Struttura di cristallo del dominio N-terminale del recettore Ryanodine da Plutella xylostella

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

In questo articolo, descriviamo i protocolli della determinazione di espressione, purificazione, cristallizzazione e struttura della proteina del dominio N-terminale del recettore rianodinico da diamondback moth (Plutella xylostella).

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Sviluppo di insetticidi potenti ed efficienti targeting recettori della rianodina insetto (RyRs) è stato di grande interesse nella zona di controllo dei parassiti agricoli. Ad oggi, diversi insetticidi diammide targeting dei parassiti che RyRs sono stati commercializzati, che generano un fatturato annuo di 2 miliardi di dollari. Ma la comprensione del modo di azione degli insetticidi RyR-targeting è limitata dalla mancanza di informazioni strutturali per quanto riguarda insetto RyR. Questo a sua volta limita la comprensione dello sviluppo della resistenza agli insetticidi in parassiti. Il diamondback moth (DBM) è un parassita devastante distruggendo crocifere raccolti in tutto il mondo, che inoltre è stato segnalato per mostrare resistenza agli insetticidi diammide. Pertanto, è di grande importanza pratica per sviluppare nuovi insetticidi il RyR DBM, targeting soprattutto per una regione diversa dal sito di legame tradizionale diammide di targeting. Qui, presentiamo un protocollo per caratterizzare strutturalmente il dominio N-terminale di RyR da DBM. La struttura di cristallo dei raggi x è stato risolto da sostituzione molecolare ad una risoluzione di 2,84 Å, che mostra un motivo di beta-trefoil pieghevole e un accompagnamento alfa elica. Questo protocollo può essere adattato per l'espressione, purificazione e caratterizzazione strutturale di altri domini o proteine in generale.

Introduction

Recettori della rianodina (RyRs) sono canali ionici specifici, che mediano la permeazione degli ioni Ca2 + attraverso le membrane del reticolo sarcoplasmatico (SR) nelle cellule muscolari. Di conseguenza, giocano un ruolo importante nel processo di accoppiamento eccitazione contrazione. Nella sua forma funzionale, RyR monta come un homo-tetramero con una massa molecolare di > 2 MDa, con ogni unità secondaria che contengono residui dell'amminoacido ~ 5000. Nei mammiferi, ci sono tre isoforme: RyR1 - tipo di muscolo scheletrico, muscolo cardiaco tipo di RyR2 - e RyR3-ubiquitariamente espressa in diversi tessuti1.

Negli insetti c'è un solo tipo di RyR, che si esprime nel tessuto muscolare e nervoso2. Insetto RyR è più simile a mammiferi RyR2 con un'identità di sequenza di circa il 47%3. Insetticidi di diammide targeting RyR di lepidotteri e coleotteri sono stati sviluppati e commercializzati da importanti aziende come Bayer (flubendiamide), DuPont (chlorantraniliprole) e Syngenta (cyantraniliprole). Dal suo lancio relativamente recente, diammide insetticidi sono diventati uno della più rapida crescita classe di insetticidi. Attualmente, le vendite di questi tre insetticidi annualmente hanno attraversato 2 miliardi di dollari con un tasso di crescita di oltre il 50% dal 2009 (Agranova).

Gli studi recenti hanno segnalato lo sviluppo di resistenza negli insetti dopo poche generazioni di utilizzo di questi insetticidi4,5,6,7,8. Le mutazioni di resistenza nel dominio del transmembrane di RyRs dal diamondback moth (DBM), Plutella xylostella (G4946E, I4790M) e le corrispondenti posizioni in pomodoro minatrice, Tuta absoluta (G4903E, I4746M) mostrano che la regione potrebbe essere coinvolto nel legame di insetticida diammide come questa regione è conosciuta per essere critico per gating del canale4,8,9. Nonostante approfondite ricerche in questo settore, i meccanismi molecolari esatti di insetticidi diammide rimangono evasivi. Inoltre, non è chiaro se le mutazioni di resistenza riguardano le interazioni con diamides direttamente o allosterico.

Precedenti studi hanno segnalato la struttura dei diversi domini di RyR da specie di mammiferi e la struttura del full-length dei mammiferi RyR1 e RyR2 di cristallografia a raggi x e microscopia crio-elettronica, rispettivamente10,11, 12,13,14,15,16,17,18,19,20,21 . Ma finora, nessuna struttura di insetto RyR è stata segnalata, che ci impedisce di comprendere le complessità molecolare della funzione del ricevitore come pure i meccanismi molecolari di azione insetticida e lo sviluppo della resistenza agli insetticidi.

In questo manoscritto, presentiamo un protocollo generalizzato per la caratterizzazione strutturale del dominio β-trifoglio N-terminale del recettore rianodinico dal diamondback moth, un parassita distruttivo infettare crocifere colture in tutto il mondo22. Il costrutto è stato progettato secondo il coniglio pubblicati RyR1 NTD cristallo strutture23,24e cryo-EM modelli strutturali16,17,18,19, 20 , 21. Questa è la prima struttura ad alta risoluzione segnalata per insetto RyR, che rivela il meccanismo per canale gating e fornisce un modello importante per lo sviluppo di specie-insetticidi utilizzando Progettazione di farmaci basati su struttura. Per delucidazione della struttura, abbiamo impiegato la cristallografia a raggi x, che è considerato come il 'gold standard' per la determinazione della struttura della proteina a vicino a risoluzione atomica. Anche se il processo di cristallizzazione è imprevedibile e alta intensità di manodopera, questo protocollo passo-passo vi aiuterà i ricercatori di esprimere, purificare e caratterizzare altri domini di insetto RyR o qualsiasi altre proteine in generale.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. clonazione di Gene, l'espressione della proteina e la purificazione

  1. PCR amplificare il DNA corrispondente alla proteina di interesse (residui 1-205 di DBM RyR, Genbank ACC. n. AFW97408) e clone in animali-28a-HMT vettore di clonazione di legatura-indipendente (LIC)25. Questo vettore contiene un tag di istidina, MBP tag e un sito di clivaggio della proteasi TEV al N-terminale15.
    1. Progettazione LIC primer per l'amplificazione del gene bersaglio con LIC-compatibile 5' le estensioni:
      Forward primer LIC:
      5' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3'
      Reverse primer LIC:
      5' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3'
    2. Combinare i componenti di reazione (50 μL): 1 μL di modelli di DNA (100 ng/μL), 1 μL di forward primer (10 μM), 1 μL di reverse primer (10 μM), 0,5 µ l di DNA polimerasi (NEB), 5 μL di reazione 10X tampone, 1 μL di dNTP (25 mM) , 40,5 μL della RNasi free ddH2O.
      1. Inserire la miscela di reazione in una macchina PCR ed eseguire il seguente programma.
      2. Incubare a 95 ° C per 3 min, e quindi eseguire 30 cicli di (95 ° C per 30 s, 58 ° C per 15 s, 72 ° C per 1 min). Incubare a 72 ° C per 5 min e quindi tenere a 4 ° C.
      3. Eseguire il mix di reazione intera (50 μL) su un gel di agarosio al 2% ed estrarre con un Kit di estrazione del Gel. Seguire il protocollo del produttore.
    3. Legatura-indipendente clonazione (LIC)
      1. Eseguire SspI digestione (60 µ l): 20 μL di DNA di vettore (50 ng/μL), 6 μL di tampone di reazione, 4 μL di SspI e 30 μL di ddH2O. Incubare a 37 ° C per 3 h. eseguire l'intera reazione: 10x mescolare su gel di agarosio 1% ed estrarre con un Kit di estrazione del Gel. Seguire il protocollo del produttore.
      2. Eseguire trattamento T4 DNA polimerasi del vettore e inserire il DNA. Combinare i seguenti: 5 μL di DNA vettore o insert (50 ng/μL), 2 μL di tampone di 10 x T4 DNA polimerasi, 1 μL del dGTP (25 mM) per vettore o 1 μL di dCTP (25 mM) per inserimento del DNA, 1 μL di DTT (100 mM), 0,4 μL di T4 DNA polimerasi (LIC-qualificato) e 9.6 μL di reazioni di ddH2O. Incubare a temperatura ambiente per 40 min. inattivare con il calore enzima a 75 ° C per 20 min.
        Nota: Il vettore LIC e inserimento del DNA devono essere trattati in reazioni separate.
      3. Eseguire la reazione di ricottura di LIC. Combinare i seguenti: 2 µ l di DNA di T4-trattati inserto, 2 μL di LIC T4-trattati di vettore del DNA. Incubare la reazione a temperatura ambiente per 10 min.
  2. Trasformare BL21 (DE3) Escherichia coli cellule con questo plasmide ricombinante.
    1. Scongelare le cellule competenti (50 μL in micro-provetta) sul ghiaccio.
    2. Aggiungere circa 1 μL (50 ng) del plasmide nel tubo. Mescolare le cellule e DNA scorrendo delicatamente il tubo 2 – 3 volte. Porre la provetta in ghiaccio per 20 min.
    3. Riscaldare shock a 42 ° C per 40 s. posto il tubo sul ghiaccio ancora per 2 min. aggiungere 1 mL di LB di temperatura media per il tubo.
    4. Posto il tubo miscela nello shaker 250 giri/min a 37 ° C per 45 min. sviluppa 150 – 200 µ l della miscela nei piatti di selezione. Capovolgere la piastra e incubare per una notte a 37 ° C.
  3. Scegli una singola Colonia e cultura le cellule in 100 mL di terreno di 2YT contenente 50 kanamicina µ g/mL a 37 ° C durante la notte. Mattina successiva, inoculare medio 2YT 1 L contenente 50 kanamicina µ g/mL 10 ml di coltura durante la notte e incubare in incubatore a 37 ° C agitatore a 250 giri/min, fino a quando raggiunge il OD600 ~ 0.6. Da allora in poi indurre la cultura con IPTG ad una concentrazione finale di 0,4 mM e crescere per un altro 5 h a 30 ° C.
  4. Raccogliere le cellule mediante centrifugazione a 8.000 x g per 10 min a 4 ° C, raccogliere le cellule e risospendere ogni cellule di 10 g in 40 mL di tampone di lisi (10 mM HEPES pH 7.4, 250 mM KCl, 10mm β-mercaptoetanolo, lisozima di 25 μg/mL, 25 μg/mL dnasi 1 mM PMSF).
    1. Interromperla tramite sonicazione ad ampiezza di 65% per 8 min con 1 s s on e 1 fuori. Rimuovere i detriti cellulari mediante centrifugazione a 40.000 x g per 30 min a 4 ° C. Filtrare il surnatante passando attraverso il filtro di 0,22 μm e caricarlo nel loop del campione.
  5. Purificare la proteina di fusione, fendere il tag e ri-purificare la proteina bersaglio.
    1. Purificare la proteina di fusione utilizzando colonna Ni-NTA (buffer obbligatorio: 10 mM a pH 7.4, 250 mM KCl HEPES; tampone di eluizione: 10 mM a pH 7.4, 250 mM KCl, imidazolo 500 mM HEPES) e purificare da un sistema di depurazione, con una sfumatura lineare di imidazolo 20 – 250 mM.
    2. Fendere la proteina bersaglio eluiti con proteasi TEV (01:50 rapporto) overnight a 4 ° C.
    3. Purificare la miscela di reazione di scissione tramite colonna di resina di amilosio (buffer obbligatorio: 10 mM a pH 7.4, 250 mM KCl HEPES; tampone di eluizione: 10 mM a pH 7.4, 250 mM KCl, maltosio 10 mM HEPES) e colonna Ni-NTA per rimuovere il tag e proteasi TEV. La proteina dell'obiettivo sarà nella frazione del flusso continuo di queste due colonne.
    4. Dializzare il campione contro il buffer di dialisi (10 mM Tris-HCl pH 8,8, 50 mM KCl, 10mm β-mercaptoetanolo per ridurre la concentrazione di sale. Purificare il campione su una colonna di scambio anionico (buffer obbligatorio: 10 mM Tris-HCl a pH 8.8, 10mm β-mercaptoetanolo; tampone di eluizione: 10 mM Tris-HCl a pH 8.8, 1m KCl, 10mm β-mercaptoetanolo) da una sfumatura lineare di 20 – 500 mM KCl nel buffer di eluizione.
    5. Come ultimo passo nel processo di purificazione, concentrare la proteina utilizzando concentratore centrifugo (10 kDa MWCO) e iniettare in una colonna di gel-filtrazione Superdex 200 26/600 per verificare l'omogeneità.
  6. Esaminare la purezza della proteina in esecuzione su un 15% SDS pagina.
    Nota: Tutte le colonne sono in esecuzione su un sistema di purificazione della proteina con una portata di associazione di 2 mL/min e un tasso di flusso di eluizione di 4 mL/min ad eccezione di gel-filtrazione a 1 mL/min.

2. proteina preparazione e cristallizzazione

  1. Concentrare il campione proteico purificato a 10 mg/mL utilizzando concentratore centrifugo (10 kDa MWCO) e lo scambio di buffer buffer cristallizzazione prima della conservazione a-80 ° C.
  2. Eseguire lo screening di cristallizzazione (rapporto 1:1, 200 nL di proteina e 200 nL del buffer serbatoio) di seduta drop metodo di diffusione del vapore a 295 K con diversi kit di cristallizzazione utilizzando un liquido automatico movimentazione robotizzata in un formato a 96 pozzetti.
    Nota: Abbiamo utilizzato i kit da ricerca dimensioni molecolari e Hampton e il Grifone automatizzato sistema di gestione dei liquidi.
  3. Sigillare la piastra 96 pozzetti cristallizzazione per evitare l'evaporazione e abilitare l'equilibrazione della proteina goccia con il buffer di serbatoio. Quindi tenere le piastre nell'incubatore cristallo a 18 ° C.
  4. Controllare le piastre da 96 pozzetti periodicamente utilizzando un microscopio ottico per monitorare la crescita e la formazione di cristalli.
  5. Per distinguere i cristalli della proteina da cristalli di sale, usare un colorante di proteina. Aggiungere 1 µ l di colorante per il drop di destinazione. Attendere circa 1 h e osservare al microscopio. I cristalli della proteina diventerà blu.
  6. Utilizzare le condizioni di cristallizzazione positivo (solfato di ammonio di 1,5 M, 0.1 M Tris-HCl pH 8.0) per ottimizzare ulteriormente i cristalli con impiccagione vapor-diffusione metodo drop in piastre da 24 pozzetti.
    1. Ottimizzare pH da 7.0 a 8.5 con intervallo di unità di pH 0,5 ogni passo. Ottimizzare la concentrazione di solfato di ammonio da 1,2 M a 1,7 M con intervallo di 0,1 M ogni passo. (Nel nostro caso la migliore condizione producendo grandi cristalli a forma di piastra era solfato dell'ammonio 0,1 M HEPES pH 7.0 e 1.6 M)

3. Crystal montaggio, raccolta di dati di raggi x e determinazione della struttura

  1. Montare i cristalli in un cryoloop e flash-cool in azoto liquido con serbatoio soluzione contenente 20% glicerolo come cryo-protectant. Posizionare i cristalli in unipuck per immagazzinaggio e trasporto.
  2. Pre-schermo cristalli della proteina usando un diffractor di raggi x in-House Verian. Scegliere i migliori con le risoluzioni più alte per la raccolta di dati presso sincrotrone (nostro dataset è stato raccolto da BL17U1 presso Shanghai Synchrotron Radiation Facility).
    1. Utilizzare il software di controllo beamline BluIce26 per montare e centrare i cristalli dalla funzione di centraggio automatica o manuale. Eseguire le esposizioni di prova per determinare la strategia di raccolta dei dati, compreso l'avvio di angolo, tempo di esposizione, distanza rivelatore, Larghezza telaio e numeri.
    2. Raccogliere il dataset di conseguenza (abbiamo raccolto 180 telai con 1 tempo di esposizione di s, Larghezza telaio 1° e la distanza di rivelatore di 350 mm).
  3. Indice, integrare e scalare il dataset utilizzando HKL2000 suite27. Prima di svolgere la funzione di ricerca di picco per trovare i punti di diffrazione e quindi i punti di indice e selezionare il gruppo giusto spazio. Dopo l'integrazione del picco, scala il dataset con il modello corretto errore e salvare il file di output. SCA.
  4. Risolvere il problema di fase di rimontaggio molecolare usando Phaser28 PHENIX29.
    1. Calcolare il numero di possibili copia di molecole proteiche nell'unità asimmetrica di Xtriage30.
    2. Cercare i modelli di struttura adeguata con la somiglianza strutturale e di identità in sequenza ad alta come la proteina dell'obiettivo utilizzando strutture note dalla letteratura o i modelli generati da server di predizione di struttura come Phyre231 (abbiamo usato coniglio RyR1 NTD come un modello di ricerca, PDB ID 2XOA).
    3. Eseguire Phaser utilizzando il file di dati di diffrazione, il file di struttura del modello e il file di sequenza della proteina per trovare la soluzione.
  5. Eseguire AutoBuild32 PHENIX29 per generare il modello iniziale utilizzando il file di output da Phaser e il file di sequenza da proteina bersaglio.
  6. Costruire la struttura nella densità dell'elettrone sperimentale modificate utilizzando folaga33 e perfezionare usando phenix.refine34 in cicli iterativi manualmente.
  7. Convalidare il modello finale utilizzando gli strumenti di convalida di PHENIX18.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Purificazione

Il dominio N-terminale di RyR DBM è stato espresso come proteina di fusione con un tag di hexahistidine, un tag MBP e un sito di clivaggio della proteasi TEV. Abbiamo seguito una strategia di cinque fasi di purificazione per ottenere una proteina altamente pura, adatta a scopo di cristallizzazione. In un primo momento, la proteina di fusione è stata purificata dalla frazione solubile del lysate delle cellule di colonna Ni-NTA (HP HisTrap). Successivamente, la proteina di fusione è stato sottoposto a fenditura di proteasi TEV e la frazione di hexahistidine-MBP è stato rimosso dalla colonna di resina di amilosio seguita da colonna Ni-NTA. Inoltre, la proteina è stata purificata mediante colonna a scambio anionico (Q Sepharose HP) e infine dalla colonna di gel-filtrazione (Superdex 200 26/600). La resa finale di proteina purificata da coltura batterica 1L utilizzando 2YT media era ~ 4 mg. La proteina purificata ha mostrato una singola banda su SDS-PAGE al ~ 21 kDa (Figura 1). Il volume di eluizione da colonna di gel-filtrazione ha confermato il NTD RyR purificato per essere un monomero (Figura 1).

Cristallizzazione

Cristallizzazione iniziale di screening in piastre da 96 pozzetti dato i cristalli in diverse condizioni. Queste condizioni sono state selezionate per l'ottimizzazione di cristallo in 24 piatti ben. La condizione più ottima dove si formarono cristalli forma dei piatti di alta qualità era 0.1 M HEPES pH 7.0 e 1.6 M di solfato di ammonio (Figura 2).

Determinazione della struttura

Cristalli ottenuti era diffratte a 2,84 Å su beamline BL17U1 presso Shanghai Synchrotron Radiation Facility. Il cristallo è stato indicizzato nel gruppo spazio P61 con parametri di cella unitaria un = 170.13, b = 170.13, c = 51.763 Å, α = β = 90,00 °, γ = 120 °. Per la determinazione della struttura, sostituzione molecolare è stata impiegata utilizzando coniglio RyR1 NTD come un modello di ricerca in PHENIX. Ulteriore perfezionamento della struttura è stato fatto in PHENIX a un finale Rlavorare e Rgratuito di 21,63 e 24,52%, rispettivamente. Le statistiche di dati raccolta e raffinatezza sono elencate nella tabella 1. La struttura solved di DBM RyR NTD coprendo i residui 1-205 (PDB ID 5Y9V) è mostrata in Figura 3.

Figure 1
Figura 1: cromatogramma di filtrazione di SDS-PAGE e gel che rappresenta la purificazione di DBM RyR NTD35. SDS PAGE (15%) nella rientranza Mostra purificato DBM RyR NTD come una singola banda dopo i cinque passi per una strategia di purificazione. La corsia di sinistra viene illustrato proteina standard marcatore (PM). Il cromatogramma di filtrazione di gel ottenuto utilizzando una colonna di Superdex 200 26/600 Mostra il picco di eluizione a 240 mL, che corrisponde alla forma monomerica della proteina. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2. Cristallizzazione di DBM RyR NTD35Cristalli di DBM RyR NTD prodotta con metodo vapor-diffusione come si è visto sotto un microscopio chiaro. La condizione di cristallizzazione era solfato dell'ammonio 0,1 M HEPES pH 7.0 e 1.6 M. Barra della scala = 200 µm. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: Struttura del DBM RyR NTD (PDB ID 5Y9V)35Risolto la struttura della proteina mostrata da due punti di vista. Elementi di struttura secondaria sono etichettati. Filamenti β sono visualizzati in viola. Α elica e un'elica10 3 sono mostrati in blu. Loop sono mostrate in bianco. NT e Ct rappresentano il N-terminale e C-terminale della proteina, rispettivamente. Clicca qui per visualizzare una versione più grande di questa figura.

Tabella 1: statistiche di dati raccolta e raffinatezza per il cristallo di DBM RyR NTD35. Per favore clicca qui per scaricare questa tabella.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In questo articolo, descriviamo la procedura per recombinantly esprimere, purificare, cristallizzare e determinare la struttura di DBM RyR NTD. Per cristallizzazione, un requisito fondamentale è quello di ottenere proteine con omogeneità, purezza e solubilità alta. Nel nostro protocollo, abbiamo scelto di utilizzare animali-28a-HMT vettoriale in quanto contiene un tag hexahistidine e MBP, entrambi i quali potrebbero essere utilizzati per la purificazione ottenere una maggiore purezza di piega. Inoltre, gli aiuti di tag MBP di solubilità della proteina bersaglio. Abbiamo purificato della proteina da cinque passaggi consecutivi che ha prodotto la proteina che era altamente puro e adatto per cristallizzazione. Selezione di cristallizzazione è stata realizzata utilizzando il sistema di gestione automatizzata di liquido. Rispetto al tradizionale proiezione dall'impostazione manuale goccia, sistema automatizzato utilizza molto piccoli volumi di campione, fa risparmiare tempo ed energia. Si migliora anche la riproducibilità grazie alla precisione di manipolazione dei liquidi. Cristalli sono state diffratte internamente per screening e al sincrotrone per la raccolta dati quanto fornisce raggi x con maggiore intensità e meno divergenza, producendo quindi dati di alta qualità. Sostituzione molecolare era la nostra prima scelta come modelli strutturali simili erano disponibili nel database. Il metodo alternativo consiste nell'utilizzare fasatura sperimentali, tra cui MAD, SAD, MIR, ecc.

Mentre risolvere la struttura del DBM RyR NTD, i coefficienti di Matthews ottenuti da Xtriage30 ha suggerito che l'unità asimmetrica (ASU) molto probabilmente conteneva quattro monomeri con 46% contenuto di solvente, che ha una probabilità del 49%. Tuttavia, non abbiamo trovato la soluzione giusta con quattro molecole in ASU. Le esecuzioni successive a guardare per due, tre, cinque, sei molecole non è riuscito. Alla fine abbiamo trovato la soluzione giusta con soltanto una molecola in ASU, che ha solo 4% di probabilità e oltre 86% contenuto di solventi. L'elevato contenuto di acqua è stata confermata dopo abbiamo risolto la struttura. Così, l'alto contenuto di solvente estremo esistono a seconda del modo intrinseco in quali confezioni di proteina.

Anche se la cristallografia a raggi x è un gold-standard nella determinazione della struttura della proteina, proteine con grande disordine o regioni flessibile e alcuni complessi di grande proteina con debole affinità sono difficili da cristallizzare. Metodi di ingegneria della proteina, compreso ciclo-troncamento, superficie entropia riduzione e cross-linking, potrebbe migliorare le possibilità di ottenere migliore cristalli della proteina. Oltre a svelare delle strutture proteiche ad alta risoluzione, cristallografia a raggi x utilizzabile anche per studiare le interazioni della proteina-pesticidi, che ci avrebbero aiutato il disegno basato sulla struttura dei pesticidi. Qi et al. , trovato che diverse famiglie di diamides potrebbero associare ai siti distinti che sono diversi in tutta specie36. Utilizzando la nostra strategia, uno può determinare le strutture di RyR dalle specie multiple ed individua gli elementi unici responsabili per la condiziona osservato. Nel complesso, questo protocollo può essere adattato per la determinazione di espressione, purificazione, cristallizzazione e struttura di proteine o domini proteici da soli o in complesso con farmaci piccola molecola.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgements

Finanziamenti per questa ricerca è stata fornita da: nazionali chiave di ricerca e sviluppo programma della Cina (2017YFD0201400, 2017YFD0201403), National Nature Science Foundation of China (31320103922, 31230061) e programma di progetto di ricerca base nazionale (973) di Cina (2015CB856500, 2015CB856504). Siamo grati al personale la beamline BL17U1 a Shanghai Synchrotron Radiation Facility (SSRF).

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics