnen of eiwit domeinen zelf of in complex met klein molecuul drugs.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgements

Financiering voor dit onderzoek werd verstrekt door: nationale sleutel onderzoek en ontwikkeling programma van China (2017YFD0201400, 2017YFD0201403), nationale aard Science Foundation van China (31320103922, 31230061) en Project van nationale basis (973) onderzoeksprogramma van China (2015CB856500, 2015CB856504). We zijn dankbaar voor het personeel op de beamline BL17U1 in Shanghai Synchrotron Radiation Facility (SSRF).

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics