N-terminal etki alanı Ryanodine reseptör Plutella xylostella gelen kristal yapısı

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Bu makalede, protein ifade, arıtma, kristalizasyon ve yapı tayini N-terminal etki alanı ryanodine reseptör diamondback güve (Plutella xylostella) üzerinden iletişim kuralları açıklar.

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Güçlü ve verimli böcek böcek ryanodine reseptörleri (RyRs) hedefleme geliştirilmesi tarımsal haşere kontrolü alanında büyük ilgi olmuştur. , Birkaç diamide böcek haşere RyRs ticari hedefleme bugüne kadar olan 2 milyar dolarlık yıllık gelir elde. Ama eylem RyR hedefleme böcek öldürücüler, modu, anlama böcek RyR ilgili yapısal bilgi eksikliği ile sınırlıdır. Bu sırayla anlama zararlıları böcek ilacı direnç gelişimi sınırlar. Diamondback güve (DBM) da diamide böcek öldürücüler direnç göstermek için rapor yok turpgillerden bitkileri dünya çapında, yıkıcı bir zararlı olduğunu. Bu nedenle, roman böcek öldürücüler DBM RyR, özellikle geleneksel diamide bağlama Web sitesinden farklı bir bölge hedefleme hedefleme geliştirmek için pratik büyük önem taşımaktadır. Burada, yapısal olarak RyR DBM üzerinden N-terminal etki alanını tanımlamak için bir iletişim kuralı mevcut. X-ışını kristal yapısı moleküler yedek bir çözünürlükte tarafından çözüldü 2,84 Å, hangi, bir beta-trefoil katlama motif ve bir kanat alpha sarmalının gösterir. Bu iletişim kuralı ifade, arıtma ve diğer etki alanları veya proteinler yapısal karakterizasyonu için genel olarak adapte edilebilir.

Introduction

Ryanodine reseptörleri (RyRs) Permeasyon Ca2 + iyonlarının kas hücrelerindeki sarcoplasmic retikulum (SR) membranlar arasında arabuluculuk belirli iyon kanalları vardır. Bu nedenle, işlem kaplin uyarma daralmaya önemli bir rol oynuyorlar. İşlevsel haliyle, bir homo tetramer moleküler kütlesi ile olarak RyR çeviren > her alt birim ~ 5000 amino asit kalıntıları eklenmesi oluşan ile 2 MDa. Memelilerde, üç izoformlarının vardır: RyR1 - kas iskelet tipi, RyR2 kalp kası tipi ve RyR3-ubiquitously farklı dokular1' dile getirdi.

Böcekler RyR, kas ve sinir dokusu2' de gösterilen tek bir türü yoktur. Böcek RyR memeli RyR2 bir sıra kimliğini yaklaşık % 47 ile daha benzer3. Diamide böcek RyR Lepidoptera ve Coleoptera hedefleyen geliştirilmiştir ve Bayer (flubendiamide), DuPont (chlorantraniliprole) ve Syngenta (cyantraniliprole) gibi büyük şirketler tarafından pazarlanan. Nispeten son başlatılmasından bu yana, diamide böcek böcek öldürücüler en hızlı büyüyen sınıf biri haline gelmiştir. Şu anda, bu üç böcek öldürücüler yıllık satış 2009 yılından bu yana (Agranova) 2 milyar ABD Doları % 50'den fazla bir büyüme oranı ile kesişti.

Son yıllarda yapılan çalışmalarda bu böcek öldürücüler4,5,6,7,8kullanımı, birkaç kuşak sonra böceklerde direnç gelişimi bildirdin. Direnç mutasyonlar transmembran etki alanındaki RyRs diamondback güve (DBM), Plutella xylostella (G4946E, I4790M) ve domates leafminer ilgili pozisyonlarda, Tuta absoluta (G4903E, I4746M) bu bölge göster Bu bölge kanal4,8,9geçişi için kritik olduğu bilinmektedir olarak diamide böcek ilacı bağlamasında dahil olabilir. Bu alanda kapsamlı bir araştırma rağmen diamide böcek öldürücüler tam moleküler mekanizmaları zor kalır. Ayrıca, direnç mutasyonları diamides ile etkileşimi doğrudan veya allosterically etkiler belirsizdir.

Daha önceki çalışmalar memeli türlerden birkaç RyR etki alanı yapısını ve yapısı tam uzunlukta memeli RyR1 ve RyR2 x-ışını kristalografisi ve cryo-elektron mikroskobu, sırasıyla10,11tarafından bildirdin, 12,13,14,15,16,17,18,19,20,21 . Ama şimdiye kadar hiçbir yapısını böcek RyR, bizi moleküler inceliklerini reseptör işlevinin yanı sıra böcek ilacı eylem moleküler mekanizmaları ve böcek ilacı direnç gelişimi anlamak yasaklayan bildirilmiştir.

Bu makale, biz N-terminal β-trefoil etki alanı ryanodine reseptör diamondback güve, yıkıcı bir haşere turpgillerden bitkileri dünya çapında22bulaşmasını gelen yapısal karakterizasyonu için genel bir iletişim kuralı mevcut. Yapı dizayn edilmiştir yayımlanan tavşan RyR1 nöral tüp defekti kristal yapıları23,24ve cryo-EM yapısal modelleri16,17,18,19, göre 20 , 21. bu böcek RyR, hangi kanal geçişi için mekanizma ortaya çıkarır ve uyuşturucu yapısı tabanlı tasarım kullanarak species-specific böcek öldürücüler geliştirmesi için önemli bir şablon sağlar için bildirilen ilk yüksek çözünürlüklü yapısıdır. Yapısı aydınlatma için 'altın standart' protein yapı tayini için atomik çözünürlük yakın olarak kabul edilir x-ışını kristalografisi çalıştırmaya başladık. Kristalizasyon işlem öngörülemeyen ve emek yoğun olmakla birlikte, adım adım bu protokolü araştırmacılar hızlı, arındırmak ve böcek RyR ya da herhangi bir diğer proteinler diğer etki alanlarındaki genel olarak karakterize etmek için yardımcı olacaktır.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Gen klonlama, Protein ifade ve arıtma

  1. PCR yükseltmek için ilgi protein karşılık gelen DNA (DBM RyR, Genbank artıkları 1-205 Hayır Hes. AFW97408) ve klon ligasyonu bağımsız klonlama (LIC)25tarafından evde beslenen hayvan-28a-HMT vektör içine. Histidin etiketi, MBP etiket ve N-terminus bir TEV proteaz bölünme sitesinde bu vektör içerir15.
    1. Tasarım LIC astar hedef gen LIC uyumlu 5' uzantılı amplifikasyon için:
      LIC astar ilet:
      5' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3'
      Ters LIC astar:
      5' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3'
    2. Reaksiyon parçaları (50 μL) birleştirmek: 1 μL DNA şablonları (100 ng/μL), ileri astar (10 mikron), ters astar (10 mikron), DNA polimeraz (NF'leri), 10 x reaksiyon 5 μL 0.5 μL 1 μL 1 μL tampon, 1 μL dNTP (25 mM) , 40.5 μL RNase free GKD2O.
      1. Bir PCR makinesi ile reaksiyon karışımı yerleştirin ve aşağıdaki programı çalıştır.
      2. 95 ° c 3 min için kuluçkaya ve 30 döngüleri çalıştırın (95 ° C 30 s, 15 58 ° C s, 1 dk 72 ° C). 5 min için 72 ° C'de kuluçkaya ve 4 ° C'de basılı tutun
      3. Tüm reaksiyon mix (50 μL) % 2 özel jel üzerinde çalıştırmak ve bir jel ekstraksiyon kiti ile ayıklayın. Üreticinin iletişim kuralı izleyin.
    3. Tüp ligasyonu bağımsız (LIC) klonlama
      1. SSPI sindirim (60 μL) gerçekleştirmek: 20 μL vektörünün DNA (50 ng/μL), 10 x reaksiyon arabellek, SSPI 4 μL ve GKD2O. Incubate 3 h. tüm reaksiyon çalıştırmak için 37 ° C'de 30 μL 6 μL mix üzerinde % 1'özel jel ve bir jel ekstraksiyon kiti ile ayıklayın. Üreticinin iletişim kuralı izleyin.
      2. Yöneyin T4 DNA polimeraz tedavi gerçekleştirmek ve DNA ekleyin. Şu birleştirmek: vektör veya INSERT DNA'ın 5 μL (50 ng/μL), 10 x T4 DNA polimeraz arabelleği, dGTP (25 mM) vektör veya INSERT DNA'ın, 1 μL DTT (100 mM), 0.4 μL, T4 DNA polimeraz (LIC nitelikli), dCTP (25 mM) 1 μL 1 μL 2 μL ve 9,6 μL GKD2O. Incubate reaksiyonlar, oda sıcaklığında 20 dakika 75 ° C'de 40 dk. ısı devre dışı bırakabilirsiniz enzim için.
        Not: LIC vektör ve INSERT DNA ayrı tepkileri ele alınması gerekir.
      3. Reaksiyon tavlama LIC gerçekleştirin. Şu birleştirmek: T4 tedavi Ekle DNA, LIC T4 tedavi 2 μL 2 μL vektör DNA. Reaksiyon, oda sıcaklığında 10 dakika için kuluçkaya.
  2. Bl21 dönüştürmek (DE3) E. coli hücreleri bu rekombinant plazmid ile.
    1. Yetkili hücreleri (mikro-santrifüj tüpü içinde 50 μL) buz çözme.
    2. Yaklaşık 1 μL ekleyin (50 ng), plazmid tüp içine. Hücreleri ve DNA hafifçe 2-3 kez tüp flicking tarafından karıştırın. Tüp buz 20 dakika yerleştirin.
    3. Şok 42 ° c için 40 s. yer buz 2 dk. eklemek 1 mL tüp oda sıcaklığında LB medya için tekrar tüp ısı.
    4. Yer karışım tüp 37 ° C'de 250 d/d Shaker 45 dakika süreyle 150-200 µL seçimi plakalar üzerine karışımı yayılmış. Plaka ters çevir ve gecede 37 ° C'de kuluçkaya
  3. Bir koloni ve Kültür 100 mL 2YT orta 50 µg/mL sefaloridin 37 ° C'de gecede içeren hücreleri seçin. Ertesi sabah, 10 mL gecede kültür ile 50 µg/mL sefaloridin içeren 1 L 2YT orta aşılamak ve OD600 ~ 0,6 ulaşıncaya kadar 37 ° C shaker kuluçka 250 rpm'de kuluçkaya. Bundan sonra IPTG ile kültür 0.4 mM son bir konsantrasyon için ikna etmek ve başka bir 5 h 30 ° C'de için büyümek
  4. Santrifüjü 8.000 x g 4 ° C'de 10 dakika için de tarafından hücreleri hasat, hücreleri toplamak ve 40 mL lizis arabellek (10 mM HEPES pH 7.4, 250 mM KCl, 10 mM β-mercaptoethanol, 25 μg/mL lizozim, 25 μg/mL DNaz her 10 g hücrelerde resuspend 1 mM PMSF).
    1. Sonication için 1 ile 8 dk % 65 genlik, tarafından bozabilir s s açık ve 1 kapalı. Santrifüjü 40.000 x g 4 ° C'de 30 dk için de hücre artıkları çıkarın Süpernatant 0,22 mikron filtreden geçirilerek filtre ve örnek döngü içine yükleyin.
  5. Füzyon proteini arındırmak, etiketi ayırmak ve hedef protein yeniden arındırmak.
    1. Ni-NTA sütun kullanarak füzyon protein arındırmak (bağlama arabellek: 10 mM HEPES pH 7.4, 250 mM KCl; elüsyon arabellek: 10 mM HEPES pH 7.4, 250 mM KCl, 500 mM imidazole) ve 20-250 mM imidazole doğrusal bir gradyan ile bir arıtma sistemi tarafından arındırmak.
    2. Eluted hedef protein TEV proteaz ile ayırmak (1:50 oranı) gecede 4 ° C'de
    3. Amiloz reçine sütun kullanarak bölünme tepki karışımı arındırmak (bağlama arabellek: 10 mM HEPES pH 7.4, 250 mM KCl; elüsyon arabellek: 10 mM HEPES pH 7.4, 250 mM KCl, 10 mM maltoz) ve Ni-NTA sütun etiketi ve TEV proteaz kaldırmak için. Hedef protein bu iki sütunu içinde akışı aracılığıyla kesir olacak.
    4. Diyaliz arabellek (10 mM Tris-HCl pH 8.8, 50 mM KCl, tuz konsantrasyonu azaltmak için β-mercaptoethanol 10 mM. karşı örnek diyaliz Örnek bir anyon Satım sütun üzerinde arındırmak (bağlama arabellek: 10 mM Tris-HCl pH 8.8, 10 mM β-mercaptoethanol; elüsyon arabellek: 10 mM Tris-HCl pH 8.8, 1 M KCl, 10 mM β-mercaptoethanol) tarafından 20-500 mm KCl elüsyon arabellekte doğrusal gradyan.
    5. Arıtma sürecindeki son adım, santrifüj yoğunlaştırıcı (10 kDa MWCO) kullanarak protein konsantre ve homojenliği kontrol etmek için Superdex 200 26/600 jel-filtrasyon sütun enjekte.
  6. Protein saflığı % 15 SDS sayfa üzerinde çalıştırarak inceleyin.
    Not: Tüm sütunları bir bağlama akış hızı 2 mL/dk ve 4 mL/dk jel-filtrasyon 1 mL/dk dışında bir elüsyon akış hızı ile bir protein arıtma sistemi üzerinde çalışıyor.

2. protein hazırlık ve kristalizasyon

  1. Saf protein örnek 10 mg/ml-80 ° C'de depolamadan önce santrifüj yoğunlaştırıcı (10 kDa MWCO) ve kristalizasyon arabellek arabellek Exchange'e kullanarak konsantre
  2. Kristalizasyon tarama gerçekleştirmek (1:1 oran, 200 nL protein ve 200 nL rezervuar arabelleği) tarafından oturma 295 k bir 96-iyi biçimde robotik sistem işleme bir otomatik sıvı kullanarak birkaç kristalizasyon kitleri ile buharı difüzyon yöntemi bırak.
    Not: Moleküler boyutları ve Hampton Araştırma Kitleri kullandık ve Gryphon otomatik sıvı işleme sistemi.
  3. Buharlaşma önlemek ve protein bırak rezervuar arabellek ile denge etkinleştirmek için 96-şey kristalizasyon plaka mühür. Daha sonra plakaları 18 ° C'de kristal kuluçka makinesine tutmak
  4. Düzenli olarak kristal oluşumu ve büyüme izlemek için hafif bir mikroskop kullanarak 96-şey plakaları kontrol edin.
  5. Protein kristalleri tuz kristallerinin ayırt etmek için bir protein boya kullanın. Boya 1 µL hedef damla ekleyin. Yaklaşık 1 saat bekleyin ve mikroskop altında gözlemlemek. Protein kristalleri mavi dönecek.
  6. Daha fazla asılı kullanarak kristallerin en iyi duruma getirmek için olumlu kristalizasyon koşullar (1.5 M amonyum sülfat, 0.1 M Tris pH 8.0) kullanma 24-şey levha buharı difüzyon yöntemi bırak.
    1. PH 7,0 üzerinden 8,5 0,5 pH birim aralığı ile için her adımda en iyi duruma getirme. Konsantrasyonu 1.7 m 1.2 m amonyum sülfat 0,1 M aralığı ile her adım optimize edin. (Bizim durumumuzda büyük levha biçimli kristaller üreten en iyi durumda 0.1 M HEPES pH 7,0 ve 1.6 M amonyum sülfat idi)

3. Kristal montaj, x-ışını veri toplama ve yapı belirlenmesi

  1. Bir cryoloop kristaller ve flash-serin sıvı azot % 20 gliserol cryo-koruyucu olarak içeren rezervuar çözüm kullanarak bağlayın. Unipuck depolama ve nakliye için kristalleri yerleştirin.
  2. Protein kristalleri Rigaku in-house x-ışını diffractor kullanarak önceden görüntüleme. (Bizim veri kümesi BL17U1 Shanghai sinkrotron radyasyon tesisi de toplanmıştır) en yüksek çözünürlükler için veri toplama sinkrotron tesisleri ile en iyi olanları seçin.
    1. Mount ve kristalleri otomatik veya el ile ortalama işlevi tarafından merkezi BluIce26 beamline kontrol yazılımı kullanın. Başlangıç açısı, pozlama süresi, dedektör mesafe, çerçeve genişliği ve numaraları da dahil olmak üzere veri toplama stratejisini belirlemek için test Etkilenmeler gerçekleştirin.
    2. Veri kümesi buna göre toplamak (1 s çekim hızı, 1 ° çerçeve genişliği ve dedektör mesafesi 350 mm 180 çerçevelerle topladığımız).
  3. Dizin, entegre ve HKL2000 Süit27kullanarak veri kümesi ölçek. İlk kırınım noktalar bulmak için en yüksek arama iþlevini gerçekleþtirmek ve noktalar dizin ve doğru alan grubunu seçin. Tepe Tümleştirme sonra veri kümesi uygun hata modeli ile ölçekli ve çıkış .sca dosyayı kaydedin.
  4. Moleküler değiştirme fazer28 PHENIX29kullanarak tarafından faz sorunu çözmek.
    1. Xtriage30' protein molekülleri asimetrik biriminde mümkün kopya sayısını hesaplayın.
    2. Edebiyat veya modelleri yapısı tahmin Phyre231 gibi sunucu tarafından üretilen bilinen yapıları kullanarak hedef protein olarak yüksek sıra kimlik ve yapısal benzerlik ile uygun yapısı şablonları için bak (tavşan RyR1 nöral tüp defekti kullanılan olarak bir ara modeli, PDB kimliği 2XOA).
    3. Fazer kırınım veri dosyası, şablon yapısı dosyası ve protein dizi dosya bulmak belgili tanımlık eriyik kullanarak çalıştırın.
  5. Fazer çıkış dosyasından ve hedef protein sıra dosyasından kullanarak ilk modeli oluşturmak için PHENIX29 AutoBuild32 gerçekleştirin.
  6. El ile Coot33 kullanarak değiştirilmiş deneysel elektron yoğunluğu yapısını oluşturmak ve phenix.refine34 yinelemeli döngüleri kullanarak rafine.
  7. PHENIX18' doğrulama Araçları'nı kullanarak son modeli doğrulama.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Arıtma

DBM RyR N-terminal etki hexahistidine etiketi, MBP etiket ve TEV proteaz bölünme site bir füzyon proteini olarak ifade edildi. Kristalizasyon amaç için uygun bir son derece saf protein elde etmek için beş adım arıtma strateji takip ettik. İlk başta, Füzyon proteini hücre lysate çözünür kısmını Ni-NTA sütun (HisTrap HP) tarafından saflaştırıldı. Ardından, Füzyon protein TEV proteaz bölünme için maruz kaldığı ve hexahistidine-MBP yan Amiloz reçine sütun Ni-NTA sütuna göre takip tarafından kaldırıldı. Ayrıca, protein anyon Satım sütun (Q Sepharose HP) tarafından saflaştırıldı ve nihayet jel-filtrasyon sütun (Superdex 200 26/600) tarafından. 1 L bakteriyel kültüründen 2YT medya kullanarak saf protein son verim ~ 4 mg oldu. Saf protein tek bir bant SDS-sayfasında ~ 21 kDa (Şekil 1) gösterdi. Jel-filtrasyon sütun elüsyon birimden bir monomer (Şekil 1) olmak için saf RyR nöral tüp defekti doğruladı.

Kristalizasyon

96-şey levha eleme ilk kristalizasyon kristalleri çeşitli koşullarda vermiştir. Bu koşullar 24 iyi tabak içinde kristal optimizasyonu için seçildi. Nerede kaliteli plaka-Şekil kristalleri kuruldu en uygun koşul 0.1 M HEPES pH 7,0 ve 1.6 M amonyum sülfat (Şekil 2) yapıldı.

Yapı belirlenmesi

Kristalleri elde 2,84 Å beamline BL17U1 Shanghai sinkrotron radyasyon tesisi de tarih için diffracted. Kristal alan grup P6, dizini1 birim hücre parametrelerle bir 170.13, = b 170.13, c = 51.763 Å, α = β = 90.00 °, γ = 120 ° =. Yapı belirlenmesi için moleküler yerine arama model PHENIX olarak tavşan RyR1 nöral tüp defekti kullanarak istihdam edildi. Yapısı daha fazla ayrıntılandırma PHENIX içinde bir nihai R ve R 21.63 ve %24.52,ücretsiz için sırasıyla yapıldı. Veri toplama ve arıtma istatistikleri Tablo 1' de listelenmiştir. DBM RyR artıkları 1-205 (PDB kimliği 5Y9V) kapsayan nöral tüp defekti çözüldü yapısını Şekil 3' te gösterilmiştir.

Figure 1
Şekil 1: arıtma DBM RyR nöral tüp defekti35temsil eden SDS-sayfa ve jel filtrasyon kromatografik. Adım beş arıtma strateji sonra SDS sayfasında (% 15) ilave tek bir bant arıtılmış DBM RyR nöral tüp defekti gösterir. Sol şeritte standart protein işaretleyici (PM) gösterir. Superdex 200 26/600 sütun kullanarak elde edilen jel filtrasyon kromatografik elüsyon tepe 240 mL, protein monomeric şekline karşılık gelen gösterir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2. DBM kristalleşme RyR nöral tüp defekti35Işık mikroskop altında görülen kristaller DBM RyR NTD buharı difüzyon yöntemi tarafından üretilen. Kristalizasyon durumunun 0.1 M HEPES pH 7,0 ve 1.6 M amonyum sülfat olduğunu. Ölçek çubuğu 200 µm. = Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: Yapısını DBM RyR nöral tüp defekti (PDB kimlik 5Y9V)35İki görünüm gösterilen protein yapısını çözdü. İkincil yapı elemanları olarak etiketlenmiştir. Β iplikçikleri mor olarak gösterilir. Α sarmal ve 310 helix mavi renkle gösterilir. Döngüler beyaz olarak gösterilir. NT ve Ct N-terminal ve C-terminal protein, sırasıyla temsil eder. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Tablo 1: veri toplama ve arıtma istatistikleri için DBM RyR nöral tüp defekti kristal35. Bu tabloyu indirmek için buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bu yazıda, recombinantly express, arındırmak, kristalize ve DBM RyR nöral tüp defekti yapısını belirlemek için bu yordamı açıklar. Kristalizasyon için yüksek çözünürlük, saflık ve homojenliği ile protein elde etmek çok önemli bir gereksinimdir. Bizim iletişim kuralında, bir hexahistidine etiketi ve MBP etiketi, ikisi de daha yüksek bir kat saflık elde etmek arıtma için yararlanılabilir içerdiğinden evde beslenen hayvan-28a-HMT vektör kullanmayı seçtiniz. Ayrıca, hedef protein çözünürlük MBP etiketi AIDS. Son derece saf ve kristalizasyon için uygun protein vermiştir beş ardışık adımlar tarafından protein saf. Kristalizasyon tarama otomatik sıvı işleme sistemi kullanılarak gerçekleştirildi. Geleneksel tarama için el ile açılan ayarıyla karşılaştırıldığında, otomatik sistem örnek çok küçük miktarda kullanır, zaman ve enerji tasarrufu sağlar. O da tekrarlanabilirlik nedeniyle sıvı işleme doğruluğunu artırır. X-ışını daha yüksek yoğunluğu ile ve daha az sapma sağladığından kristalleri şirket içinde tarama ve sinkrotron veri toplama için kaliteli veri böylece verimli diffracted. Benzer yapısal şablonları veritabanında kullanılabilir olduğu gibi moleküler yerine ilk seçenek oldu. Deneysel phasing, MAD, SAD, MIR, vb dahil olmak üzere kullanmak için alternatif yoldur

DBM RyR nöral tüp defekti, Xtriage30 ' dan itibaren elde edilen Matthews katsayıları yapısını çözme asimetrik birim (ASU) büyük olasılıkla % 46 solvent içerik ile dört monomerleri bulunan önerdi hangi bir olasılık % 49 sahipken. Ancak, ASU içinde dört molekülleri ile doğru çözüm bulamadı. İki, üç, beş, altı moleküller için bakmak için sonraki ishal de başarısız oldu. Sonunda sadece % 4 olasılık ve üzeri % 86 solvent içeriğe sahip ASU içinde tek bir molekül ile doğru çözümü bulduk. Biz yapısı çözüldü sonra yüksek su içeriği doğrulandı. Böylece, aşırı yüksek çözücü içeriği hangi protein paketlerde iç yönteme bağlı olarak mevcut.

X-ışını kristalografisi altın standart protein yapısı belirlenmesi olsa da, proteinler ile büyük bozukluğu ya da esnek bölgeler ve bazı büyük protein kompleksleri zayıf benzeşimli kristalize zor. Döngü-kesme, dahil olmak üzere protein Mühendislik yöntemleri yüzey entropi azaltma ve cross-linking, daha iyi protein kristalleri elde etme olasılığını artırmak. Yüksek çözünürlüklü protein yapılarının açığa yanı sıra, x-ışını kristalografisi bize pestisit yapısı tabanlı tasarım yardımcı olacak protein-pestisit etkileşimleri eğitim için de kullanılabilir. Qi vd. diamides farklı aileler farklı türler36arasında farklı sitelere bağlamak bulundu. Bizim strateji kullanarak, bir çoklu türlerden RyR yapıları belirlemek ve benzersiz öğeleri için gözlenen species-specificity sorumlu tanımlamak. Genel olarak, bu iletişim kuralı tek başlarına veya küçük molekül ilaçlarla karmaşık ifade, arıtma, kristalizasyon ve yapı belirlenmesi herhangi bir protein veya protein etki alanları için adapte edilebilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgements

Bu araştırma tarafından sağlanan için finansman: Ulusal anahtar araştırma ve geliştirme Çin Program (2017YFD0201400, 2017YFD0201403), Ulusal Doğa Bilim Vakfı Çin (31320103922, 31230061) ve proje, Ulusal temel araştırma (973) programı Çin (2015CB856500, 2015CB856504). Beamline BL17U1 Shanghai sinkrotron radyasyon tesisi (SSRF), personel için minnettarız.

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics